Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Mata, L.
Right arrow Articles by Mistou, M.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mata, L.
Right arrow Articles by Mistou, M.-Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Protein Engineering, Vol. 12, No. 8, 681-686, August 1999
© 1999 Oxford University Press

Deletion of the four C-terminal residues of PepC converts an aminopeptidase into an oligopeptidase

Luis Mata, Jean-Claude Gripon and Michel-Yves Mistou1

INRA, Unité de Recherche de Biochimie et Structure des Protéines, 78352 Jouy-en-Josas Cedex, France


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The aminopeptidase PepC is a cysteine peptidase isolated from lactic acid bacteria. Its structural and enzymatic properties closely resembles those of the bleomycin hydrolases, a group of cytoplasmic enzymes isolated from eukaryotes. Previous biochemical and structural data have shown that the C-terminal end of PepC partially occupies the active site cleft. In this work the substrate specificity of PepC was engineered by deletion of the four C-terminal residues. The mutant PepC{Delta}432–435 cleaved peptide substrates as an oligopeptidase while the aminopeptidase specificity was totally abolished. The substrate size dependency indicated that PepC{Delta}432–435 possesses an extended binding site able to accommodate four residues of the substrate on both sides of the cleaved bond. The activity of PepC{Delta}432–435 towards tryptic fragments of casein revealed a preference for peptides with hydrophobic amino acids at positions P2 and P3 and for Gly, Asn and Gln at position P1. PepC{Delta}432–435 was shown to be highly sensitive to the thiol peptidase inhibitors leupeptin or E64 which are inefficient towards the wild-type PepC. In conclusion, deletion of the four C-terminal residues in PepC produces a new enzyme with properties resembling those of an endopeptidase from the papain family.

Keywords: bleomycin hydrolase/cystein proteinaseLactococcus/papain/substrate specificity


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
PepC is a hydrolytic enzyme with a strict aminopeptidase specificity. It was initially purified from the AM2 strain of Lactococcus lactis and its activity was thiol dependent (Neviani et al., 1989Go). The amino acid sequence deduced from the cloned gene has revealed that it belongs to the clan CA, family 1 of cysteine peptidase (papain family) (Chapot-Chartier et al., 1993Go). The latter classification is based on the conservation of active site residues and their linear order along the sequence (Rawlings and Barrett, 1993Go).

Orthologous genes to PepC have been isolated in many other species of lactic acid bacteria (LAB) (Chapot-Chartier et al., 1994Go; Klein et al., 1994Go; Vesanto et al., 1994Go) and have recently been identified in L. monocytogenes and T. pallidum (Fraser et al., 1998Go).

Homologues of PepC appear to be broadly distributed among eukaryotes: they have been characterized in yeast (GAL6, BLH1, YCP1) (Kambouris et al., 1992Go; Enenkel and Wolf, 1993Go; Magdolen et al., 1993Go) and in several mammals (Sebti et al., 1989Go; Brömme et al., 1996Go; Ferrando et al., 1996Go; Takeda et al., 1996Go), where they are called bleomycin hydrolases due to their ability to hydrolyse and inactivate the anticancer drug bleomycin (Sebti and Lazo, 1987Go). The bleomycin hydrolase activity has been directly related to the aminopeptidase specificity shared by all these enzymes.

PepCs and their eukaryotic homologues display the catalytic and active site sequences characteristic of thiol proteases. However, their size (50 kDa), their cytoplasmic localization and their oligomeric organization distinguish them from the well studied model plant papain or from lysosomal cathepsins. Active PepC is arranged as a homohexamer composed of subunits of 435 residues, which leaves a narrow channel (22 Å in diameter) giving access to the six active sites. This feature probably restricts the activity of PepCs and bleomycin hydrolases solely to peptides.

It has been known for a long time that cysteine proteases of the papain family possess an extended binding site able to accommodate up to seven residues of a peptidic substrate along a distance of 25 Å (Schechter and Berger, 1967Go). The primary specificity of most of the enzymes of the family is largely determined by the binding interaction in their S2 subsites which show a preference for residues with bulky non-polar side chains (Turk et al., 1998Go). It was recently demonstrated that PepC also possesses an extended binding site with four subsites (S1 to S'3) (Mistou and Gripon, 1998Go).

The crystallographic models of GAL6 and PepC (Joshua-Tor et al., 1995Go; Mistou and Housset, personal communication) revealed that the C-terminal extremity, the sequence of which is well conserved among BLMases and PepCs, was inserted into the active site cleft and that the carboxylate group of the last alanyl residue pointed towards the active site residue. The deletion of the C-terminal residue of the enzyme demonstrated the essential role that this residue plays in the strict aminopeptidase specificity and the catalytic mechanism of the enzyme (Mata et al., 1997Go).

In the present work we have studied the hydrolytic specificity of a mutant of PepC, in which the last four C-terminal residues (Gly432–Ala435) were deleted by site-directed mutagenesis. This modification liberates the potential S subsites of the enzyme and shifts its specificity from a strict aminopeptidase to an oligopeptidase.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Mutant construction, expression and purification of recombinant enzymes

The PepC gene with the last four codons deleted was obtained by site-directed mutagenesis. The selection oligonucleotide GTGACTGGTGAGGCCTCAACCAAGTG was designed to suppress the unique ScaI site in pTIL003 and introduced a StuI site. The mutagenic oligonucleotide 5'-CCATGGGATCCAATGTAAGCCTTGGCTTAATTTG-3' introduced a stop codon (TAA) instead of GGA at codon 433. The EcoRV–TthI fragment (2.2 kb) containing the mutated region was introduced into the expression vector pTIL25 and sequenced to confirm the deletion. This construction allows the expression of a mutant of PepC with the last four residues deleted (PepC{Delta}432–435). The deletion was verified at the protein level as previously described (Mata et al., 1997Go). The recombinant proteins were produced in the TIL90 strain of Lactococcus lactis and purified as described by Mata et al. (1997).

Enzyme assays

The activity towards peptide substrates was measured by incubating the enzyme with the substrate at a 1 mM final concentration. In all experiments the enzyme concentration was 2x10–7 M for wild-type PepC (PepCwt) and varied between 2x10–6 and 4x10–8 M for PepC{Delta}432–435. Protein concentrations were determined by the method of Bradford (1976), with BSA as a standard. The molar concentration was calculated on the basis of the molecular mass of one monomer (Mr = 49 500). The assays were carried out at 37°C in 100 mM sodium phosphate, 10 mM EDTA, 10 mM dithiothreitol, pH 6.15. The duration of the incubation (5–20 min) and the enzyme concentration were set to minimize substrate hydrolysis to less than 20%. The reaction was stopped by addition of trifluoroacetic acid (TFA) to a 1% final concentration. The initial rates of bradykinin hydrolysis by PepC{Delta}432–435 (4x10–8 M) were measured over a range of substrate concentrations (0.1–5 mM). The enzymatic parameters were calculated by non-linear regression analysis of the initial rates of hydrolysis fitted to the Michaelis–Menten equation.

The substrate and the products were separated by reversed-phase HPLC at 40°C using a C18 Hypersil PEP 100 column (250x4.6 mm, 5 µm particle size) in a TFA/acetonitrile solvent system (solvent A: 0.115% TFA; solvent B: 0.11% TFA, 60% CH3CN). The solvent gradient was adapted to the hydrophobicity of the peptides to be separated. Elution was monitored at 214 nm and the peak areas of the substrate and/or products were used to quantify the extent of hydrolysis. The peaks were collected and analysed by mass spectrometry (HP G2025A MALDI-TOF System, Hewlett Packard) and/or N-terminal sequencing (494-Procise Protein Sequencer, Applied Biosystem, Perkin-Elmer).

For the pH activity profile the following buffers were used: 100 mM sodium citrate (pH 3.5–5.8), 100 mM sodium phosphate (pH 5.8–8.0) and 100 mM Tris–HCl (pH 8.0–8.6). All buffers contained 10 mM DTT, 10 mM EDTA and 0.3 M NaCl to minimize variations in ionic strength.

Inhibition of wild-type PepC and PepC{Delta}432–435 by leupeptin and E64

Initial rates for the hydrolysis of Arg-pNA (1 mM) and bradykinin (1 mM) by wild-type PepC and PepC{Delta}432–435, respectively, were measured in the presence of different leupeptin concentrations (50–300 µM for PepCwt; 0.01–1 µM for PepC{Delta}432–435). The enzyme–inhibitor dissociation constant (Ki) was determined from the relationship described by Salvesen and Nagase (1989)

where Ki(app) is calculated from

where [I] is the known inhibitor concentration and v0 and vi are the hydrolysis rates in the absence or presence of inhibitor, respectively.

Kinetic parameters for the inactivation of PepC{Delta}432–435 by L-trans-epoxysuccinyl-leucylamido(4-guanidino)butane inhibitor (E64) (Sigma) were measured on bradykinin (5 mM) at the same enzyme and inhibitor concentrations (1x10–7 M). The rate of inactivation of PepC{Delta}432–435 by E64 was calculated as previously described for papain by Barrett et al. (1982).

Tryptic digest of casein

{alpha}s1, {alpha}s2 and ß caseins were purified from whole casein as described by Guillou et al. (1987). Purified caseins (2.5 mg/ml in 40 mM phosphate buffer, pH 7.0) were digested by incubation with L-1-tosylamide-2-phenylmethyl chloromethyl ketone-treated trypsin (Serva, Heidelberg, Germany) at a E/S ratio of 1:100 (wt/wt) at 37°C for 15 h. The reactions were stopped by heating the digests at 75°C for 15 min. The casein hydrolysates were stored at –20°C until use.

Tryptic digests of {alpha}s1, {alpha}s2 or ß casein were incubated up to 8 h at 30°C with or without (as control) PepC{Delta}432–435 (2x10–7 M final concentration). Aliquots were taken at the indicated times and the reaction was stopped by addition of TFA (1% final concentration). Samples were analysed by reversed-phase HPLC as described above. The linear elution gradient was from 0 to 80% solvent B for 55 min (for {alpha}s1 and {alpha}s2 caseins) or 65 min (for ß casein).

The peaks, whose area decreased or increased compared with the control sample, were analysed by mass spectrometry (MALDI-TOF) and/or N-terminal amino acid sequencing. This made it possible to identify the peptides hydrolysed and the hydrolysis products.

Analysis of the preference of amino acid residues around the cleaved bonds

The experimental results obtained from the hydrolysis of the tryptic casein digests were analysed in the following way. Amino acid residues were classified into five groups: (i) hydrophobic (Trp, Met, Phe, Leu, Ile, Tyr, Val); (ii) positively charged (His, Lys, Arg); (iii) negatively charged (Glu, Asp); (iv) small-sized or non-charged polar (Gly, Ala, Ser, Thr, Asn, Gln) and (v) proline.

The occurrence of the five groups at each position of the peptides hydrolysed by PepC{Delta}432–435 was calculated (see below). A similar calculation was made on the whole tryptic casein peptides having 7–16 residues. The difference in composition at positions P3 to P'3, between hydrolysed versus all tryptic peptides, is a measure of the preference of the enzyme.

At each position P3 to P'3 of the peptides found to be hydrolysed by PepC{Delta}432–435, the total number of appearances of each of the five groups was divided by the number of cleaved bonds (one peptide displayed two cleaved bonds), this ratio defines the occurrence of each group at each position.

To eliminate the contribution of the abundance of some amino acids in the overall composition of the casein, the occurrence of each amino acid group at each position (P3–P'3) in all the tryptic fragments of caseins containing 7–16 residues was calculated. In this case, the ratio was the number of times a group occurs at a given position to the total number of tryptic peptides containing 7–16 residues. Due to the inability of PepC to hydrolyse peptides containing Pro at the P1 and P'1 positions, all the peptides containing the prolyl residue at these potential positions were not taken into account.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Converting the aminopeptidase PepC into an oligopeptidase

The insertion of the C-terminal end of PepC into the active site suggests that its deletion could expose new substrate binding sites, modifying the specificity of the enzyme. We constructed a mutant of PepC in which the last four C-terminal residues had been deleted (PepC{Delta}432–435) and its activity was tested against peptidic substrates. While bradykinin (Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg) is not degraded through the aminopeptidase activity of PepCwt, due to the presence of proline in the second position, an oligopeptidase activity was detected for PepC{Delta}432–435 (Table IGo). Analysis of the products from bradykinin hydrolysis showed that the cleaved bond in bradykinin was between Gly4 and Phe5. The hydrolytic activity of PepC{Delta}432–435 on bradykinin appears to be very specific, as long incubation times (1 h) or a high enzyme concentration (2x10–6 M) did not lead to new hydrolysis products. The kinetic parameters for the hydrolysis of the Gly4–Phe5 bond of the bradykinin substrate were calculated (Km, 2.5 mM; kcat, 10.7 s–1). The initial rate of hydrolysis measured at 1 mM bradykinin for PepC{Delta}432–435 was 5.6 µmol bradykinin hydrolysed/min/mg enzyme, a value which is in good agreement with that of 7.4 and 11.4 reported for PepF and PepO, two lactococcal metallo-oligopeptidases (Monnet et al., 1994Go; Pritchard et al., 1994Go).


View this table:
[in this window]
[in a new window]
 
Table I. Hydrolysis of peptide substrates by PepC{Delta}432–435
 
Other substrates, such as ACTH 1-10, ACTH 4-10 and the oxidized chain B of insulin, were also cleaved by the peptidase activity of PepC{Delta}432–435, albeit with a lower efficiency (Table IGo). While intra-peptidic cleavage sites were identified for each peptide, no evidence of aminopeptidase activity was found.

In order to investigate the properties of the active site of PepC{Delta}432–435, hydrolytic activity was assayed towards 10 bradykinin-related peptides (Table IGo). All these peptides whose size varies from 6 to 11 residues were hydrolysed by PepC{Delta}432–435 at the same position (between residues Gly and Phe). This result can be explained by the presence of three consecutive proline-containing bonds on the N-terminal side and also by the specificity requirements of the new active site (see above and Discussion). Taking into account the activity towards bradykinin as the reference (activity 100%), the highest activity (258%) was displayed on the fragment 1–8 which is shorter by one residue on the C-terminal side. The activity towards the bradykinin fragment 1–7 (two residues shorter) was slightly higher than that measured for bradykinin. The bradykinin fragment 1–6 was also hydrolysed by PepC{Delta}432–435 but the rate was 37% of that found for bradykinin. These results indicate that, at least on bradykinin-derived substrates, the full catalytic potency of PepC{Delta}432–435 is developed when four residues occupy S' subsites.

On the other hand, the presence of four residues on the N-terminal side of the hydrolysed bond appears to be optimal. The activity decreased 3.5-fold on shorter peptides, such as DesPro2-bradykinin and bradykinin fragment 2–7, in which one residue was lacking. The presence of additional residues on the N-terminal side (Tyr-bradykinin, Lys-bradykinin and Met-Lys-bradykinin) also leads to a poor peptide degradation. Therefore, PepC{Delta}432–435 displays a maximal rate of hydrolysis towards bradykinin-related peptides when four residues of the substrate are positioned in the S subsites.

Thermal stability and pH activity

Thermal stability and optimal pH activity for PepC{Delta}432–435 were determined using bradykinin as a substrate. A high level of activity (90% of the maximal activity) was maintained when the enzyme was incubated up to 50°C for 15 min. Under these conditions PepCwt retains only 10% of its aminopeptidase activity (Figure 1Go). The aminopeptidase activity of Pepwt imposes an accurate positioning of the C-terminal residue which could be perturbed by heat. This would explain the far higher thermal stability of the enzymic activity of PepC{Delta}432–435.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. Thermal stability of wild-type ({circ}) and mutant PepC (•). Enzymes were held in the assay buffer at the indicated temperatures for 15 min. The residual activity was measured at 37°C on Arg-pNA and bradykinin for wild-type PepC and PepC{Delta}432–435, respectively.

 
The effect of pH on the activity of PepC{Delta}432–435 towards bradykinin is reported (Figure 2Go). Maximal activity occurred over a broad pH range (5.0–6.7) which contrasts with the sharper pH curve for PepCwt with an optimum at about pH 7.0. Beyond pH 5.0, the activity dropped as a consequence of the instability of the enzyme (result not shown).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2. pH-activity profiles of wild-type ({circ}) and mutant PepC (•) determined on Gly-pNA and bradykinin, respectively.

 
Inhibition of wild-type and mutant PepC by leupeptin and E64

Inactivation of PepC{Delta}432–435 by E64, an inhibitor specific for cysteine proteases, was found to be very fast as 70% of the enzyme was inactivated in less than 5 s ([E] = [I] = 1x10–7 M). Due to the specific requirements for measuring the activity of PepC{Delta}432–435, it was not possible to accurately measure the kinetic parameters of the inhibition. However, we can estimate that the second order rate constant for inactivation of PepC{Delta}432–435 by E64 is higher than 2.7x106 M–1s–1. Under similar conditions, the rate of inactivation for the wild-type enzyme by E64 was 680 M–1s–1 (Mata et al., 1997Go). This result shows that the deletion of the C-terminal residues greatly favours the reactivity of the epoxysuccinyl compound with PepC.

The reactivity of PepCwt and PepC{Delta}432–435 towards leupeptin was also studied. This inhibitor binds non-covalently to the active-site of the enzyme and has been considered to behave as a transition state analogue (Schröder et al., 1993Go). It is important to study the effect of this inhibitor on the mutant enzyme since the analysis of the crystallographic model of GAL6 indicates that the C-terminal part of PepC takes a conformation which can be superimposed onto that of leupeptin in the active site of papain. The measured affinity of leupeptin for PepC{Delta}432–435 (Ki = 2.3x10–8 M) was found to be 8700-fold higher than that measured for the wild-type enzyme (Ki = 1.97x10–4 M). This result compares well to that found for a mutant of the yeast enzyme, GAL6, in which the last two C-terminal residues of the mature enzyme have been genetically deleted (Zheng et al., 1998Go). The inhibitory effect of E64 and leupeptin towards PepCwt and PepC{Delta}432–435 are consistent with the presence of potential S2–S3 subsites occluded by the C-terminal end of the wild-type enzyme.

Degradation of tryptic digests of {alpha}s1, {alpha}s2 and ß casein by PepC{Delta}432–435

To further investigate the specificity of PepC{Delta}432–435, the enzyme was incubated with a large diversity of peptides originated from tryptic hydrolysates of purified caseins. After RP-HPLC, 70 peptides were identified from the hydrolysates of {alpha}s1, {alpha}s2 and ß casein. The size range of these peptides was between 2 and 57 residues.

As summarized in Table IIGo, seven casein peptides, ranging between 7 and 16 residues, were found to be hydrolysed by PepC{Delta}432–435 (32 out of the 70 identified casein peptides have a size within that range). PepC{Delta}432–435 cleaved most of the casein fragments by releasing tripeptides from the N-terminal end, but tetra- or dipeptides were also found as products of the hydrolysis. Fragment 92–98 from {alpha}s2 casein was also hydrolysed, but in that case the products of hydrolysis were not identified.


View this table:
[in this window]
[in a new window]
 
Table II. Tryptic fragments from caseins hydrolysed by PepC{Delta}432–435
 
Among the 70 different peptides available, only seven tryptic fragments were cleaved by PepC{Delta}432–435. The length and the composition of the peptides are the two main factors which can restrict the hydrolytic activity. We analysed the nature of the residues at each position (P3 to P'3) around the cleaved peptidic bonds (see Material and methods). The results of this analysis are presented in Figure 3Go. The nearly absolute preference for hydrophobic residues at positions P2 and P3 is one of the most striking results, although the presence of a prolyl residue at position P2 is also accepted. Another important property of the new substrate binding site is the preference for non-charged polar or small-sized residues, such as Gly, Gln and Asn, at position P1.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 3. Analysis of the preference for amino acid residues at the P3 to P'3 positions around the cleaved bonds by PepC{Delta}432–435 in tryptic casein peptides. Amino acids were classified as described in the Material and methods section: hydrophobic residues (black bars), positively charged residues (cross-hatched bars), negatively charged residues (dotted bars), non-charged polar and small-sized residues (white bars) and proline (horizontal striped bars).

 
In contrast, the specificity appears to be broader at the P' positions of the substrate, but a slight preference was observed for acidic and hydrophobic side chains. Previous studies have shown that the backbone of the substrate is essential for the interactions with the S' subsites of PepC (Mistou and Gripon, 1998Go). Although they are not represented on Figure 3Go, the other tested peptides, i.e. bradykinin, ACTH 1–10 and the oxidized chain B of insulin, also respect the preceding rules.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In this work we showed that the specificity of PepC can be changed by the deletion of the four C-terminal residues (Gly432–Ala435). The specificity of the engineered enzyme was shifted from a strict aminopeptidase to a peptidase releasing tri- or tetrapeptides from substrates with a size varying from 6 to 16 residues. The loss of aminopeptidase activity by PepC{Delta}432–435 is easily interpreted as the C-terminal residue was shown to be essential for the activity of wild-type PepC and its eukaryotic homolog GAL6 (Mata et al., 1997Go; Zheng et al., 1998Go).

Among the substrates tested, bradykinin and their related peptides were good substrates for PepC{Delta}432–435. The hydrolytic activity was always found to occur at the Gly–Phe bond. This restrictive specificity of PepC{Delta}432–435 towards the Gly–Phe bond is due to the presence of proline-containing peptidic bonds, which does not allow the hydrolysis to occur on the N-terminal side of the glycine residue. Moreover, hydrolysis of the Gly–Phe bond is probably favoured because small hydrophilic residues and hydrophobic residues or proline are preferred at the S1 and S2 positions, respectively, as shown in Figure 3Go. This property made it possible to delineate a relationship between the level of hydrolysis and the enzyme subsite occupancy. For this group of substrates of similar composition, the optimal activity was found when four residues were present on both sides of the hydrolysed bond. This suggests that the removal of the last four C-terminal residues of PepC reveals an extended substrate binding site. However, the specificity for the hydrolysis of peptides by PepC{Delta}432–435 is a balance between full occupancy and specificity of the substrate binding sites. This characteristic is well illustrated in the case of the hydrolysis of casein peptides (see above), but the cleavage of Des-Pro2-bradykinin which generates a tripeptide also indicates that specificity can take preferences over the full occupancy of S subsites. In a previous work, it was demonstrated that tetra- and pentapeptides led to the maximal aminopeptidase activity of the wild-type enzyme (Mistou and Gripon, 1998Go). This result agrees well with the occupancy of the three to four S' subsites suggested for the mutant PepC in the present work.

The composition of casein peptides hydrolysed by PepC{Delta}432–435 revealed that the deletion not only removes steric hindrance but also creates new substrate binding sites whose specificity resembles that of other members of the papain family. Although the sample of peptides used in this study is not exhaustive, the reported activity of PepC{Delta}432–435 on 20 different peptides gives a coherent picture of the specificity of the active site. PepC{Delta}432–435 can accommodate four residues on its new S subsites, the occupancy of which is dependant upon the composition of the peptidic substrate.

One of the primary determinants of the substrate specificity for PepC{Delta}432–435 is associated with position P2, in which a preference for residues with hydrophobic side chains was demonstrated, as in the case of other papain family members (Turk et al., 1998Go). Moreover, PepC{Delta}432–435 also accepts Pro at position P2, an unusual property which has been only found for cruzipain, the major cysteine protease from Trypanosoma cruzi (Del Neri et al., 1997). The S3 binding site is more tolerant than S2 but a slight preference for hydrophobic residues at this position has also been reported for papain and cathepsin L (Koga et al., 1990Go; Turk et al., 1998Go).

As a consequence of the oligomeric organization of PepC, the hydrolytic activity is restricted to peptides which can go through the central channel giving access to the active sites. We did not observe cleavage on peptides exceeding 16 residues in length, although the composition of some of them was compatible with their hydrolysis by PepC{Delta}432–435. This result is not exclusive to the mutant, but was also observed for PepCwt (data not shown). Consequently, it is likely that a length of 16–18 residues constitutes the upper limit for a peptide to be hydrolysed by PepC. On the other hand, peptides of fewer than 6 residues in size are not hydrolyzed by PepC{Delta}432–435, while they constitute good substrates for PepCwt. As a consequence of the elimination of the C-terminal residues in the enzyme, the enzymatic activity requires more extensive enzyme–substrate contacts which are not provided by small peptides.

Further similarities with the papain family are found through the inhibitory activity of E64 and leupeptin. These molecules poorly react with the wild-type enzyme while PepC{Delta}432–435 is strongly inhibited by them. The rate constant of inactivation determined for E64 on PepC{Delta}432–435 is the highest among those determined for the peptidases of the papain family (Barrett et al., 1982Go). The crystallographic structures of several cysteine proteases with E64 or leupeptin have shown that these inhibitors interact with the S subsites of cysteine proteases. Moreover, E64 and leupeptin possess a leucyl group at position P2 that binds within the S2 subsite. This result confirms the preference of the cysteine peptidases for hydrophobic residues at position P2 (Varughese et al., 1989Go; Schröder et al., 1993Go; Fujishima et al., 1997Go). It has recently been reported that the deletion of the two last residues of the mature yeast enzyme, GAL6, also favoured the inhibition by leupeptin (Zheng et al., 1998Go).

Structural and functional studies have revealed that the exopeptidase specificity of different members of the papain family are determined by structural elements which partially filled the active site cleft. For example, the dipeptidyl carboxypeptidase activity of cathepsin B is due to the presence of an 18-residue surface loop, called the occluding loop, which restricts the access to the S' subsites (Musil et al., 1991Go). Furthermore, two histidine residues provide positive charges, which anchors the carboxyl group of the substrate (Illy et al., 1997Go). In the case of cathepsin H, the insertion into the active site cleft of an octapeptide which originates from the propeptide, defines the aminopeptidase specificity. It is located in front of the S1 subsite, and the carboxylate group of the last Thr residue is positioned to interact with the amino group of the substrate (Guncar et al., 1998Go). The well conserved C-terminal extension in the PepC and bleomycin hydrolase family is an essential motif which plays a similar role.

The results of the present work demonstrate that PepC possesses a partially occluded active site cleft with substrate binding properties which are close to those described for other members of the papain family.


    Acknowledgments
 
We are grateful to Marta Erra-Pujada for her assistance with the construction of the mutant enzyme. We would like to thank Claire Gay for her assistance with the preparation of the manuscript. L.M. was beneficiary of a fellowship from the Ministerio de Educacion y Cultura of the Spanish Government and also the European Community (FAIR-CT98-5066).


    Notes
 
1 To whom correspondence should be addressed Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Barrett,A.J., Kembhavi,A.A., Brown,M.A., Kirschke,H., Knight,C.G., Tamai,M. and Hanada,K. (1982) Biochem. J., 201, 189–198.[Web of Science][Medline]

Bradford,M.M. (1976) Anal. Biochem., 72, 248–254.[Web of Science][Medline]

Brömme,D., Rossi,A.B., Smeekens,S.P., Anderson,D.C. and Payan,D.G. (1996) Biochemistry, 35, 6706–6714.[Medline]

Chapot-Chartier,M.-P., Nardi,M., Chopin,M.-C., Chopin,A. and Gripon,J.-C. (1993) Appl. Environ. Microbiol., 59, 330–333.[Abstract/Free Full Text]

Chapot-Chartier,M.-P., Rul,F., Nardi,M. and Gripon,J.-C. (1994) Eur. J. Biochem., 224, 497–506.[Web of Science][Medline]

Del Nery,B., Juliano,M.A., Meldal,M.M., Svendsen,I., Scharfstein,J. Walmsley,A. and Juliano,L. (1997) Biochem. J., 323, 427–433.

Enenkel,C. and Wolf,D.H. (1993) J. Biol. Chem., 268, 7036–7043.[Abstract/Free Full Text]

Ferrando,A.A., Velasco,G., Campo,E. and Lopez-Otin,C. (1996) Cancer Res., 56, 1746–1750.[Abstract/Free Full Text]

Fraser,C.M. et al. (1998) Science 281, 375–388.[Abstract/Free Full Text]

Fujishima,A., Imai,Y., Nomura,T., Fujisawa,Y., Yamamoto,Y. and Sugawara,T. (1997) FEBS Lett., 407, 47–50.[Web of Science][Medline]

Guillou,H., Miranda,G. and Pelissier,J.-P. (1987) Le Lait, 67, 135–148.

Guncar,G., Podobnik,M., Pungercar,J., Strukelj,B., Turk,V. and Turk,D. (1998) Structure, 6, 51–61.[Medline]

Illy,C., Quraishi,O., Wang,J., Purisima,E., Vernet,T. and Mort,J.S. (1997) J. Biol. Chem., 272, 1197–1202.[Abstract/Free Full Text]

Joshua-Tor,L., Xu,H.E., Johnston,S.A. and Rees,D.C. (1995) Science, 269, 945–950.[Abstract/Free Full Text]

Kambouris,N.G., Burke,D.J. and Creutz,C.E. (1992) J. Biol. Chem., 267, 21570–21576.[Abstract/Free Full Text]

Klein,J.R., Henrich,B. and Plapp,R. (1994) FEMS Microbiol. Lett., 124, 291–299.[Web of Science][Medline]

Koga,H., Yamada, H., Nishimura,Y., Kato,K. and Imoto,T. (1990) J. Biochem., 108, 976–982.[Abstract/Free Full Text]

Magdolen,U., Mueller,G., Magdolen,V. and Bandlow,W. (1993) Biochim. Biophys. Acta, 1171, 299–303.[Medline]

Mata,L., Erra-Pujada,M., Gripon,J.-C. and Mistou,M.-Y. (1997) Biochem. J., 328, 343–347.

Mistou,M.-Y. and Gripon,J.-C. (1998) Biochim. Biophys. Acta, 1383, 63–70.[Medline]

Monnet,V., Nardi,M., Chopin,A., Chopin,M.-C. and Gripon,J.-C. (1994) J. Biol. Chem., 269, 32070–32076.[Abstract/Free Full Text]

Musil,D., Zucic,D., Turk,D., Engh,R.A., Mayr,I., Huber,R., Popovic,T., Turk,V., Towatari,T., Katunuma,N. and Bode, W. (1991) EMBO J., 10, 2321–2330.[Web of Science][Medline]

Neviani,E., Boquien,C.-Y., Monnet,V., Phan Thanh,L. and Gripon,J.-C. (1989) Appl. Environ. Microbiol., 55, 2308–2314.[Abstract/Free Full Text]

Pritchard,G.G., Freebairn,A.D. and Coolbear,T (1994) Microbiology, 140, 923–930.[Abstract/Free Full Text]

Rawlings,N.D. and Barrett,A.J. (1993) Biochem. J., 290, 205–218.

Salvasen,G. and Nagase,H. (1989) In Beynon,R.J. and Bond,J.S. (eds), Proteolytic Enzymes. A Practical Approach. IRL Press, Oxford, pp. 85–89.

Schechter,I. and Berger,A. (1967) Biochem. Biophys. Res. Commun., 27, 157–162.[Web of Science][Medline]

Schröder,E., Phillips,C., Garman,E., Harlos,K. and Crawford,C. (1993) FEBS Lett., 315, 38–42.[Web of Science][Medline]

Sebti,S.M. and Lazo,J.S. (1987) Biochemistry 26, 432–437.[Medline]

Sebti,S.M., Mignano,J.E., Jani,J.P., Srimatkandada,S. and Lazo,J.S. (1989) Biochemistry 28, 6544–6548.[Medline]

Takeda,A., Masuda,Y., Yamamoto,T., Hirabayashi,T., Nakamura,Y. and Nakaya,K. (1996) J. Biochem., 120, 353–359.[Abstract/Free Full Text]

Turk,D., Guncar,G., Podobnik,M. and Turk,B. (1998) Biol. Chem., 379, 137–147.[Web of Science][Medline]

Varughese,K.I., Ahmed,F.R., Carey,P.R., Hasnain,S., Huber,C.P. and Storer,A.C. (1989) Biochemistry, 28, 1330–1332.[Medline]

Vesanto,E., Varmanen,P.,Steele,J. L. and Palva,A. (1994) Eur. J. Biochem., 224, 991–997.[Web of Science][Medline]

Zheng,W., Johnston,S.A. and Joshua-Tor,L. (1998) Cell, 93, 103–109.[Web of Science][Medline]

Received July 31, 1998; revised January 19, 1999; accepted April 29, 1999.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Gen Biol EvolHome page
H. Cai, R. Thompson, M. F. Budinich, J. R. Broadbent, and J. L. Steele
Genome Sequence and Comparative Genome Analysis of Lactobacillus casei: Insights into Their Niche-Associated Evolution
Gen Biol Evol, September 23, 2009; 2009(0): 239 - 257.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Mata, L.
Right arrow Articles by Mistou, M.-Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mata, L.
Right arrow Articles by Mistou, M.-Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?