Protein Engineering, Vol. 12, No. 7, 597-604,
July 1999
© 1999 Oxford University Press
scFv multimers of the anti-neuraminidase antibody NC10: length of the linker between VH and VL domains dictates precisely the transition between diabodies and triabodies
CSIRO Molecular Science and CRC for Diagnostic Technologies, 343 Royal Parade, Parkville, Victoria, 2 Biomolecular Research Institute, 343 Royal Parade, Parkville, Victoria, Australia 3052 and 3 Medical Research Council, Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, UK
| Abstract |
|---|
|
|
|---|
Single-chain Fv antibody fragments (scFvs) incorporate a polypeptide linker to tether the VH and VL domains together. An scFv molecule with a linker 512 residues long cannot fold into a functional Fv domain and instead associates with a second scFv molecule to form a bivalent dimer (diabody). Direct ligation of VH and VL domains further restricts association and forces three scFv molecules to associate into a trivalent trimer (triabody). We have defined the effect of linker length on scFv association by constructing a series of scFvs from anti-neuraminidase antibody NC10 in which the linker varied from one to four glycine residues. NC10 scFv molecules containing linkers of three and four residues showed a strong preference for dimer formation (diabodies), whereas a linker length of one or two glycine residues prevented the formation of diabodies and directed scFv association into trimers (triabodies). The data suggest a relatively strict transition from dimer (diabody) to trimer (triabody) upon reduction of the linker length from three to two glycine residues. Modelling studies are consistent with three residues as the minimum linker length compatible with diabody formation. Electron microscope images of complexes formed between the NC10 scFv multimers and an anti-idiotype Fab' showed that the dimer was bivalent for antigen binding and the trimer was trivalent.
Keywords: antibody/diabody/dimers/single-chain Fvs/shorter linkers/triabody/trimers
| Introduction |
|---|
|
|
|---|
The antigen binding domain of an antibody can be expressed in Escherichia coli as a single-chain molecule (scFv) in which the VH and VL domains of the antibody are joined by a flexible polypeptide linker (Bird et al., 1988
12 residues, the VH domain is unable to bind to its attached VL domain in the Fv orientation. Instead, complementary VH/VL pairs from two separate scFv molecules combine to form a bivalent dimer, termed a diabody (Holliger et al., 1993
Modelling studies based on the X-ray crystal structure of a diabody (five-residue linker scFv) showed that reducing the linker to `just one or two residues' seriously strained the diabody association (Perisic et al., 1994
). The definition of linker length is imprecise because the last residue held in contact within the VH domain framework is unique for each antibody. For example, the NC10 (anti-neuraminidase) triabody was defined as a linkerless scFv with direct ligation of the terminal residue in VH (SerH112) to the N-terminal residue of VL (AspL1), whereas the B18/NQ11 triabody (Pei et al., 1997
) and 111G10 triabody (Iliades et al., 1997
) included an additional residue, SerH113, between VH and VL domains. Indeed, it was noted that in the B18/NQ11 triabody, the orientation of VH to VL domains in the Fv modules was distorted and a CDR loop structure was misplaced. A report of a linkerless scFv monospecific `diabody' library (McGuiness et al., 1996) further confused the field since the molecular mass of these `diabodies' was not determined and many were likely to be triabodies.
To clarify the effect of linker length on scFv association, we have modelled NC10 diabodies and triabodies, constructed a series of scFvs from NC10 with linkers of one, two, three and four amino acids and determined which linker length changes the preferred conformation of the multimer from a dimer to a trimer. Our results show that linkers of three residues or greater are required for diabody formation whereas two residues or less enable scFvs to associate into active trimers.
| Materials and methods |
|---|
|
|
|---|
Sequence numbering
Antibody residues were numbered according to Kabat et al. (1991) and for NC10 correspond exactly to Malby et al. (1993). Residues in the VH domain of the scFv were superscripted with H and the residue number; for example SerH112 signifies serine in position 112 of the VH domain. Similarly, residues in the VL domain of the scFv were superscripted L and the residue number.
Molecular modelling
Computer-generated models of NC10 scFv diabodies and triabodies were constructed using Fv modules that corresponded to the coordinates of the NC10 Fv domain in PDB entry 1NMB (Malby et al., 1994
, 1998
). Fv modules were manipulated as rigid bodies with the O molecular graphics package (Jones et al., 1991
) such that the diabody structure and gross alignment of linkers corresponded to the crystal structure described by Perisic et al. (1994) and the triabodies corresponded to the model described by Kortt et al. (1997). Thus, the diabodies comprised two Fv modules with twofold symmetry and triabodies comprised three Fv modules with threefold symmetry. No attempt was made to model conformational changes in the Fv domains. The figures were prepared using Molscript (Kraulis, 1991
).
Construction and expression of NC10 scFv with linkers of one, two, three and four glycine residues
The starting template for construction of the scFvs was the `zero-linked' NC10 scFv0 gene construct in the vector pPOW (Kortt et al., 1997
), in which the 3' end of the VH sequence (codon for SerH112) is linked directly to the 5' end of the VL sequence (codon for AspL1).
Four sets of complementary nucleotides (Table I
) were used to mutate pPOW NC10 scFv0, inserting codons for one, two, three and four glycine residues between codons for SerH112 and AspL1 using QuikChange site-directed mutagenesis (Stratagene Cloning Systems, La Jolla, CA), thus creating scFv1, scFv2, scFv3 and scFv4. In each reaction, 15 ng of pPOW NC10 scFv0 plasmid DNA were subjected to PCR in a 50 µl reaction volume containing 5 µl of reaction buffer, as supplied with the kit, 20 pmol of the purified complementary oligonucleotide primer pairs, 2.5 nmol of each dNTP and 2.5 units of Pfu DNA polymerase. Thermal cycling conditions were as follows: (95°C, 30 s) 1 cycle; (95°C, 30 s; 55°C, 1 min; 68°C, 12 min) 18 cycles. A 1 µl volume of DpnI restriction enzyme (20 U/µl) was then added to each sample and incubated at 37°C for 90 min. E.coli XL1-Blue cells (Stratagene, 1x109 cfu/µg) were then transformed by electroporation with 2 µl of each reaction mix at 1.8 kV in 0.1 cm pathlength cuvettes (BioRad Laboratories). After the addition of 500 µl of SOC medium, aliquots of the cells were plated on to YT/amp200 and incubated overnight at 30°C. Ten individual colonies were selected from each transformation, plasmid DNA was prepared and sequenced across the region targeted for mutation, using Sequenase version 2.0 (Amersham Life Sciences) with the oligonucleotide primer TACATGCAGCTCAGCAGCCTGAC, a sequence in the VH region 5' to the mutation site.
|
Clones containing the correct sequence insertion were subjected to expression in 5 ml of YT/amp200 as described by Malby et al. (1993). A small culture sample (10 µl) was probed by Western blot analysis using anti-FLAG M2 antibody, which reacts with the C-terminal epitope tag (FLAG) present in the constructs (Hopp et al., 1988
Each pPOW-scFv construct was expressed in 500 ml of 2YT/amp200 as described by Malby et al. (1993), using E.coli strain HB2151 as host. The scFv protein was located in the periplasm as insoluble aggregates associated with the membrane fraction, as found previously for NC10 scFv15, 5 and 0 (Malby et al., 1993
; Kortt et al., 1997
). The scFv protein was purified as described by Kortt et al. (1997). Cells were sonicated in 100 ml of phosphate-buffered saline, pH 7.4 (PBS), centrifuged and the cell pellet was extracted with 50 ml of 6 M guanidinium hydrochloride, 0.1 M TrisHCl, 5 mM EDTA, pH 8.0. The extract was dialysed against PBS and insoluble material removed by centrifugation. The soluble fraction (supernatant) was then passed over an affinity column of immobilized anti-FLAG M2 antibody (Eastman Kodak, New Haven, CT) and bound protein was eluted with Gentle Elution Buffer (Pierce Chemical, Rockford, IL). The eluted protein was concentrated and dialysed against PBS, pH 7.4, containing 0.02% (w/v) sodium azide and stored frozen.
Estimation of molecular mass of NC10 short-linkered constructs
The relative molecular mass of each affinity-purified NC10 short-linkered scFv was compared by size-exclusion gel chromatography on a Superose 12 HR 10/30 column (Pharmacia) in PBS, pH 7.4, calibrated with BioRad Gel Filtration Standard proteins (thyroglobulin, Mr 670 kDa; bovine
-globulin, Mr 158 kDa; chicken ovalbumin, Mr 44 kDa; equine myoblobin, Mr 17 kDa; vitamin B-12 Mr 1.35 kDa). The flow-rate was 0.5 ml/min and the absorbance of the effluent stream was monitored at both 214 and 280 nm. Peak elution times were also compared with those of NC10 scFv0 trimer and NC10 scFv5 dimer from previous runs on the same column.
Formation of complexes with 32 G12 anti idiotype Fab'
Fab' fragments of the NC10 anti-idiotype antibody 32 G12 were prepared as described by Kortt et al. (1997). Purified NC10 scFv2 triabody and scFv3 diabody from Superose 12 gel chromatography were mixed with a small excess of 32G12 anti-idiotype Fab' in approximately 1:3 and 1:2 molar ratios, respectively, as described by Kortt et al. (1997). The complexes were separated from excess Fab' by size-exclusion chromatography on Superose 6 (HR 10/30) in PBS, pH 7.4, with a flow-rate of 0.5 ml/min. The column had previously been calibrated with preformed scFv5/Fab' and scFv0/Fab' complexes and uncomplexed scFv2, scFv3 and 32G12 Fab'.
Electron microscopy
Complexes of scFv2 and scFv3 with 32 G12 Fab' were prepared for electron microscope imaging and data analysis as described previously (Lawrence et al., 1998
). Complexes of NC10 Fab' and influenza neuraminidase (soluble tetrameric extracellular domain) were prepared according to Malby et al. (1994) and imaged as described previously (Lawrence et al., 1998
). The complexes were diluted in PBS1% glutaraldehyde to concentrations of the order of 0.010.03 mg/ml, applied to glow-discharged carbon-coated 400-mesh gold grids and stained with 2% potassium phosphotungstate at pH 6.0. Micrographs were recorded at 60 kV in a JEOL 100B transmission electron microscope at a magnification of 100 000x. Magnification was calibrated as described by Tulloch et al. (1986) by recording the size of influenza virus neuraminidase (100 Å) in single molecule images when complexed with NC10 Fab'.
Particle dimensions (arm lengths and internal inter-arm angles) were measured from the coordinates of digitized micrographs of 211 diabodies and 128 triabodies as described by Lawrence et al. (1998). Interpretation of the observed angles was based upon considerations presented by Lawrence et al. (1998). In particular, diabody projections were selected only if similar Fab arm lengths were observed in the molecule to ensure that the observed internal inter-arm angle represented the angle between Fab arms lying flat on the support film. Diabody projections with Fab arms of unequal length were disregarded since the Fab arms could be tilted out of the plane of the film or could arise from staining artifacts, radiation damage or dehydration of the protein.
| Results |
|---|
|
|
|---|
Molecular modelling of shorter linker scFvs
The molecular models (C
traces) depicted in Figure 1
represent single conformations of NC10 scFv diabodies and triabodies in which the linker length between the C-terminus of VH and N-terminus of VL domains is reduced from four glycine residues to zero. All the conformations in Figure 1
are plausible and there are no steric clashes between side-chain atoms. Dimers with four and three residue linkers are shown in two different orientations, each rotated 90° to the other, with the scFv4 diabody depicted in Figure 1a and c
and the scFv3 diabody depicted in Figure 1b and d
. The orientation in Figure 1a and b
corresponds to the that reported in Perisic et al. (1994). In the diabodies (Figure 1ad
), the regions of the Fv modules in closest proximity to each other are between the `backs' or C-terminal surface of the VH domains across the twofold symmetry axis (i.e. between loops distal to the CDRs). As the scFv linker is reduced from four residues to three, the range of orientations between the two Fvs that were sterically allowed was progressively restricted by contacts between the VH domains (compare Figure 1c
for scFv4 with Figure 1d
for scFv3). When the scFv linker was further reduced to two residues (scFv2), the diabody could not be modelled as there were no viable orientations of the Fv domains free from side-chain steric clashes. Instead, three scFv2 molecules could be modelled into a triabody association with threefold symmetry (Figure 1e
) with a range of allowed orientations between Fv modules. The regions of the Fv modules in closest proximity in triabodies are the VH domains, between loops distal to the CDRs. Clashes between VH domain loops restricted the range of allowed Fv orientations when the linker was reduced from two residues to direct ligation of VH and VL domains together as an scFv0 `zero linker' molecule (Figure 1f
). The scFv constructions described below provide protein chemical data on the state of these diabodies and triabodies, both in solution and when complexed with anti-idiotype Fab'.
|
Construction of NC10 scFvs with linkers of one to four glycine residues
Four NC10 scFvs with short linkers, scFv1, scFv2, scFv3 and scFv4, were constructed in the pPOW expression vector as described in Materials and methods. The DNA sequence of each scFv construct was confirmed in both orientations to ensure that the correct sequence had been inserted between the VH and VL domains (data not shown). Each scFv construct was assessed by expression and Western blot analysis on SDSPAGE using mouse anti-FLAG M2 antibody and shown to encode an scFv of the expected size including the C-terminal FLAG tag epitope (~27 kDa; data not shown). The scFv product was recovered in the supernatant fraction following solubilization of the bacterial pellet in 6 M guanidine hydrochloride, dialysis against PBS and centrifugation to remove insoluble material. The scFvs were affinity purified using an anti-FLAG M2 antibody column (Kortt et al., 1997
).
Molecular mass of short-linkered NC10 scFvs
Samples of affinity-purified scFv1, scFv2, scFv3 and scFv4 were shown by SDSPAGE and Western blot analysis to comprise predominantly scFv of the expected molecular mass (~27 kDa). The samples were individually subjected to analysis by size-exclusion gel chromatography on a calibrated Superose 12 column (Figure 2
). The major peaks of each of the scFvs showed the following distribution. Peaks of scFv1 and scFv2 eluted at the same time as the zero-linked scFv0 (~23 min; Mr
70 000 Da), previously shown to be a trivalent trimer (Kortt et al., 1997
). The major peaks for scFv3 and scFv4 showed elution times identical with that found previously for NC10 scFv5 (~24.5 min; Mr
52 000 Da), previously shown to be a bivalent dimer (Kortt et al., 1997
). The results clearly demonstrate a precise delineation into two groups; scFv1 and scFv2 formed trimers similar to scFv0 whereas scFv3 and scFv4 formed dimers similar to scFv5. The small peak eluting at ~23 min in the scFv3 and scFv4 profiles could indicate the presence of small amounts of trimer. There was insufficient material to investigate this further. The small shoulder eluting at 26.5 min is possibly Fv monomer, produced by proteolytic cleavage as observed by Kortt et al. (1997). Compared with the size of the major peaks, these minor components represented between 10 and 15% of the recovered recombinant product.
|
The high molecular mass material at the column void volume (~14 min) had previously been shown (for scFv0; Kortt et al., 1997
Formation of complexes with 32 G12 anti idiotype Fab' fragments
32G12 is an anti-idiotype monoclonal antibody which competes with influenza virus neuraminidase for binding to NC10. Complexes were formed by mixing scFv2 or scFv3 isolated by gel filtration in a 1:3 or 1:2 molar ratio, respectively, with the Fab' fragment of 32G12, an anti-idiotype antibody. The Fab' was kept in slight excess of these ratios to ensure complete decoration of all antigen binding sites present. The complexes were separated from excess Fab' on a previously calibrated Superose 6 column (Figure 3
). Elution times of uncomplexed scFv2, scFv3 and the complexes of scFv0/Fab' and scFv5/Fab' (Kortt et al., 1997
) are indicated by arrows. The complexes eluted as single peaks, well separated from unbound Fab'. There was no evidence of any uncomplexed scFv2 or scFv3 in either separation. The complex formed between scFv2 and 32G12 Fab eluted as a single peak at 27.4 ± 0.15 min averaged from several chromatographic analyses. The elution time is identical with that observed for the scFv0/Fab' complex, which was found to have a molecular mass of ~235 000 Da (Kortt et al., 1997
) and is consistent with the mass of a complex of three Fab' molecules (Mr
52 000 Da each) and one scFv2 trimer (Mr
78 500 Da). The scFv-3 complexed with 32G12 Fab' eluted at 28.6 ± 0.1 min, averaged from several chromatographic analyses. The elution time is identical with that observed for the scFv5Fab' complex, shown previously to have a molecular mass of ~156 000 Da (Kortt et al., 1997
), which is consistent with a complex comprising two 32G12 Fab' molecules and one scFv3 dimer (Mr
52 000 Da).
|
The estimated molecular mass of scFvanti-idiotype Fab' complexes is consistent with the prediction that scFv3 diabodies are bivalent and bind two Fab' fragments and that scFv2 triabodies are trivalent and bind three Fab' fragments.
Electron microscopy of NC10 scFvs complexed with 32G12 Fab' fragments
The complex of scFv3 and 32G12 Fab' was isolated by gel filtration on Superose 6 (Figure 3
) and imaged by electron microscopy. Images of the complex appeared predominantly as boomerang-shaped projections (each arm ~100110 Å in length) with the internal angle between the two arms ranging from 60 to 180° (Figure 4a
). These images were similar to those observed previously for scFv5 diabodies complexed with 32G12 Fab', which showed similar projections consistent with two Fab molecules extending outwards from the antigen binding sites (Lawrence et al., 1998
). Despite the potential `elbow' flexibility between Fv and C modules in the Fab', each Fab' arm appeared as a relatively rigid, linear molecular rod (Tulloch et al., 1986
; Lawrence et al., 1998
). Relatively rigid Fab arms were also observed in free 32G12 anti-idiotype Fabs under the same imaging conditions (data not shown) and also in complexes of NC10 Fab with influenza neuraminidase tetramers (Figure 4c
). In the neuraminidase complexes, the four NC10 Fab arms extend radially from the central neuraminidase core, consistent with the high-resolution crystal structure (Malby et al., 1998
).
|
In the scFv3 diabody complexes with 32G12 Fab' (Figure 4a
|
ScFv2 complexed with 32G12 Fab' appeared as both Y- and V-shaped projections (Figure 4b
The V-shaped projections (Figure 4b
) were interpreted as tripod-shaped objects lying on their sides on the carbon film, with one Fab' leg extending upward and partially out of the stain. The vertical Fab' leg increased the projected density at the base of the V-shaped structures (Figure 4b
) and produced a very different image to the boomerang-shaped diabody complexes which frequently had decreased stain at the centre (Figure 4a
). This is consistent with the expected models (Figure 1
). The interpretation of tripods lying on their side is also consistent with the appearance of a few projections with all three Fab' legs pointing in the same direction.
Measurement of inter-arm angles for the Y-shaped projections of scFv2 and scFv0 triabody complexes showed similar distributions of all angles measured (Table III
). The three Fab legs were separated by angles of mean 88, 121 and 149° (Table III
) with a significant difference between the smallest and largest angles. However, the range of angles was such that for ~10% of particles the legs were evenly spaced with angles all 120° (±5°), consistent with the model of threefold symmetry (Figure 1
).
|
| Discussion |
|---|
|
|
|---|
A series of short-linkered scFvs of the anti-neuraminidase antibody NC10 have been produced in which the linker length between VH and VL domains was sequentially decreased from four glycine residues (scFv4) to one glycine residue (scFv1). Previous studies have established that NC10 scFv5 (five residueGly4Ser linker) exists predominantly as a dimer (Kortt et al., 1997
A precise definition of the N- and C-terminal residues of VL and VH is required when considering short-linkered scFvs in which the configuration is VHlinkerVL. In the case of NC10, the terminal residues were selected after examination of the 2.4 Å resolution structure from X-ray diffraction analysis of the NC10 Fab-NA complexes (Malby et al., 1994
, 1998
). SerH112 was selected as the VH C-terminus because it was not in any direct hydrogen-bonded contact with other VH domain residues, whereas ThrH110 and ValH111 contacted framework residues ValH12 and SerH87, respectively. The VL N-terminal residues were defined as AspIleGlu in which side-chain atoms in AspL1 and IleL2 contacted framework residues GluL3 and ThrL97. Therefore, VH SerH112 was joined to VL AspL1 in the gene constructions encoding NC10 scFv15 using linkers of 15 residues (Gly4Ser)3 (Malby et al., 1993
, Kortt et al., 1994
) and scFv5 diabodies with five residue linkers (Gly4Ser) (Kortt et al., 1997
). Likewise, VH SerH112 was joined directly to VL AspL1 for the gene encoding scFv0 (triabody; Kortt et al., 1997
). In the refined crystal structures of NC10 scFv15 and NC10 scFv5 complexed with the antigen neuraminidase, the electron density is poor for both the linker region and the VH C-terminal residue SerH112 (Malby et al., 1998
), indicating that there is some flexibility in the designated VH C-terminus.
Other reported gene constructions encoding diabodies (five residue linkers) or triabodies (directly linked VH to VL cassettes) have included an additional residue, SerH113, as the C-terminus of the VH domain (Holliger et al., 1993
; Perisic et al., 1994
; Holliger et al., 1996
, Iliades et al., 1997
; Pei et al., 1997
). Our analysis based upon the NC10 structure predicts that the additional residue is part of the flexible linker, not part of the V-domain framework.
Valency of the NC10 scFv3 diabody and scFv2 triabody was determined by forming complexes with anti-idiotype 32G12 Fab' which were purified and subjected to two independent analytical methods. First, the molecular mass was assessed using size-exclusion columns that had been calibrated with preformed complexes of scFv-5 diabodies and scFv-0 triabodies with 32G12 Fab'. The mass of scFv-3 complexes was identical with that of scFv-5 diabody complexes (~156 kDa) and consistent with one diabody binding two Fab' molecules. The mass of scFv-2 complexes was identical with that of scFv-0 triabody complexes (~235 kDa) and was consistent with one triabody binding three Fab molecules. The complexes were stable and could be stored either at 4°C for several weeks or frozen and thawed as required. Based on the rate of complex formation and stability, the functional affinity (avidity) of the diabodies and triabodies is similar to that reported previously for the scFv5 diabody and scFv0 triabody (Kortt et al., 1997
).
In the second method of analysis, electron microscopy of scFv3 diabodies complexed with 3G12 Fab revealed boomerang-shaped projections which are interpreted as two Fab arms extending from the antigen binding sites. These images confirmed our previous observations with scFv5 (Lawrence et al., 1998
) that diabodies are unlikely to form the rigid `back-to-back' structure revealed in the scFv crystal structure for the NC10 scFv-15 (monomer) complexed to NA (Kortt et al., 1994
). Analysis of the projections after densitometry revealed a similar angular distribution between Fab arms in the boomerang-shaped projections for scFv3 compared with scFv5 (mean 116° and 122°, respectively; Table II
). This indicates that there is considerable flexibility in the linker region joining the two Fv modules in an orientation consistent with a `twisted' or bent diabody structure similar to that modelled by Holliger et al. (1993, 1996) (see Figure 1
) and confirmed in a crystal structure of a five-residue linker diabody (Perisic et al., 1994
). However, in modelling studies of the L5MK16 diabody (Holliger et al., 1996
) the predicted angle between the Fv domains was >122° and ranged from 138 to 166°. A few Y-shaped projections (~3%) in the scFv3 diabody complexes could be interpreted as triabody complexes similar to scFv0 (Lawrence et al., 1998
). No trimers were observed in preparations of NC10 scFv5/Fab' complexes (Lawrence et al., 1998
). This implies that, unlike scFv5, the scFv3 molecules have a weak propensity to associate into trimers rather than dimers. The size-exclusion chromatographic profiles are consistent with a small percentage of trimers eluting before the dimer peak for scFv3. How do scFv-3 triabodies form? One possible interpretation is that two scFv3 molecules initially combine by association of a single VH to a single VL, allowing combination with a third scFv3 molecule through the uncomplexed VH or VL domains only if the correct diabody pairing is not immediately formed. Formation of trimers with scFv3 was observed to be more prevalent than with scFv5 and presumably the shorter three residue linker restricts V-domain flexibility and increases the time required for complete diabody association.
NC10 scFv2 forms exclusively triabodies and electron micrograph images of complexes with three 32G12 Fab molecules showed Y-shaped projections similar to previous images of scFv0 complexes (Lawrence et al., 1998
). Y-shaped projections are characteristic of a trivalent molecule binding three Fab molecules. These images are consistent with the interpretation that the three Fab' projections of the trimerFab' complex are not coplanar, but are angled together in one direction like the legs of a tripod, consistent with the triabody model of NC10 scFv0 (Figure 1
). However, triabodies are obviously flexible molecules since only 10% of the projections have three equal inter-arm angles of 120° (±5°), consistent with the rigid model of threefold symmetry (Figure 1e and f
). The observed distribution of angles between Fab arms in the scFv2 triabody complexes ranged around three angles of mean 88, 121 and 149°. These results did not differ significantly from those observed for scFv0/Fab' triabody complexes (Lawrence et al., 1998
). The molecular models of scFv2 and scFv0 triabodies show that the contacts between Fv modules are minimal and would allow considerable flexibility without steric constraints even with scFv0. V-shaped images exhibited a distinctive feature of increased density at the base of the V that was interpreted as the projection of the third arm of the tripod pointing upwards (Figure 4b
). The V-shaped triabody images were clearly different to the boomerang-shaped projections of diabody complexes (Figure 4a
), which had distinctly wider inter-arm angles and low density at the central bend of the boomerang. No projections with the appearance of diabody complexes were observed in the triabody complex images. Since the triabodyFab complexes are stable in solution and all three antigen combining sites have equivalent affinity (Iliades et al., 1997
; Kortt et al., 1997
), it is unlikely that one Fab leg has dissociated from the complex to form the V-shaped projections. Also, imaging of purified triabody preparations did not reveal free Fab' molecules in the proportion that would be expected: in fact, very few free Fabs were observed.
Flexibility and binding affinity in diabodies and triabodies
It is tempting to speculate that the trimeric conformation (triabodies) will predominate over dimers (diabodies) for other antibody scFv fragments with a linker length of less than three residues and that the transition between scFv3 and scFv2 will be generic. The molecular models depicted in Figure 1
support this interpretation; when the linker is reduced from four residues to three the orientation of Fv modules is restricted by interactions between the VH domains across the twofold symmetry axis. There are numerous steric clashes when the linker is further reduced to two residues (the scFv2 could not be built as a diabody in a sterically allowed conformation). However, it is likely that association between Fv modules will depend on both linker flexibility and unique interface interactions. Linker flexibility will be affected by the choice of inserted residues (we used highly flexible glycine residues) and the choice of the C-terminal residue in VH and N-terminal residue in VL which might be constrained by interactions to the V-domain framework. Interface interactions across the Fv interface in diabodies and triabodies are almost exclusively between VH domains when scFvs are in the VHVL orientation (Holliger et al., 1996
; Pei et al., 1997
; Malby et al., 1998
). The detailed interactions across the Fv interfaces will obviously be unique to each scFv and will affect both flexibility and stoichiometry of diabodies and triabodies. We can only hypothesize that NC10 will be representative of other antibody scFv molecules.
The gain in functional affinity through multivalent binding (often termed avidity; Kortt et al., 1997
; Pluckthun and Pack, 1997
) makes trimeric scFvs attractive for in vivo tumour imaging as an alternative reagent to diabodies (Wu et al., 1996
; Zhu et al., 1996
; Adams et al., 1998
; FitzGerald et al., 1998) and multivalent chemical conjugates (Adams et al., 1993
; McCartney et al., 1995
; Antoniw et al., 1996
; Casey et al., 1996
). The gain in functional affinity for scFv trimers compared with scFv monomers is apparently due to reduced off-rates which result from both multiple binding and rebinding to the target antigens (Kortt et al., 1997
, Pluckthun and Pack, 1997
). There is also the added advantage of reduced blood clearance rates for triabodies over diabodies and scFv monomers which is relevant to in vivo applications. Multiple binding to surface-bound antigens is dependent on correct alignment and orientation in the Fv modules of diabodies and triabodies. If multiple binding is not sterically possible, particularly for surface-bound antigens, then apparent gains in functional affinity are likely to be small and due only to the effect of increased rebinding, which is dependent on diffusion rates and surface antigen concentration. Antigen orientation also affects the ability of diabodies and triabodies to bind simultaneously to multiple antigens on a cell surface and this factor is particularly important in the design of any therapeutic reagent required to cross-link surface receptors on either the same or adjacent cells (Pack et al., 1995
; Pluckthun and Pack, 1997
). Indeed, receptor cross-linking and enhanced cell activation have recently been demonstrated using intact Ig molecules conjugated together into flexible dimers (Ghetie et al., 1997
). Flexibility in both scFv diabodies and triabodies is evident in our single-molecule imaging studies. The effect of manipulating linker length, sequence and structure on diabody and triabody stability and flexibility can now be analysed using single-molecule imaging of anti-idiotype complexes. The ability of triabodies to cross-link surface receptors is unknown and will obviously depend on flexibility between the Fv modules and the orientation of the antigen binding sites, as well as the structure of the receptor. Furthermore, the construction of tricistronic expression vectors should allow the production of trispecific scFv0 trimers capable of cross-linking different target antigens, with obvious applications in specific cell recruitment and activation.
| Acknowledgments |
|---|
The authors thank Professors D.Metzger and R.Webster for providing the 32G12 and NC10 hybridoma cell lines, Dr D.Hewish for preparing the 32G12 antibodies, J.Burns for assistance with protein purification and chromatographic analysis and Drs K.Maxwell and T.Garrett for assistance with modelling using Molscript.
| Notes |
|---|
1 To whom correspondence should be addressed. E-mail: john.atwell{at}molsci.csiro.au
| References |
|---|
|
|
|---|
Adams,G.P. et al. (1993) Cancer Res., 53, 40264034.
Adams,G.P., Schier,R., McCall,A.M., Crawford,R.S., Wolf,E.J., Weiner,L.M. and Marks,J.D. (1998) Br. J. Cancer, 77, 14051412.[Web of Science][Medline]
Antoniw,P. et al. (1996) Br. J. Cancer, 74, 513524.[Web of Science][Medline]
Atwell,J.L., Pearce,L.A., Lah,M., Gruen,L.C., Kortt,A.A. and Hudson,P.J., (1996) Mol. Immunol., 33, 13011312.[Web of Science][Medline]
Bird,R.E. et al. (1988) Science, 242, 423426.
Casey,J.L., King,D.J., Chaplin,L.C., Haines,A.M., Pedley,R.B., Mountain,A., Yarranton,G.T. and Begent,R.H. (1996) Br. J. Cancer, 74, 13971405.[Web of Science][Medline]
FitzGerald,K., Holliger,P. and Winter, G. (1997) Protein Engng, 10, 12211225.
Ghetie,M.A., Podar,E.M., Ilgen,A., Gordon,B.E., Uhr,J.W. and Vitetta,E.S. (1997) Proc. Natl Acad. Sci. USA, 94, 75097514.
Holliger,P., Prospero,T. and Winter,G. (1993) Proc. Natl Acad. Sci. USA, 90, 64446448.
Holliger,P., Brissinick,J., Williams,R.L., Thielemans,K. and Winter,G. (1996) Protein Engng, 9, 299305.
Hopp,T.P., Prickett,K.S., Libby,R.T., March,C.J., Cerretini,D.P., Uradl,D.L. and Conlon,P.J. (1988) Bio/Technology, 6, 12041210.
Huston,JS. et al. (1988) Proc. Natl Acad. Sci. USA, 85, 58795883.
Iliades,P., Kortt,A.A. and Hudson,P.J., (1997) FEBS Lett., 409, 437441.[Web of Science][Medline]
Jones,T.A., Zou,J-Y., Cowan,S.W.,and Kjeldgaard,M. (1991) Acta Crystallogr., B47, 110119.
Kabat,E.A., Wu,T.T., Perry,H.M., Gottensman,K.S. and Foeler,C. (1991) Sequences of Proteins of Immunological Interest. US Department of Health and Human Service, US Public Health Service, National Institutes of Health, Bethesda, MD.
Kortt,A.A. et al. (1994) Eur. J. Biochem., 221, 151157.[Web of Science][Medline]
Kortt,A.A. et al. (1997) Protein Engng, 10, 423433.
Kraulis,P.J. (1991) J. Appl. Crystallogr., 24, 946950.
Lawrence,L.J., Kortt,A.A., Iliades,P., Tulloch,P.A. and Hudson,P.J. (1998) FEBS Lett., 425, 479484.[Web of Science][Medline]
Malby,R.L. et al. (1993) Proteins: Struct. Funct. Genet., 16, 5763.[Web of Science][Medline]
Malby,R.L., Tulip,W.R., Harley,V.R., McKimm-Breschkin,J.L., Laver,W.G., Webster,R.G. and Colman, P.M. (1994) Structure, 2, 733746.[Medline]
Malby,R.L., McCoy,A.J., Kortt,A.A., Hudson,P.J. and Colman, P.M. (1998) J. Mol. Biol., 279, 901910.[Web of Science][Medline]
McCartney,J.E. et al. (1995) Protein Engng, 8, 301314.
McGuinness,B.T., Walter,G., FitzGerald,K., Schuler,P., Mahoney,W., Duncan, A.R. and Hoogenboom,H.R. (1996) Nature Biotechnol., 14, 11491154.[Web of Science][Medline]
Pack,P., Muller,K., Zahn,R. and Pluckthun,A., (1995) J. Mol. Biol., 246, 2834.[Web of Science][Medline]
Pei,X,Y., Holliger,P., Murzin,A.G. and Williams,R.L. (1997) Proc. Natl Acad. Sci. USA, 94, 96379642.
Perisic,O., Webb,P.A., Holliger,P., Winter,G. and Williams,R.L., (1994) Structure, 2, 12171226.[Medline]
Pluckthun,A. and Pack,P. (1997) Immunotechnology, 3, 83105[Web of Science][Medline]
Tulloch,P.A., Colman,P.M., Davis,P.C., Laver,W.G., Webster,R.G. and Air,G.M. (1986) J. Mol. Biol., 190, 215225.[Web of Science][Medline]
Whitlow,M., Filpula,D., Rollence,M.L., Feng,S.-L. and Woods,J.F. (1994) Protein Engng, 7, 10171026.
Wu,A.M., Chen,W., Raubitschek,A., Williams,L.E., Neumaier,M., Fischer,R., Hu,S.-Z., Odom-Maryon,T., Wong,J.Y.C. and Shively,J.E. (1996) Immunotechnology, 2, 2136.[Web of Science][Medline]
Zdanov,A., Li,Y., Bundle,D.R., Deng,S.-J., MacKenzie,C.R., Narang,S.A., Young,N.M. and Cygler,M. (1994) Proc. Natl Acad. Sci. USA, 91, 64236427.
Zhu,Z., Zapata,G., Shalaby,R., Snedecor,B., Chen,H. and Carter,P. (1996) Nature Biotechnol., 14, 192196.
Received October 22, 1998; revised March 26, 1999; accepted April 16, 1999.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. V. Leyton, T. Olafsen, M. A. Sherman, K. B. Bauer, P. Aghajanian, R. E. Reiter, and A. M. Wu Engineered humanized diabodies for microPET imaging of prostate stem cell antigen-expressing tumors Protein Eng. Des. Sel., March 1, 2009; 22(3): 209 - 216. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Peterson, E. M. Laurenzana, W. T. Atchley, H. P. Hendrickson, and S. M. Owens Development and Preclinical Testing of a High-Affinity Single-Chain Antibody against (+)-Methamphetamine J. Pharmacol. Exp. Ther., April 1, 2008; 325(1): 124 - 133. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Smith, R. E. Kontermann, J. Embleton, and S. Kumar Antibody phage display technologies with special reference to angiogenesis FASEB J, March 1, 2005; 19(3): 331 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Shahied, Y. Tang, R. K. Alpaugh, R. Somer, D. Greenspon, and L. M. Weiner Bispecific Minibodies Targeting HER2/neu and CD16 Exhibit Improved Tumor Lysis When Placed in a Divalent Tumor Antigen Binding Format J. Biol. Chem., December 24, 2004; 279(52): 53907 - 53914. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-B. Wang, B.-F. Zhao, Q. Zhao, J.-H. Piao, J. Liu, Q. Lin, and H.-L. Huang A New Recombinant Single Chain Trispecific Antibody Recruits T Lymphocytes to Kill CEA (Carcinoma Embryonic Antigen) Positive Tumor Cells In Vitro Efficiently J. Biochem., April 1, 2004; 135(4): 555 - 565. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Dolezal, R. De Gori, M. Walter, L. Doughty, M. Hattarki, P. J. Hudson, and A. A. Kortt Single-chain Fv multimers of the anti-neuraminidase antibody NC10: the residue at position 15 in the VL domain of the scFv-0 (VL-VH) molecule is primarily responsible for formation of a tetramer-trimer equilibrium Protein Eng. Des. Sel., January 1, 2003; 16(1): 47 - 56. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-C. Wu, J. C. Yeung, Y. Duan, R. Ye, S. J. Szarka, H. R. Habibi, and S.-L. Wong Functional Production and Characterization of a Fibrin-Specific Single-Chain Antibody Fragment from Bacillus subtilis: Effects of Molecular Chaperones and a Wall-Bound Protease on Antibody Fragment Production Appl. Envir. Microbiol., July 1, 2002; 68(7): 3261 - 3269. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Volkel, T. Korn, M. Bach, R. Muller, and R. E. Kontermann Optimized linker sequences for the expression of monomeric and dimeric bispecific single-chain diabodies Protein Eng. Des. Sel., October 1, 2001; 14(10): 815 - 823. [Abstract] [Full Text] [PDF] |
||||
![]() |
E.J. Norton, A.B. Diekman, V.A. Westbrook, C.J. Flickinger, and J.C. Herr RASA, a recombinant single-chain variable fragment (scFv) antibody directed against the human sperm surface: implications for novel contraceptives Hum. Reprod., September 1, 2001; 16(9): 1854 - 1860. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tahtis, F.-T. Lee, F. E. Smyth, B. E. Power, C. Renner, M. W. Brechbiel, L. J. Old, P. J. Hudson, and A. M. Scott Biodistribution Properties of 111Indium-labeled C-Functionalized trans-Cyclohexyl Diethylenetriaminepentaacetic Acid Humanized 3S193 Diabody and F(ab')2 Constructs in a Breast Carcinoma Xenograft Model Clin. Cancer Res., April 1, 2001; 7(4): 1061 - 1072. [Abstract] [Full Text] |
||||
![]() |
A. Schmiedl, F. Breitling, and S. Dubel Expression of a bispecific dsFv-dsFv' antibody fragment in Escherichia coli Protein Eng. Des. Sel., October 1, 2000; 13(10): 725 - 734. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Dolezal, L. A. Pearce, L. J. Lawrence, A. J. McCoy, P. J. Hudson, and A. A. Kortt ScFv multimers of the anti-neuraminidase antibody NC10: shortening of the linker in single-chain Fv fragment assembled in VL to VH orientation drives the formation of dimers, trimers, tetramers and higher molecular mass multimers Protein Eng. Des. Sel., August 1, 2000; 13(8): 565 - 574. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||











