Protein Engineering, Vol. 12, No. 8, 681-686,
August 1999
© 1999 Oxford University Press
Deletion of the four C-terminal residues of PepC converts an aminopeptidase into an oligopeptidase
INRA, Unité de Recherche de Biochimie et Structure des Protéines, 78352 Jouy-en-Josas Cedex, France
| Abstract |
|---|
|
|
|---|
The aminopeptidase PepC is a cysteine peptidase isolated from lactic acid bacteria. Its structural and enzymatic properties closely resembles those of the bleomycin hydrolases, a group of cytoplasmic enzymes isolated from eukaryotes. Previous biochemical and structural data have shown that the C-terminal end of PepC partially occupies the active site cleft. In this work the substrate specificity of PepC was engineered by deletion of the four C-terminal residues. The mutant PepC
432435 cleaved peptide substrates as an oligopeptidase while the aminopeptidase specificity was totally abolished. The substrate size dependency indicated that PepC
432435 possesses an extended binding site able to accommodate four residues of the substrate on both sides of the cleaved bond. The activity of PepC
432435 towards tryptic fragments of casein revealed a preference for peptides with hydrophobic amino acids at positions P2 and P3 and for Gly, Asn and Gln at position P1. PepC
432435 was shown to be highly sensitive to the thiol peptidase inhibitors leupeptin or E64 which are inefficient towards the wild-type PepC. In conclusion, deletion of the four C-terminal residues in PepC produces a new enzyme with properties resembling those of an endopeptidase from the papain family.
Keywords: bleomycin hydrolase/cystein proteinaseLactococcus/papain/substrate specificity
| Introduction |
|---|
|
|
|---|
PepC is a hydrolytic enzyme with a strict aminopeptidase specificity. It was initially purified from the AM2 strain of Lactococcus lactis and its activity was thiol dependent (Neviani et al., 1989
Orthologous genes to PepC have been isolated in many other species of lactic acid bacteria (LAB) (Chapot-Chartier et al., 1994
; Klein et al., 1994
; Vesanto et al., 1994
) and have recently been identified in L. monocytogenes and T. pallidum (Fraser et al., 1998
).
Homologues of PepC appear to be broadly distributed among eukaryotes: they have been characterized in yeast (GAL6, BLH1, YCP1) (Kambouris et al., 1992
; Enenkel and Wolf, 1993
; Magdolen et al., 1993
) and in several mammals (Sebti et al., 1989
; Brömme et al., 1996
; Ferrando et al., 1996
; Takeda et al., 1996
), where they are called bleomycin hydrolases due to their ability to hydrolyse and inactivate the anticancer drug bleomycin (Sebti and Lazo, 1987
). The bleomycin hydrolase activity has been directly related to the aminopeptidase specificity shared by all these enzymes.
PepCs and their eukaryotic homologues display the catalytic and active site sequences characteristic of thiol proteases. However, their size (50 kDa), their cytoplasmic localization and their oligomeric organization distinguish them from the well studied model plant papain or from lysosomal cathepsins. Active PepC is arranged as a homohexamer composed of subunits of 435 residues, which leaves a narrow channel (22 Å in diameter) giving access to the six active sites. This feature probably restricts the activity of PepCs and bleomycin hydrolases solely to peptides.
It has been known for a long time that cysteine proteases of the papain family possess an extended binding site able to accommodate up to seven residues of a peptidic substrate along a distance of 25 Å (Schechter and Berger, 1967
). The primary specificity of most of the enzymes of the family is largely determined by the binding interaction in their S2 subsites which show a preference for residues with bulky non-polar side chains (Turk et al., 1998
). It was recently demonstrated that PepC also possesses an extended binding site with four subsites (S1 to S'3) (Mistou and Gripon, 1998
).
The crystallographic models of GAL6 and PepC (Joshua-Tor et al., 1995
; Mistou and Housset, personal communication) revealed that the C-terminal extremity, the sequence of which is well conserved among BLMases and PepCs, was inserted into the active site cleft and that the carboxylate group of the last alanyl residue pointed towards the active site residue. The deletion of the C-terminal residue of the enzyme demonstrated the essential role that this residue plays in the strict aminopeptidase specificity and the catalytic mechanism of the enzyme (Mata et al., 1997
).
In the present work we have studied the hydrolytic specificity of a mutant of PepC, in which the last four C-terminal residues (Gly432Ala435) were deleted by site-directed mutagenesis. This modification liberates the potential S subsites of the enzyme and shifts its specificity from a strict aminopeptidase to an oligopeptidase.
| Materials and methods |
|---|
|
|
|---|
Mutant construction, expression and purification of recombinant enzymes
The PepC gene with the last four codons deleted was obtained by site-directed mutagenesis. The selection oligonucleotide GTGACTGGTGAGGCCTCAACCAAGTG was designed to suppress the unique ScaI site in pTIL003 and introduced a StuI site. The mutagenic oligonucleotide 5'-CCATGGGATCCAATGTAAGCCTTGGCTTAATTTG-3' introduced a stop codon (TAA) instead of GGA at codon 433. The EcoRVTthI fragment (2.2 kb) containing the mutated region was introduced into the expression vector pTIL25 and sequenced to confirm the deletion. This construction allows the expression of a mutant of PepC with the last four residues deleted (PepC
432435). The deletion was verified at the protein level as previously described (Mata et al., 1997
). The recombinant proteins were produced in the TIL90 strain of Lactococcus lactis and purified as described by Mata et al. (1997).
Enzyme assays
The activity towards peptide substrates was measured by incubating the enzyme with the substrate at a 1 mM final concentration. In all experiments the enzyme concentration was 2x107 M for wild-type PepC (PepCwt) and varied between 2x106 and 4x108 M for PepC
432435. Protein concentrations were determined by the method of Bradford (1976), with BSA as a standard. The molar concentration was calculated on the basis of the molecular mass of one monomer (Mr = 49 500). The assays were carried out at 37°C in 100 mM sodium phosphate, 10 mM EDTA, 10 mM dithiothreitol, pH 6.15. The duration of the incubation (520 min) and the enzyme concentration were set to minimize substrate hydrolysis to less than 20%. The reaction was stopped by addition of trifluoroacetic acid (TFA) to a 1% final concentration. The initial rates of bradykinin hydrolysis by PepC
432435 (4x108 M) were measured over a range of substrate concentrations (0.15 mM). The enzymatic parameters were calculated by non-linear regression analysis of the initial rates of hydrolysis fitted to the MichaelisMenten equation.
The substrate and the products were separated by reversed-phase HPLC at 40°C using a C18 Hypersil PEP 100 column (250x4.6 mm, 5 µm particle size) in a TFA/acetonitrile solvent system (solvent A: 0.115% TFA; solvent B: 0.11% TFA, 60% CH3CN). The solvent gradient was adapted to the hydrophobicity of the peptides to be separated. Elution was monitored at 214 nm and the peak areas of the substrate and/or products were used to quantify the extent of hydrolysis. The peaks were collected and analysed by mass spectrometry (HP G2025A MALDI-TOF System, Hewlett Packard) and/or N-terminal sequencing (494-Procise Protein Sequencer, Applied Biosystem, Perkin-Elmer).
For the pH activity profile the following buffers were used: 100 mM sodium citrate (pH 3.55.8), 100 mM sodium phosphate (pH 5.88.0) and 100 mM TrisHCl (pH 8.08.6). All buffers contained 10 mM DTT, 10 mM EDTA and 0.3 M NaCl to minimize variations in ionic strength.
Inhibition of wild-type PepC and PepC
432435 by leupeptin and E64
Initial rates for the hydrolysis of Arg-pNA (1 mM) and bradykinin (1 mM) by wild-type PepC and PepC
432435, respectively, were measured in the presence of different leupeptin concentrations (50300 µM for PepCwt; 0.011 µM for PepC
432435). The enzymeinhibitor dissociation constant (Ki) was determined from the relationship described by Salvesen and Nagase (1989)
|
|
|
|
Kinetic parameters for the inactivation of PepC
432435 by L-trans-epoxysuccinyl-leucylamido(4-guanidino)butane inhibitor (E64) (Sigma) were measured on bradykinin (5 mM) at the same enzyme and inhibitor concentrations (1x107 M). The rate of inactivation of PepC
432435 by E64 was calculated as previously described for papain by Barrett et al. (1982).
Tryptic digest of casein
s1,
s2 and ß caseins were purified from whole casein as described by Guillou et al. (1987). Purified caseins (2.5 mg/ml in 40 mM phosphate buffer, pH 7.0) were digested by incubation with L-1-tosylamide-2-phenylmethyl chloromethyl ketone-treated trypsin (Serva, Heidelberg, Germany) at a E/S ratio of 1:100 (wt/wt) at 37°C for 15 h. The reactions were stopped by heating the digests at 75°C for 15 min. The casein hydrolysates were stored at 20°C until use.
Tryptic digests of
s1,
s2 or ß casein were incubated up to 8 h at 30°C with or without (as control) PepC
432435 (2x107 M final concentration). Aliquots were taken at the indicated times and the reaction was stopped by addition of TFA (1% final concentration). Samples were analysed by reversed-phase HPLC as described above. The linear elution gradient was from 0 to 80% solvent B for 55 min (for
s1 and
s2 caseins) or 65 min (for ß casein).
The peaks, whose area decreased or increased compared with the control sample, were analysed by mass spectrometry (MALDI-TOF) and/or N-terminal amino acid sequencing. This made it possible to identify the peptides hydrolysed and the hydrolysis products.
Analysis of the preference of amino acid residues around the cleaved bonds
The experimental results obtained from the hydrolysis of the tryptic casein digests were analysed in the following way. Amino acid residues were classified into five groups: (i) hydrophobic (Trp, Met, Phe, Leu, Ile, Tyr, Val); (ii) positively charged (His, Lys, Arg); (iii) negatively charged (Glu, Asp); (iv) small-sized or non-charged polar (Gly, Ala, Ser, Thr, Asn, Gln) and (v) proline.
The occurrence of the five groups at each position of the peptides hydrolysed by PepC
432435 was calculated (see below). A similar calculation was made on the whole tryptic casein peptides having 716 residues. The difference in composition at positions P3 to P'3, between hydrolysed versus all tryptic peptides, is a measure of the preference of the enzyme.
At each position P3 to P'3 of the peptides found to be hydrolysed by PepC
432435, the total number of appearances of each of the five groups was divided by the number of cleaved bonds (one peptide displayed two cleaved bonds), this ratio defines the occurrence of each group at each position.
To eliminate the contribution of the abundance of some amino acids in the overall composition of the casein, the occurrence of each amino acid group at each position (P3P'3) in all the tryptic fragments of caseins containing 716 residues was calculated. In this case, the ratio was the number of times a group occurs at a given position to the total number of tryptic peptides containing 716 residues. Due to the inability of PepC to hydrolyse peptides containing Pro at the P1 and P'1 positions, all the peptides containing the prolyl residue at these potential positions were not taken into account.
| Results |
|---|
|
|
|---|
Converting the aminopeptidase PepC into an oligopeptidase
The insertion of the C-terminal end of PepC into the active site suggests that its deletion could expose new substrate binding sites, modifying the specificity of the enzyme. We constructed a mutant of PepC in which the last four C-terminal residues had been deleted (PepC
432435) and its activity was tested against peptidic substrates. While bradykinin (Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg) is not degraded through the aminopeptidase activity of PepCwt, due to the presence of proline in the second position, an oligopeptidase activity was detected for PepC
432435 (Table I
). Analysis of the products from bradykinin hydrolysis showed that the cleaved bond in bradykinin was between Gly4 and Phe5. The hydrolytic activity of PepC
432435 on bradykinin appears to be very specific, as long incubation times (1 h) or a high enzyme concentration (2x106 M) did not lead to new hydrolysis products. The kinetic parameters for the hydrolysis of the Gly4Phe5 bond of the bradykinin substrate were calculated (Km, 2.5 mM; kcat, 10.7 s1). The initial rate of hydrolysis measured at 1 mM bradykinin for PepC
432435 was 5.6 µmol bradykinin hydrolysed/min/mg enzyme, a value which is in good agreement with that of 7.4 and 11.4 reported for PepF and PepO, two lactococcal metallo-oligopeptidases (Monnet et al., 1994
; Pritchard et al., 1994
).
|
Other substrates, such as ACTH 1-10, ACTH 4-10 and the oxidized chain B of insulin, were also cleaved by the peptidase activity of PepC
432435, albeit with a lower efficiency (Table I
In order to investigate the properties of the active site of PepC
432435, hydrolytic activity was assayed towards 10 bradykinin-related peptides (Table I
). All these peptides whose size varies from 6 to 11 residues were hydrolysed by PepC
432435 at the same position (between residues Gly and Phe). This result can be explained by the presence of three consecutive proline-containing bonds on the N-terminal side and also by the specificity requirements of the new active site (see above and Discussion). Taking into account the activity towards bradykinin as the reference (activity 100%), the highest activity (258%) was displayed on the fragment 18 which is shorter by one residue on the C-terminal side. The activity towards the bradykinin fragment 17 (two residues shorter) was slightly higher than that measured for bradykinin. The bradykinin fragment 16 was also hydrolysed by PepC
432435 but the rate was 37% of that found for bradykinin. These results indicate that, at least on bradykinin-derived substrates, the full catalytic potency of PepC
432435 is developed when four residues occupy S' subsites.
On the other hand, the presence of four residues on the N-terminal side of the hydrolysed bond appears to be optimal. The activity decreased 3.5-fold on shorter peptides, such as DesPro2-bradykinin and bradykinin fragment 27, in which one residue was lacking. The presence of additional residues on the N-terminal side (Tyr-bradykinin, Lys-bradykinin and Met-Lys-bradykinin) also leads to a poor peptide degradation. Therefore, PepC
432435 displays a maximal rate of hydrolysis towards bradykinin-related peptides when four residues of the substrate are positioned in the S subsites.
Thermal stability and pH activity
Thermal stability and optimal pH activity for PepC
432435 were determined using bradykinin as a substrate. A high level of activity (90% of the maximal activity) was maintained when the enzyme was incubated up to 50°C for 15 min. Under these conditions PepCwt retains only 10% of its aminopeptidase activity (Figure 1
). The aminopeptidase activity of Pepwt imposes an accurate positioning of the C-terminal residue which could be perturbed by heat. This would explain the far higher thermal stability of the enzymic activity of PepC
432435.
|
The effect of pH on the activity of PepC
432435 towards bradykinin is reported (Figure 2
|
Inhibition of wild-type and mutant PepC by leupeptin and E64
Inactivation of PepC
432435 by E64, an inhibitor specific for cysteine proteases, was found to be very fast as 70% of the enzyme was inactivated in less than 5 s ([E] = [I] = 1x107 M). Due to the specific requirements for measuring the activity of PepC
432435, it was not possible to accurately measure the kinetic parameters of the inhibition. However, we can estimate that the second order rate constant for inactivation of PepC
432435 by E64 is higher than 2.7x106 M1s1. Under similar conditions, the rate of inactivation for the wild-type enzyme by E64 was 680 M1s1 (Mata et al., 1997
). This result shows that the deletion of the C-terminal residues greatly favours the reactivity of the epoxysuccinyl compound with PepC.
The reactivity of PepCwt and PepC
432435 towards leupeptin was also studied. This inhibitor binds non-covalently to the active-site of the enzyme and has been considered to behave as a transition state analogue (Schröder et al., 1993
). It is important to study the effect of this inhibitor on the mutant enzyme since the analysis of the crystallographic model of GAL6 indicates that the C-terminal part of PepC takes a conformation which can be superimposed onto that of leupeptin in the active site of papain. The measured affinity of leupeptin for PepC
432435 (Ki = 2.3x108 M) was found to be 8700-fold higher than that measured for the wild-type enzyme (Ki = 1.97x104 M). This result compares well to that found for a mutant of the yeast enzyme, GAL6, in which the last two C-terminal residues of the mature enzyme have been genetically deleted (Zheng et al., 1998
). The inhibitory effect of E64 and leupeptin towards PepCwt and PepC
432435 are consistent with the presence of potential S2S3 subsites occluded by the C-terminal end of the wild-type enzyme.
Degradation of tryptic digests of
s1,
s2 and ß casein by PepC
432435
To further investigate the specificity of PepC
432435, the enzyme was incubated with a large diversity of peptides originated from tryptic hydrolysates of purified caseins. After RP-HPLC, 70 peptides were identified from the hydrolysates of
s1,
s2 and ß casein. The size range of these peptides was between 2 and 57 residues.
As summarized in Table II
, seven casein peptides, ranging between 7 and 16 residues, were found to be hydrolysed by PepC
432435 (32 out of the 70 identified casein peptides have a size within that range). PepC
432435 cleaved most of the casein fragments by releasing tripeptides from the N-terminal end, but tetra- or dipeptides were also found as products of the hydrolysis. Fragment 9298 from
s2 casein was also hydrolysed, but in that case the products of hydrolysis were not identified.
|
Among the 70 different peptides available, only seven tryptic fragments were cleaved by PepC
432435. The length and the composition of the peptides are the two main factors which can restrict the hydrolytic activity. We analysed the nature of the residues at each position (P3 to P'3) around the cleaved peptidic bonds (see Material and methods). The results of this analysis are presented in Figure 3
|
In contrast, the specificity appears to be broader at the P' positions of the substrate, but a slight preference was observed for acidic and hydrophobic side chains. Previous studies have shown that the backbone of the substrate is essential for the interactions with the S' subsites of PepC (Mistou and Gripon, 1998
| Discussion |
|---|
|
|
|---|
In this work we showed that the specificity of PepC can be changed by the deletion of the four C-terminal residues (Gly432Ala435). The specificity of the engineered enzyme was shifted from a strict aminopeptidase to a peptidase releasing tri- or tetrapeptides from substrates with a size varying from 6 to 16 residues. The loss of aminopeptidase activity by PepC
432435 is easily interpreted as the C-terminal residue was shown to be essential for the activity of wild-type PepC and its eukaryotic homolog GAL6 (Mata et al., 1997
Among the substrates tested, bradykinin and their related peptides were good substrates for PepC
432435. The hydrolytic activity was always found to occur at the GlyPhe bond. This restrictive specificity of PepC
432435 towards the GlyPhe bond is due to the presence of proline-containing peptidic bonds, which does not allow the hydrolysis to occur on the N-terminal side of the glycine residue. Moreover, hydrolysis of the GlyPhe bond is probably favoured because small hydrophilic residues and hydrophobic residues or proline are preferred at the S1 and S2 positions, respectively, as shown in Figure 3
. This property made it possible to delineate a relationship between the level of hydrolysis and the enzyme subsite occupancy. For this group of substrates of similar composition, the optimal activity was found when four residues were present on both sides of the hydrolysed bond. This suggests that the removal of the last four C-terminal residues of PepC reveals an extended substrate binding site. However, the specificity for the hydrolysis of peptides by PepC
432435 is a balance between full occupancy and specificity of the substrate binding sites. This characteristic is well illustrated in the case of the hydrolysis of casein peptides (see above), but the cleavage of Des-Pro2-bradykinin which generates a tripeptide also indicates that specificity can take preferences over the full occupancy of S subsites. In a previous work, it was demonstrated that tetra- and pentapeptides led to the maximal aminopeptidase activity of the wild-type enzyme (Mistou and Gripon, 1998
). This result agrees well with the occupancy of the three to four S' subsites suggested for the mutant PepC in the present work.
The composition of casein peptides hydrolysed by PepC
432435 revealed that the deletion not only removes steric hindrance but also creates new substrate binding sites whose specificity resembles that of other members of the papain family. Although the sample of peptides used in this study is not exhaustive, the reported activity of PepC
432435 on 20 different peptides gives a coherent picture of the specificity of the active site. PepC
432435 can accommodate four residues on its new S subsites, the occupancy of which is dependant upon the composition of the peptidic substrate.
One of the primary determinants of the substrate specificity for PepC
432435 is associated with position P2, in which a preference for residues with hydrophobic side chains was demonstrated, as in the case of other papain family members (Turk et al., 1998
). Moreover, PepC
432435 also accepts Pro at position P2, an unusual property which has been only found for cruzipain, the major cysteine protease from Trypanosoma cruzi (Del Neri et al., 1997). The S3 binding site is more tolerant than S2 but a slight preference for hydrophobic residues at this position has also been reported for papain and cathepsin L (Koga et al., 1990
; Turk et al., 1998
).
As a consequence of the oligomeric organization of PepC, the hydrolytic activity is restricted to peptides which can go through the central channel giving access to the active sites. We did not observe cleavage on peptides exceeding 16 residues in length, although the composition of some of them was compatible with their hydrolysis by PepC
432435. This result is not exclusive to the mutant, but was also observed for PepCwt (data not shown). Consequently, it is likely that a length of 1618 residues constitutes the upper limit for a peptide to be hydrolysed by PepC. On the other hand, peptides of fewer than 6 residues in size are not hydrolyzed by PepC
432435, while they constitute good substrates for PepCwt. As a consequence of the elimination of the C-terminal residues in the enzyme, the enzymatic activity requires more extensive enzymesubstrate contacts which are not provided by small peptides.
Further similarities with the papain family are found through the inhibitory activity of E64 and leupeptin. These molecules poorly react with the wild-type enzyme while PepC
432435 is strongly inhibited by them. The rate constant of inactivation determined for E64 on PepC
432435 is the highest among those determined for the peptidases of the papain family (Barrett et al., 1982
). The crystallographic structures of several cysteine proteases with E64 or leupeptin have shown that these inhibitors interact with the S subsites of cysteine proteases. Moreover, E64 and leupeptin possess a leucyl group at position P2 that binds within the S2 subsite. This result confirms the preference of the cysteine peptidases for hydrophobic residues at position P2 (Varughese et al., 1989
; Schröder et al., 1993
; Fujishima et al., 1997
). It has recently been reported that the deletion of the two last residues of the mature yeast enzyme, GAL6, also favoured the inhibition by leupeptin (Zheng et al., 1998
).
Structural and functional studies have revealed that the exopeptidase specificity of different members of the papain family are determined by structural elements which partially filled the active site cleft. For example, the dipeptidyl carboxypeptidase activity of cathepsin B is due to the presence of an 18-residue surface loop, called the occluding loop, which restricts the access to the S' subsites (Musil et al., 1991
). Furthermore, two histidine residues provide positive charges, which anchors the carboxyl group of the substrate (Illy et al., 1997
). In the case of cathepsin H, the insertion into the active site cleft of an octapeptide which originates from the propeptide, defines the aminopeptidase specificity. It is located in front of the S1 subsite, and the carboxylate group of the last Thr residue is positioned to interact with the amino group of the substrate (Guncar et al., 1998
). The well conserved C-terminal extension in the PepC and bleomycin hydrolase family is an essential motif which plays a similar role.
The results of the present work demonstrate that PepC possesses a partially occluded active site cleft with substrate binding properties which are close to those described for other members of the papain family.
| Acknowledgments |
|---|
We are grateful to Marta Erra-Pujada for her assistance with the construction of the mutant enzyme. We would like to thank Claire Gay for her assistance with the preparation of the manuscript. L.M. was beneficiary of a fellowship from the Ministerio de Educacion y Cultura of the Spanish Government and also the European Community (FAIR-CT98-5066).
| Notes |
|---|
1 To whom correspondence should be addressed
| References |
|---|
|
|
|---|
Barrett,A.J., Kembhavi,A.A., Brown,M.A., Kirschke,H., Knight,C.G., Tamai,M. and Hanada,K. (1982) Biochem. J., 201, 189198.[Web of Science][Medline]
Bradford,M.M. (1976) Anal. Biochem., 72, 248254.[Web of Science][Medline]
Brömme,D., Rossi,A.B., Smeekens,S.P., Anderson,D.C. and Payan,D.G. (1996) Biochemistry, 35, 67066714.[Medline]
Chapot-Chartier,M.-P., Nardi,M., Chopin,M.-C., Chopin,A. and Gripon,J.-C. (1993) Appl. Environ. Microbiol., 59, 330333.
Chapot-Chartier,M.-P., Rul,F., Nardi,M. and Gripon,J.-C. (1994) Eur. J. Biochem., 224, 497506.[Web of Science][Medline]
Del Nery,B., Juliano,M.A., Meldal,M.M., Svendsen,I., Scharfstein,J. Walmsley,A. and Juliano,L. (1997) Biochem. J., 323, 427433.
Enenkel,C. and Wolf,D.H. (1993) J. Biol. Chem., 268, 70367043.
Ferrando,A.A., Velasco,G., Campo,E. and Lopez-Otin,C. (1996) Cancer Res., 56, 17461750.
Fraser,C.M. et al. (1998) Science 281, 375388.
Fujishima,A., Imai,Y., Nomura,T., Fujisawa,Y., Yamamoto,Y. and Sugawara,T. (1997) FEBS Lett., 407, 4750.[Web of Science][Medline]
Guillou,H., Miranda,G. and Pelissier,J.-P. (1987) Le Lait, 67, 135148.
Guncar,G., Podobnik,M., Pungercar,J., Strukelj,B., Turk,V. and Turk,D. (1998) Structure, 6, 5161.[Medline]
Illy,C., Quraishi,O., Wang,J., Purisima,E., Vernet,T. and Mort,J.S. (1997) J. Biol. Chem., 272, 11971202.
Joshua-Tor,L., Xu,H.E., Johnston,S.A. and Rees,D.C. (1995) Science, 269, 945950.
Kambouris,N.G., Burke,D.J. and Creutz,C.E. (1992) J. Biol. Chem., 267, 2157021576.
Klein,J.R., Henrich,B. and Plapp,R. (1994) FEMS Microbiol. Lett., 124, 291299.[Web of Science][Medline]
Koga,H., Yamada, H., Nishimura,Y., Kato,K. and Imoto,T. (1990) J. Biochem., 108, 976982.
Magdolen,U., Mueller,G., Magdolen,V. and Bandlow,W. (1993) Biochim. Biophys. Acta, 1171, 299303.[Medline]
Mata,L., Erra-Pujada,M., Gripon,J.-C. and Mistou,M.-Y. (1997) Biochem. J., 328, 343347.
Mistou,M.-Y. and Gripon,J.-C. (1998) Biochim. Biophys. Acta, 1383, 6370.[Medline]
Monnet,V., Nardi,M., Chopin,A., Chopin,M.-C. and Gripon,J.-C. (1994) J. Biol. Chem., 269, 3207032076.
Musil,D., Zucic,D., Turk,D., Engh,R.A., Mayr,I., Huber,R., Popovic,T., Turk,V., Towatari,T., Katunuma,N. and Bode, W. (1991) EMBO J., 10, 23212330.[Web of Science][Medline]
Neviani,E., Boquien,C.-Y., Monnet,V., Phan Thanh,L. and Gripon,J.-C. (1989) Appl. Environ. Microbiol., 55, 23082314.
Pritchard,G.G., Freebairn,A.D. and Coolbear,T (1994) Microbiology, 140, 923930.
Rawlings,N.D. and Barrett,A.J. (1993) Biochem. J., 290, 205218.
Salvasen,G. and Nagase,H. (1989) In Beynon,R.J. and Bond,J.S. (eds), Proteolytic Enzymes. A Practical Approach. IRL Press, Oxford, pp. 8589.
Schechter,I. and Berger,A. (1967) Biochem. Biophys. Res. Commun., 27, 157162.[Web of Science][Medline]
Schröder,E., Phillips,C., Garman,E., Harlos,K. and Crawford,C. (1993) FEBS Lett., 315, 3842.[Web of Science][Medline]
Sebti,S.M. and Lazo,J.S. (1987) Biochemistry 26, 432437.[Medline]
Sebti,S.M., Mignano,J.E., Jani,J.P., Srimatkandada,S. and Lazo,J.S. (1989) Biochemistry 28, 65446548.[Medline]
Takeda,A., Masuda,Y., Yamamoto,T., Hirabayashi,T., Nakamura,Y. and Nakaya,K. (1996) J. Biochem., 120, 353359.
Turk,D., Guncar,G., Podobnik,M. and Turk,B. (1998) Biol. Chem., 379, 137147.[Web of Science][Medline]
Varughese,K.I., Ahmed,F.R., Carey,P.R., Hasnain,S., Huber,C.P. and Storer,A.C. (1989) Biochemistry, 28, 13301332.[Medline]
Vesanto,E., Varmanen,P.,Steele,J. L. and Palva,A. (1994) Eur. J. Biochem., 224, 991997.[Web of Science][Medline]
Zheng,W., Johnston,S.A. and Joshua-Tor,L. (1998) Cell, 93, 103109.[Web of Science][Medline]
Received July 31, 1998; revised January 19, 1999; accepted April 29, 1999.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

) and mutant PepC (). Enzymes were held in the assay buffer at the indicated temperatures for 15 min. The residual activity was measured at 37°C on Arg-pNA and bradykinin for wild-type PepC and PepC
