Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Stenlund, P.
Right arrow Articles by Tibell, L. A.E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stenlund, P.
Right arrow Articles by Tibell, L. A.E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Protein Engineering, Vol. 12, No. 4, 319-325, April 1999
© 1999 Oxford University Press

Chimeras of human extracellular and intracellular superoxide dismutases. Analysis of structure and function of the individual domains

Peter Stenlund and Lena A.E. Tibell1

Department of Biochemistry, Umeå University, S-901 87 Umeå, Sweden


    Abstract
 Top
 Abstract
 Introduction
 Results and discussion
 Materials and methods
 References
 
Human extracellular superoxide dismutase (hEC-SOD) is a secreted tetrameric protein involved in protection against oxygen free radicals. Since EC-SOD is too large a protein for structural determination by multi-dimensional NMR and attempts to crystallize the protein for X-ray structural determination have failed, the three-dimensional structure of hEC-SOD is unknown. By fusion protein techniques we have previously shown that an amphipathic {alpha}-helix in the N-terminal domain of hEC-SOD is essential for the tetramer interaction. However, the central domain, which is homologous to intracellular hCuZnSOD, has also been proposed to be involved in the tetramer formation. Despite great efforts, the production of recombinant hEC-SOD in prokaryotic systems or simple eukaryotes (such as yeast) has failed. This lack of success has greatly complicated large-scale production and genetic engineering of the protein. In the study reported here, we constructed two chimeras comprising the N- or the N- and C-terminal domains from hEC-SOD fused to hCuZnSOD, called FusNCZ and PseudoEC-SOD, respectively. We show that these proteins can be produced in large quantities in Escherichia coli, that they can be purified with high yields and that the characteristics of PseudoEC-SOD closely resemble those of hEC-SOD. Further, we extended our studies of the nature of the subunit interaction by investigating the involvement of the central domain.

Keywords: extracellular superoxide dismutase/heparin affinity/heterologous expression/protein fusion/subunit interaction


    Introduction
 Top
 Abstract
 Introduction
 Results and discussion
 Materials and methods
 References
 
Aerobic organisms have developed an array of defense mechanisms against oxygen free radicals, important components of which are superoxide dismutases (SODs). These metalloenzymes are present in most aerobic organisms and serve to catalyze the dismutation of superoxide radicals. In all mammalian cells, two different types of CuZn-containing SOD enzymes are produced, one intracellular (CuZnSOD) and one extracellular form (EC-SOD). In humans most EC-SOD is found in extracellular matrices, associated with heparan sulfate proteoglycans, and much smaller amounts are found in plasma, lymph, synovial fluid and cerebrospinal fluid.

Every biological macromolecule can serve as a target for the damaging action of the abundant oxygen radical. A wide range of degenerative processes and diseases have also been coupled with the action of oxygen radicals such as aging (Orr and Sohal, 1994Go), reperfusion damage of ischemic tissue (Hatori et al., 1992Go), oncogenesis, inflammatory actions (Fridovich, 1986Go) and motor neurone degeneration (McCord, 1994Go). Interest has therefore evolved in the therapeutic potential of SOD enzymes and a wide range of clinical applications have been suggested.

Extra- and intra-cellular Cu- and Zn-containing SOD enzymes catalyze the dismutation reaction with about the same efficiency and have very similar kinetic parameters. The central part of the human (h)EC-SOD sequence is clearly homologous with the sequence of the intracellular hCuZnSODs. However, hEC-SOD, in contrast to intracellular hCuZnSOD, is a glycoprotein and it contains one N-terminal and one C-terminal domain with no counterparts in intracellular hCuZnSOD.

The three-dimensional structure of CuZnSOD is well known (Tainer et al., 1982Go) but determination of the three-dimensional structure of EC-SOD by X-ray crystallography has failed owing to difficulties in crystallizing the protein. The cause of this failure is probably the heterogeneous glycosylation of hEC-SOD. A variant lacking the glycosylation site has been produced, but its solubility was found to be too low for the protein to be useful for crystallization (Edlund et al., 1992Go). The protein is unfortunately too large for structure determination by NMR. With the exception of the first 10 amino acids, the sequence of the central domain of hEC-SOD (amino acids 60–194) can be modeled on the structure of hCuZnSOD (Figure 1BGo).



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 1. Ribbon diagrams of hCuZnSOD and hEC-SOD. (A) hCuZnSOD based on X-ray data (1spd from Brookhaven Protein Data Bank; Deng et al., 1993Go). (B) Residues 60–194 from the central domain of hEC-SOD homology modeled by a fully automated procedure according to Peitsch (1996). Refinement of the primary structure was made with CHARMm.

 
One of the characteristic properties of hEC-SOD is its binding to sulfated glycosaminoglycans such as heparin and to heparan sulfate (Marklund, 1982Go). The C-terminal domain of EC-SOD has been shown to be essential for this binding (Inoue et al., 1990Go; Sandstrom et al., 1992Go).

Further, we showed recently that a fusion protein composed of the C-terminal domain from hEC-SOD fused to human carbonic anhydrase II (HCAII), forms a monomeric protein that binds to heparin-Sepharose with approximately the same affinity as hEC-SOD. Previous NMR results demonstrate that the C-terminal domain of both the fusion protein and hEC-SOD moves independently from the rest of the protein and that the central part of the domain is involved in conformational exchange (Tibell et al., 1997Go).

hEC-SOD is a tetrameric protein whereas intracellular hCuZnSOD is a dimer. It has been proposed by Carlsson et al. (1996) that the tetrameric hEC-SOD is held together by the N-terminal domain as a dimer of two dimers, which in turn is held together by a dimer contact area analogous to that found in the dimeric intracellular hCuZnSOD. In CuZnSOD, the dimer interface is located close to where the N- and C-termini protrude from the globular protein. If we assume that the central part of hEC-SOD (residues 49–196) is structurally homologous to hCuZnSODs, the N- and C-terminal domains of hEC-SOD must be folded close to each other (Figure 1AGo) and, at least partly, occupy the area corresponding to the subunit interaction surface in hCuZnSOD. Despite strong similarities between the sequences of hEC-SOD and hCuZnSOD, many of the residues that are involved in the dimer contacts and which are evolutionarily conserved in the CuZnSODs are not conserved in hEC-SOD. This is true especially for the regions that correspond to the N- and C-termini of CuZnSODs (Tibell et al., 1996Go). Earlier results from our laboratory (Tibell et al., 1996Go; Stenlund et al., 1997Go) have shown that the principal component in the formation of tetramers in hEC-SOD is the N-terminal domain.

Studies of structural and functional relationships of the different domains of EC-SOD require genetic engineering and mutagenesis, which are far more easy to achieve in prokaryotic than in eukaryotic systems. However, the exploration of hEC-SOD has been partly hindered by its limited availability. Since the production of hEC-SOD in CHO cells gives relatively small amounts of the protein (Tibell et al., 1987Go), considerable effort has been devoted, without success, to the expression of hEC-SOD in prokaryotes such as Escherichia coli. Attempts to produce the enzyme in yeast have also been discouraging. Interestingly, expression of the intracellular hCuZnSOD in E.coli (Hartman et al., 1986Go) and yeast (Hallewell et al., 1987Go) gives high yields of protein. We report here the production and characterization of two fusion proteins, which is part of a project designed to overcome some of these problems. One of these proteins comprises the N-terminus of hEC-SOD fused to the N-terminus of hCuZnSOD (FusNCZ) and the other comprises the N-terminal and C-terminal domains of hEC-SOD fused to the N-and C-termini of hCuZnSOD, respectively, resulting in a mimic of hEC-SOD (PseudoEC-SOD). In this study we also compared the characteristics of the fusion proteins and hEC-SOD. In addition, a number of mutated forms of PseudoEC-SOD were used to elucidate the nature of the subunit interaction of hEC-SOD and the role of the dimer contact surface present in intracellular hCuZnSOD.


    Results and discussion
 Top
 Abstract
 Introduction
 Results and discussion
 Materials and methods
 References
 
Expression and isolation of FusNCZ and PseudoECSOD

The fusion proteins FusNCZ and PseudoECSOD (Figure 2Go) were produced in E.coli resulting in high yields (Figure 3Go, lanes 1 and 7). After cell disruption, essentially all of the enzyme remained in the supernatant (Figure 3Go, lanes 2 and 8), indicating that the fusion proteins are highly soluble in bacteria. Moreover, almost all of the detected SOD activity was sensitive to 1 mM KCN, indicating that the activity corresponded to CuZnSOD and not to bacterial SOD enzymes.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Outline of the fusion constructs (FusNCZ and PseudoEC-SOD) with domains from hCuZnSOD and hEC-SOD. Light gray, domain from hCuZnSOD; black, the N-terminal domain of hEC-SOD (a.a. 1–49); dark gray, the C-terminal domain (a.a. 197–222); white, the central part of hEC-SOD (a.a. 49–196).

 


View larger version (58K):
[in this window]
[in a new window]
 
Fig. 3. Coomassie Brilliant Blue-stained SDS–PAGE slab gel showing the PseudoEC-SOD and FusNCZ in different purification steps. Left gel (PseudoEC-SOD): lane 1, total cell extract; lane 2, supernatant of the cell extract after centrifugation; lane 3, cell extract after heat incubation; lane 4, PseudoEC-SOD after purification; lane 5, molecular weight markers. Right gel (FusNCZ): lane 6, molecular weight markers; lane 7, total cell extract; lane 8, supernatant after centrifugation; lane 9, FusNCZ after purification.

 
Isolation procedures for the fusion proteins were developed, an example of which is given for PseudoEC-SOD in Table IGo. The isolation of FusNCZ followed the same scheme with the exception that the heparin-Sepharose step was replaced with a phenyl-Sepharose chromatographic step.


View this table:
[in this window]
[in a new window]
 
Table I. Purification protocol for PseudoECSOD
 
PseudoEC-SOD was purified by a four-step purification method with high yield (Table IGo). An initial heat incubation efficiently removed contaminating proteins with almost no loss of fusion protein (Figure 3Go, lane 3). The subsequent chromatographic steps mainly removed specific protein contaminants without any dramatic increase in specific activity. However, size-exclusion chromatography on Superose 12 removed the other major contaminant, nucleic acids (Figure 3Go, lane 4). The increase in yield to over 100% after the ion-exchange chromatographic step might reflect stabilization of the protein or removal of inhibitory agents.

Both intracellular and extracellular CuZnSOD enzymes are heat stable to 60–70°C (Tibell et al., 1993Go) and the heat treatment provided a very efficient purification step with high recovery (Table IGo). To assess whether the heat treatment changed any of the characteristics of the fusion proteins, all proteins and mutated variants were isolated in two parallel alternative purification sequences, one with and one excluding the heat-incubation step. When the properties of the resulting proteins were compared, no difference in physico-chemical properties [as measured by specific activity, size-exclusion chromatography, circular dichroism (CD) and heparin affinity] could be detected for any of the proteins (data not shown). However, when the heat incubation step was excluded, small amounts of contaminant remained in the sample.

During the production and isolation of the fusion proteins, three different problems were identified. The copper content in the resulting fusion proteins was often insufficient and the copper was often apparently replaced by zinc. Partial proteolysis of PseudoEC-SOD (especially of the C-terminal domain) often occurred and became more pronounced on prolonged storage. Finally, contaminating nucleic acids were difficult to separate from the fusion proteins.

The first problem was alleviated by altering the copper and zinc concentrations in the growth medium (Table IIIGo) to 3 mM copper and 30 µM zinc. Coexpression with the human copper chaperone for SOD (CCS) (Culotta et al., 1997Go) might be an alternative to improve further the in vivo incorporation of copper. Addition of protease inhibitors and heat treatment during the isolation process reduced the proteolysis but did not prevent it completely. We conclude that the C-terminal domain is most sensitive to proteolysis since prolonged storage of PseudoEC-SOD often resulted in loss of heparin affinity. The observation that no proteolysis problems were observed in the FusNCZ protein, which does not contain the C-terminal domain, supports this conclusion. Contaminating nucleic acid was degraded by addition of DNase and RNase to the homogenization buffer (a second addition was made after the initial heat incubation if this step was applied). Neither the ion-exchange nor the heparin-Sepharose chromatographic step separated the nucleic acid fragments from the fusion proteins. Hydrophobic chromatography on phenyl-Sepharose partly removed the nucleic acid fragments but size-exclusion chromatography was the most efficient method for removal of nucleic acids (Table IGo).


View this table:
[in this window]
[in a new window]
 
Table III. Activity and metal content in SOD enzymes
 
The heparin-Sepharose chromatographic step cannot be used for the purification of FusNCZ, since this fusion protein lacks the heparin-binding C-terminal domain (Figure 1Go). An alternative purification step with phenyl-Sepharose was therefore developed.

Characterization of the proteins

A number of analyses were carried out to verify the identity of the fusion proteins. Amino acid sequencing of the N-terminus of FusNCZ and PseudoEC-SOD was confirmed by N-terminal sequencing (not shown). The fusion proteins reacted with antibodies directed against hCuZnSOD and with antibodies directed against hEC-SOD (Table IGo).

One of the characteristic properties of hEC-SOD is its binding to sulfated glycosaminoglycans such as heparan sulfate and heparin and to heparin-Sepharose (Marklund, 1982Go; Karlsson et al., 1988Go). Several reports have shown that the C-terminal domain of EC-SOD is essential for binding to heparin (Inoue et al., 1990Go; Sandstrom et al., 1992Go; Tibell et al., 1997Go). The affinity of the proteins for heparin-Sepharose, as determined by the NaCl concentration needed to elute them from a heparin-Sepharose column, is compared in Table IIGo. PseudoEC-SOD was shown to elute at an NaCl concentration of 0.45 M, which is lower than that needed for the elution of hEC-SOD, 0.55 M (Table IIGo).


View this table:
[in this window]
[in a new window]
 
Table II. A comparison of physico-chemical properties of fusion and native proteins
 
The specific activities of the fusion proteins were approximately the same for PseudoEC-SOD as for hCuZnSOD and hEC-SOD if the occupancy of Cu and Zn in the metal sites is taken into account (Table IIIGo) since the measured activity is proportional to the copper content. The monomeric mutated hCuZnSOD (F50E/G51E ) was reported to have ~10% of the specific activity of the native form (Bertini et al., 1994Go). This seems to be the case also for the PseudoEC-SOD mutant V24D/F50E/G51E (Table IIIGo) if the copper content is considered.

The isoelectric point for PseudoEC-SOD was about one pH unit higher than for hEC-SOD, which probably reflects the higher pI for the fused hCuZnSOD.

Molecular masses of the purified fusion proteins were determined by mass spectrometry (Table IIGo). These values matched the predicted molecular masses well, while the apparent subunit molecular masses of the fusion proteins, as measured by SDS–PAGE, were 28 and 30 kDa for FusNCZ and PseudoEC-SOD, respectively, and deviated about 22% from the predicted molecular masses (Table IIGo). This deviation is in the same range as that reported earlier for hCuZnSOD (Table IIGo and as reported by Hartman et al., 1986Go). The results from analysis of the native molecular mass by size-exclusion chromatography show that FusNCZ, PseudoEC-SOD and EC-SOD are tetramers, whereas hCuZnSOD is a dimer. This clearly shows that fusion of the N-terminal domain of hEC-SOD to the dimeric hCuZnSOD protein induces tetramerization of the fusion proteins. However, the role of the dimer interaction of hCuZnSOD in the tetramerization of the fusion proteins cannot be determined from these results.

The CD spectra of PseudoEC-SOD and Fus NCZ were recorded in the far-UV (Figure 4Go) and near-UV (results not shown) regions and compared with the corresponding spectra for hCuZnSOD and hEC-SOD. The spectra in the far-UV region (Figure 4Go) indicate a well defined secondary structure for all four proteins. As can be seen in Figure 4Go, the spectra of FusNCZ and Pseudo-ECSOD are very similar to the corresponding spectrum of hEC-SOD. When compared with the spectrum of hCuZnSOD, they all show an increase and a slight shift of the positive band, which has a maximum in the hCuZnSOD spectrum at ~190 nm, to a band at ~194 nm as in hEC-SOD. In addition, the negative band at 210 nm in the hCuZnSOD spectrum is more intense and shifted to lower wavelengths in the fusion proteins and hEC-SOD. Furthermore, the shoulder at ~222 nm in the spectra of hEC-SOD and the fusion proteins is absent in the spectrum of hCuZnSOD. These results imply that the N-terminal domain contributes {alpha}-helical structural elements to FusNCZ and PseudoEC-SOD, a conclusion supported by the earlier studies of the N-terminal domain fused to HCAII (Stenlund et al., 1997Go).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4. Far-UV CD spectra (180–260 nm) of hEC-SOD, hCuZnSOD and fusion proteins FusNN, with accompanying curves: hEC-SOD (—); hCuZnSOD (– - –); PseudoEC-SOD (– –); FusNCZ (- - -).

 
The CD spectra in the near-UV region are very weak for all the proteins, including hEC-SOD, and exhibit no fine structure. The explanation of this most probably is that the tryptophan residues are mobile and therefore do not contribute to the spectra (results not shown).

In summary, we have reported here, for the first time, the successful production and purification of an hEC-SOD analogous protein (PseudoEC-SOD) in E.coli, with characteristics closely resembling those of hEC-SOD. This protein can be produced in large quantities and can easily be genetically manipulated. Hence PseudoEC-SOD might be a very helpful tool for further investigation of the action of EC-SOD and might have interesting medical applications.

Introduction of mutations in subunit interaction interfaces

Our previous studies have shown that fusion of the N-terminal domain of hEC-SOD with the monomeric protein human carbonic anhydrase resulted in a tetrameric fusion protein (Tibell et al., 1996Go). The hydrophobic side of a predicted amphipathic {alpha}-helix (formed by residues 14–32) in this N-terminal domain was shown to be essential for the subunit interaction in this hybrid protein (Stenlund et al., 1997Go). To investigate the relevance of these results in a protein with very close structural and functional resemblance to hEC-SOD, five mutant forms of PseudoEC-SOD were constructed. In three of the mutant forms, amino acid residues on the hydrophobic side of the predicted {alpha}-helix at positions 17, 24 and 31 (I17D, V24D and V31D) were altered. In a fourth mutant variant, amino acid residues 50 and 51 in the hCuZnSOD sequence were altered (F50E/G51E). These mutations are at the dimer interface of hCuZnSOD and have been shown earlier to produce a monomeric species of hCuZnSOD (Bertini et al., 1994Go). In the fifth mutant variant, amino acid residue 24 in the N-terminal domain and amino acid residues 50 and 51 in the hCuZnSOD part of the fusion protein (V24D/ F50E/G51E) were altered. This variant combines mutations that have been shown to disrupt subunit interactions in N-terminal fusion proteins and hCuZnSOD. The five mutant variants of Pseudo-EC-SOD were produced, isolated and characterized by size-exclusion chromatography (Table IVGo) and CD spectroscopy (Figure 5Go).


View this table:
[in this window]
[in a new window]
 
Table IV. Apparent molecular weight of each of the native fusion proteins as estimated by chromatography on a Superose 12 HR 10/30 column (Pharmacia Biotech)
 


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5. Far-UV CD spectra (180–260 nm) of PseudoEC-SOD and its mutants, with accompanying curve lines: PseudoEC-SOD (– –); I17D (- - -); V24D (– - –); V31D (– - –); F50E/G51E (– - - –); V24D/F50E/G51E (—).

 
The mutations in positions 24 and 31 in the {alpha}-helix of the N-terminal domain resulted in the formation of dimeric proteins. The corresponding mutations in the fusion protein with HCAII have been shown earlier to form a mixture of monomers and dimers (Stenlund et al., 1997Go). The mutation in position 17 of the N-terminal domain resulted in a pure tetramer in PseudoEC-SOD but, as described earlier, in 70% tetramer and 30% monomer in the HCAII fusion (Stenlund et al., 1997Go). Hence the subunit interaction seems to be somewhat more stable in the PseudoEC-SOD than in the fusion proteins with carbonic anhydrase. This conclusion is supported by the CD results since, according to the CD spectra in the far-UV region (Figure 5Go), the secondary structure seems to be less disturbed in the PseudoEC-SOD mutants than in the corresponding mutants of the HCAII fusion with the N-terminal domain (Stenlund et al., 1997Go). An explanation of these observations could be that the central hCuZnSOD-domain in PseudoEC-SOD has a stabilizing effect on the N-terminal domain. Alternatively, the dimer interface of the hCuZnSOD part of PseudoEC-SOD can become functional when the N-terminal interactiones are perturbed. However, on comparing the subunit interaction region in hCuZnSOD with the corresponding residues in the modeled central domain of hEC-SOD (Figure 6Go), several of the residues shown to be involved in the dimer interaction, which are conserved among CuZnSOD enzymes, are not conserved in hEC-SOD (Tibell et al., 1996Go). Inspection of the models shows that these residues are predominantly found close to the area where the N- and C- termini protrude in CuZnSOD and where the N- and C-terminal domains in hEC-SOD most likely fold (Figures 1 and 6GoGo). Therefore, the possible interactions that involve direct subunit contacts between the central domains of hEC-SOD might be less extensive than observed for the well characterized subunit contacts in hCuZnSOD. To test further whether the interactions between the N-terminal domains are sufficient for the formation of stable tetramers, we decided to destroy the hCuZnSOD-dimer contact surface in PseudoEC-SOD. We chose the F50E/G51E double mutation because it has been shown to give monomeric hCuZnSOD (Bertini et al., 1994Go). The resulting PseudoEC-SOD variant was purely tetrameric (Table IVGo), strongly indicating that the interactions between the N-terminal domains are sufficient for the formation of stable tetramers. The mutation (V24D) in the N-terminal domain disturbs the subunit contact in PseudoEC-SOD and gives dimers (Table IVGo). If this mutation is added to the F50E/G51E variant (V24D/F50E/G51E), the resulting protein is monomeric (Table IVGo).



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 6. Comparison of the amino acid residues involved in the dimerization of hCuZnSOD and corresponding residues in hEC-SOD. (A) hCuZnSOD; amino acid residues involved in the dimer interaction are colored dark blue. (B) A model of the central domain of hEC-SOD (residues 60–194); corresponding residues which are identical are colored dark blue and those with conserved properties are colored light blue. The C-terminal amino acid residues are colored red in both structures. The N-terminal in hCuZnSOD is colored green. The N-terminus in the modeled central domain of hEC-SOD is unmarked, since the amino acid residues 50–59 could not be modeled on to the N-terminal of hCuZnSOD.

 
These results together with results from the earlier studies of N-termimal fusions with HCAII (Tibell et al., 1996Go; Stenlund et al., 1997Go) clearly show that the N-terminal domain is responsible for the tetramer formation in PseudoEC-SOD and that the hydrophobic side of the predicted amphipathic {alpha}-helix is essential for the subunit interaction. The dimer interaction of intracellular hCuZnSOD is not essential for subunit interactions (tetramer formation) in PseudoEC-SOD and, since the corresponding putative subunit contacts in the central domain of hEC-SOD are less extensive (Figure 6Go), we propose this dimer contact to be of less importance.


    Materials and methods
 Top
 Abstract
 Introduction
 Results and discussion
 Materials and methods
 References
 
Construction and production of the fusion proteins

The cDNA coding the human intracellular CuZnSOD was isolated from a human lymphocyte cDNA library (CD4 Positive Jurkat T, Clontech) made in the cloning vector {lambda}gt 11, by polymerase chain reaction (PCR) using the oligonucleotides 5'CACGCCGCCTGCCAGGTGCAGCCGGCGACGAGGCCGTGTGCGTGCTG3' and 5'GTGAAAGTGAAACTGAATCAATCTGTTATTGGGCGATCCCAATTACACC3'.

The gene fusions were made using a plasmid, pACNN, constructed for expression of another fusion protein, FusNN, described earlier (Tibell et al., 1996Go). To construct the gene fusion corresponding to the protein FusNCZ (where the N-terminal 49 amino acids of hEC-SOD are fused to the N-terminal of hCuZnSOD) we used sticky-feet mutagenesis (McPherson et al., 1991Go) using the isolated PCR-fragment.

The 25 amino acid C-terminal of hEC-SOD was isolated from a human placenta cDNA library (kindly provided by J.L.Millan) by PCR using the oligonucleotides 5'GTGGTGTAATTGGGATCGCCCAACCCGGGCTCTGGGAGCGCCAG3' and 5'CAGTGAACCAAGTGAAGTTCTGCAGCTCAGGCGGCCTTGCACTCGC3'.

The resulting DNA-fragment was subsequently fused to the 3'-end of the FusNCZ gene by sticky-feet mutagenesis, resulting in a fusion called PseudoEC-SOD.

For construction of the five mutants we used site-directed mutagenesis essentially according to the method of Kunkel (1985) with the slight modification described by Mårtensson et al., (1995). DNA sequencing of the entire coding region, using the chain-termination method of Sanger et al. (1977), confirmed the fusion proteins and the mutations.

The fusion proteins were produced essentially as described earlier (Mårtensson et al., 1995Go) with the modification of adding 3 mM CuSO4 and 30 µM ZnSO4 at the time of induction. Cultures of 2–2.5 l with an OD660 of ~1.2 were harvested by centrifugation. The bacteria were resuspended in a homogenization buffer containing 50 mM potassium phosphate, pH 7.8, 0.01 mg/ml DNase, 0.01 mg/ml RNase, 0.3 mM PMSF and 1 mM EDTA. In addition, Complete protease inhibitor cocktail tablets (Boehringer Mannheim) were dissolved in the homogenization cocktail according to the manufacturer's instructions. The resuspended bacteria were homogenized using a bead-beater and after centrifugation for 45 min at 20 000 r.p.m., the supernatant was collected for protein purification.

Purification

Heat denaturation. Contaminating proteins were denatured by incubating 10 ml samples of the supernatant from the homogenized cells at 60° C for 20 min followed by centrifugation.

Anion chromatography. The sample containing fusion protein was applied to an anion-exchange chromatographic column (40x2.6 cm), Q-sepharose FF, pre-equilibrated with 20 mM potassium phosphate buffer, pH 7.0. After applying the sample, the column was washed with this buffer plus 0.2 M NaCl and the fusion protein was eluted in a pulse of 0.5 M NaCl in the buffer. The flow-rate was 7 ml/min during the entire chromatographic process.

Hydrophobic chromatography. To a sample containing the fusion protein, sodium phosphate was added to a final concentration of 1 M and the pH was adjusted to 9.0. A phenyl-Sepharose FF column (10x1 cm) was equilibrated with 1 M sodium phosphate, pH 9.0, the sample was applied and the column was washed with this buffer. The fusion protein was eluted with 250 mM sodium phosphate, pH 9.0, and strongly binding contaminating proteins were washed out with 10 mM sodium phosphate, pH 9.0. The flow rate was 2 ml/min throughout the chromatography.

Heparin-Sepharose. The sample containing fusion protein was applied to a heparin-Sepharose column (14.5x1.6 cm) pre-equilibrated with 10 mM sodium phosphate buffer, pH 7.5, and washed after application of the sample with this buffer. The fusion protein was eluted with the same buffer containing 450 mM NaCl. The flow rate was 6.6 ml/min during the entire process.

Size-exclusion chromatography. Size-exclusion chromatography was performed on a Superose 12 HR 10/30 column (Pharmacia Biotech), using 10mM sodium phosphate, pH 7.6, and 0.15 M NaCl as eluent, an elution rate of 0.5 ml/min, an injection volume of 200 µl and protein concentrations of ~1.5 mg/ml. If necessary, the samples were concentrated before application.

Purification procedures. FusNCZ, PseudoEC-SOD and the mutated PseudoEC-SOD protein variants were purified either with or without initial heat incubation of the supernatant after cell disruption. The next purification step was anion chromatography on Q-Sepharose FF, followed by either phenyl-Sepharose chromatography for FusNCZ or dialysis and heparin-Sepharose chromatography for the PseudoEC-SOD proteins. Size-exclusion chromatography and a final concentration step removed nucleic acids.

Analysis of fusion proteins

The SOD activity was measured according to Marklund and Marklund (1974). The N-terminal amino acid sequence was determined in an Applied Biosystems Model 477A sequencing system. Protein extinction coefficients were determined according to the method of Gill and von Hippel (1989). SDS–PAGE was performed on a discontinuous polyacrylamide gel system (Jergil and Olsson, 1974Go) containing 14.9% acrylamide and 0.1% SDS. For Western blotting, the proteins were transferred to an Immobilone-P membrane (Millipore, Bedford, MA) by standard methods. Blots were developed using highly purified rabbit anti-EC-SOD, rabbit anti-hCuZnSOD or rabbit anti-HCAII and alkaline phosphatase-labeled anti-rabbit-IgG antibodies (Dakopats, Copenhagen, Denmark). Isoelectric focusing was carried out using a PhastGel IEF 3–9 gradient medium and a Pharmacia PhastSystem instrument. Metal contents were determined by electrothermal atomic absorption spectrometry in a Perkin-Elmer Zeeman 303 + HGA apparatus. Analytical heparin-Sepharose chromatography was carried out at room temperature as described previously (Karlsson et al., 1988Go). The apparent molecular weight of each of the native fusion proteins was estimated by chromatography on a Superose 12 HR 10/30 column (Pharmacia Biotech) (Stenlund et al., 1997Go). Circular dichroism (CD) spectra were recorded at 23°C on a CD6 spectrodichrograph (Jobin-Yvon Instruments, Longjumeau, France) essentially as described by Freskgård et al. (1994). Far-UV spectra of the proteins were recorded in a 0.5 mm quartz cell at a protein concentration of 0.25– 0.4 mg/ml in 5 mM sodium phosphate, pH 7.6, and presented as mean residue weight ellipticities (MRW) (Freskgård et al., 1994Go) on the basis of a molecular weight of 24.55 kDa and 228 amino acids.


    Acknowledgments
 
This work was supported by grants from Stiftelsen Lars Hiertas Minne, Magnus Bergvalls Stiftelse, Åke Wibergs Stiftelse, JC Kempes Minnes Stipendiefond and Carl Tryggers Stiftelse. We thank Eleonore Skärfstad, Marie Ellingsen, Malin Jonsson, Christer Köhler, Rafael de Antonio Gutierrez and Annica Rönnbäck for skilful technical assistance and Per-Ingvar Olsson for performing the mass spectrometric measurements.


    Notes
 
1 To whom correspondence should be addressed. E-mail: lena.tibell{at}chem.umu.se Back


    References
 Top
 Abstract
 Introduction
 Results and discussion
 Materials and methods
 References
 
Adachi,T., Yamada,H., Yamada,Y., Morihara,N., Yamazaki,N., Murakami,T., Futenma,A., Kato,K. and Hirano,K. (1996) Biochem. J., 313, 235–239.

Bertini,I., Piccioli,M., Viezzoli M.S., Chiu,C.Y. and Mullenbach,G.T. (1994) Eur. Biophys. J., 23, 167–176.[Web of Science][Medline]

Carlsson,L.M., Marklund,S.L. and Edlund,T. (1996) Proc. Natl Acad. Sci. USA, 93, 5219–5222.[Abstract/Free Full Text]

Culotta,V.C., Klomp,L.W.J., Strain,J., Casareno,R.L.B., Krems,B. and Gitlin,J.D. (1997) J. Biol. Chem., 19, 23469–23472.

Deng,H.X. et al. (1993) Science, 261, 1047–1051.[Abstract/Free Full Text]

Edlund,A., Edlund,T., Hjalmarsson,K., Marklund,S.L., Sandström,J., Strömqvist,M. and Tibell,L. (1992). Biochem. J., 288, 451–456.

Freskgård,P.O., Mårtensson,L.G., Jonasson,P., Jonsson,B.H. and Carlsson,U. (1994) Biochemistry, 33, 14281–14288.[Medline]

Fridovich,I. (1986) Arch. Biochem. Biophys., 247, 1–11.[Web of Science][Medline]

Gill,S.C. and Von Hippel,P.H. (1989) Anal. Biochem., 182, 319–326.[Web of Science][Medline]

Hallewell,R.A., Mills,R., Tekamp-Olson,P., Blacher,R., Rosenberg,S., Ötting,F., Masiarz,F.R. and Scandella,C.J. (1987) Biotechnology, 5, 363–366.

Hartman,J.R., Geller,T., Yavin,Z., Bartfeld,D., Kanner,D., Aviv,H. and Gorecki,M. (1986) Proc. Natl Acad. Sci. USA, 83, 7142–7146.[Abstract/Free Full Text]

Hatori,N., Sjöquist,P.O., Marklund,S.L., Pehrsson,S.K. and Rydén,L. (1992) Free Rad. Biol. Med., 13, 137–42.[Web of Science][Medline]

Inoue,M., Watanabe,N., Morino,Y., Tanaka,Y., Amachi,T. and Sasaki,J. (1990) FEBS Lett., 269, 89–92.[Web of Science][Medline]

Jergil,B. and Olsson,R. (1974) Eur. J. Biochem., 46, 13–25.[Web of Science][Medline]

Karlsson,K., Lindahl,U. and Marklund,S.L. (1988) Biochem. J., 256, 29–33.[Web of Science][Medline]

Kunkel,T.A. (1985) Proc. Natl Acad. Sci. USA, 82, 488–492.[Abstract/Free Full Text]

Marklund,S.L. (1982) Proc. Natl Acad. Sci. USA, 79, 7634–7638.[Abstract/Free Full Text]

Marklund,S. and Marklund,G. (1974) Eur. J. Biochem., 47, 469–474.[Web of Science][Medline]

Mårtensson,L.G., Jonasson,P., Freskgård,P.O., Svensson,M., Carlsson,U. and Jonsson,B.H. (1995) Biochemistry, 34, 1011–1021.[Medline]

McCord,J.M (1994) Science, 266, 1586–1587.[Free Full Text]

McPherson,J, Quirke,P. and Tylor,G.R. (1991). PCR. A Practical Approach. IRL Press, New York, pp. 204–207.

Orr,W. and Sohal,R.S. (1994) Science, 263, 1128–1130.[Abstract/Free Full Text]

Peitsch,M.C. (1996) Biochem. Soc. Trans., 24, 1 274–279.[Web of Science][Medline]

Sandstrom,J., Carlsson,L., Marklund,S.L. and Edlund,T. (1992) J. Biol. Chem., 267, 18205–18209.[Abstract/Free Full Text]

Sanger,F., Nichlen,S. and Coulson,A.R. (1977) Proc. Natl Acad. Sci. USA, 74, 5463–5467.[Abstract/Free Full Text]

Stenlund,P., Andersson,D. and Tibell,L., (1997) Protein Sci., 6, 2350–2358.[Web of Science][Medline]

Tainer,J.A., Getzoff,E.D., Beem,K.M., Richardson,J.S. and Richardson,D.C. (1982) J. Mol. Biol., 160, 181–227.[Web of Science][Medline]

Tibell,L., Hjalmarsson,K., Edlund,E., Skogman,G., Engström,Å. and Marklund,S. (1987) Proc. Natl Acad. Sci. USA, 84, 6634–6638.[Abstract/Free Full Text]

Tibell,L., Aasa,R. and Marklund,S.L. (1993) Arch. Biochem. Biophys., 304, 429–43.[Web of Science][Medline]

Tibell,L., Skärfstad,E. and Jonsson,B.H. (1996) Biochim. Biophys. Acta, 1292, 47–52.[Medline]

Tibell, L., Sethson,I. and Buevich,A.V. (1997) Biochim. Biophys. Acta, 1340, 21–32.[Medline]

Received August 28, 1998; revised November 26, 1998; accepted December 11, 1998.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
S. V. Petersen, T. D. Oury, Z. Valnickova, I. B. Thogersen, P. Hojrup, J. D. Crapo, and J. J. Enghild
The dual nature of human extracellular superoxide dismutase: One sequence and two structures
PNAS, November 25, 2003; 100(24): 13875 - 13880.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
B. Gao, S. C. Flores, J. A. Leff, S. K. Bose, and J. M. McCord
Synthesis and anti-inflammatory activity of a chimeric recombinant superoxide dismutase: SOD2/3
Am J Physiol Lung Cell Mol Physiol, June 1, 2003; 284(6): L917 - L925.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
M. Angelova, P. Dolashka-Angelova, E. Ivanova, J. Serkedjieva, L. Slokoska, S. Pashova, R. Toshkova, S. Vassilev, I. Simeonov, H.-J. Hartmann, et al.
A novel glycosylated Cu/Zn-containing superoxide dismutase: production and potential therapeutic effect
Microbiology, June 1, 2001; 147(6): 1641 - 1650.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (12)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Stenlund, P.
Right arrow Articles by Tibell, L. A.E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stenlund, P.
Right arrow Articles by Tibell, L. A.E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?