Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Burrows, G.G.
Right arrow Articles by Vandenbark, A.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burrows, G.G.
Right arrow Articles by Vandenbark, A.A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Protein Engineering, Vol. 12, No. 9, 771-778, September 1999
© 1999 Oxford University Press

Design, engineering and production of functional single-chain T cell receptor ligands

G.G. Burrows1,2,3,4,4, J.W. Chang1, H-P. Bächinger2,5, D.N. Bourdette1,6, H. Offner1,4,4 and A.A. Vandenbark1,3,4,4

1 Department of Neurology, 2 Department of Biochemistry and Molecular Biology and 4 Department of Molecular Microbiology and Immunology, Oregon Health Sciences University, 3 Neuroimmunology Research and 6 Neurology Service, Veterans Affairs Medical Center and 5 Shriners Hospital for Children, Portland, Oregon 97201, USA


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Major histocompatibility complex (MHC) class II molecules are membrane-anchored heterodimers on the surface of antigen presenting cells (APCs) that bind the T cell receptor, initiating a cascade of interactions that results in antigen-specific activation of clonal populations of T cells. The peptide binding/T cell recognition domains of rat MHC class II (alpha-1 and beta-1 domains) were expressed as a single exon for structural and functional characterization. These recombinant single-chain T cell receptor ligands (termed `ß1{alpha}1' molecules) of approximately 200 amino acid residues were designed using the structural backbone of MHC class II molecules as template, and have been produced in Escherichia coli with and without N-terminal extensions containing antigenic peptides. Structural characterization using circular dichroism predicted that these molecules retained the antiparallel ß-sheet platform and antiparallel {alpha}-helices observed in the native MHC class II heterodimer. The proteins exhibited a cooperative two-state thermal folding–unfolding transition. ß1{alpha}1 molecules with a covalently linked MBP-72–89 peptide showed increased stability to thermal unfolding relative to the empty ß1{alpha}1 molecules. This new class of small soluble polypeptide provides a template for designing and refining human homologues useful in detecting and regulating pathogenic T cells.

Keywords: ß1{alpha}1/drug design/immunotherapy/MHC class II/TCR ligand


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
MHC class II molecules function to present foreign and self peptides to T lymphocytes to initiate and control immune responses. These heterodimeric membrane-bound glycoproteins are made up of non-covalently associated alpha- and beta-polypeptide subunits. Each subunit consists of a short cytoplasmic tail, a single membrane-spanning sequence, and two extracellular domains. X-ray crystallographic studies have demonstrated that these heterodimers may form a higher order structure consisting of dimers of these heterodimers, termed (dimer)2, on the surface of antigen presenting cells (APCs). The physiological role (if any) that (dimer)2 may play in antigen presentation, T cell recognition and T cell activation remains to be elucidated (Brown et al., 1993Go; Ploegh and Benaroch, 1993Go; Schafer et al., 1995Go; Fremont et al., 1996Go; Murthy and Stern, 1997Go). Peptides from processed antigen bind to MHC molecules in the membrane distal pocket formed by the ß1 and {alpha}1 domains (Brown et al., 1993Go; Stern et al., 1994Go). Structural analysis of human MHC class II/peptide complexes (Brown et al., 1993Go; Stern et al., 1994Go) demonstrated that side chains of the bound peptide interact with `pockets' comprised of polymorphic residues within the class II binding groove. The bound peptides have class II allele-specific motifs, characterized by strong preferences for specific amino acids at the positions that anchor the peptide to the binding pocket and a wide tolerance for a variety of different amino acids at other positions (Stern et al., 1994Go; Rammensee et al., 1995Go). Based on these properties, natural populations of MHC class II molecules are highly heterogeneous. A given allele of class II molecules on the surface of a cell has the ability to bind and present over 2000 different peptides (Chicz and Urban, 1994Go). In addition, bound peptides dissociate from class II molecules with very slow rate constants (Buss et al., 1987; Tampe and McConnell, 1991Go). Thus, it has been difficult to generate or obtain homogeneous populations of class II molecules bound to specific antigenic peptides.

Complexes of MHC–antigen have been purified as detergent extracts of lymphocyte membranes (Sharma et al., 1991Go) and as associated recombinant proteins using baculovirus and bacterial expression systems (Nag et al., 1993Nag et al., 1996; Kozono et al., 1994Go; Arimilli et al., 1995Go; Rhode et al., 1996Go). These two-chain, four-domain molecular complexes, after loading with selected peptide epitopes, have been demonstrated to interact with T cells in an antigen-specific manner (Matsui et al., 1991Go; Nag et al., 1992Go Nag et al., 1993; Nicolle et al., 1994Go; Spack et al., 1995Go). However, because of their size, heterodimeric structure and the presence of multiple disulfide bonds, class II MHC molecules present an inherently difficult in vitro folding problem. Furthermore, MHC class II molecules participate in other interactions during peptide presentation and TCR engagement. The {alpha}2 domain appears to contribute to ordered oligomerization in T cell activation (Konig et al., 1995Go), and the ß2 domain contains a CD4 binding site that co-ligates CD4 when the MHC–antigen complex interacts with the TCR {alpha} and ß chains (Fleury et al., 1991Go; Cammarota et al., 1992Go; König et al., 1992Go; Huang et al., 1997Go). Moreover, the ß1 domain has recently been implicated in CD4 binding, as shown by a lymphocyte binding assay using synthetic peptides (Brogdon et al., 1998Go).

To develop a simple and effective agent that could bind selectively to the TCR, we have engineered small (approximately 200 amino acid residues) molecules consisting of the {alpha}1 and ß1 domains of the rat MHC class II RT1.B molecule genetically linked into a single polypeptide chain, with and without covalently coupled antigenic peptide (Figure 1Go). We describe in this report the design, production and purification of MHC class II-derived `ß1{alpha}1' molecules that retain the biochemical properties required for TCR engagement. These findings anticipate the production of large amounts of TCR ligands for structural characterization and immunotherapeutic applications. Molecules with this design would be useful for studying binding specificity in vitro, for exploring primary TCR signalling events independent of co-stimulatory input, and for treating CD4+ T cell-mediated autoimmune disease in an epitope-specific manner.



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 1. MHC class II and the single-chain ß1{alpha}1 molecule. A scale model of an MHC class II molecule on the surface of an APC and the soluble single-chain ß1{alpha}1 molecules derived from the antigen-binding/T cell recognition domains. The polypeptide backbone extracellular domain is based on the crystallographic coordinates of HLA DR1 (PDB accession code 1AQD), and the transmembrane domains are shown schematically as 0.5 nm cylinders, roughly the diameter of a polyglycine {alpha}-helix. Color scheme: {alpha}-chain, red; ß-chain, blue. Bound antigenic peptide is green. The N- and C-termini of the MHC class II and ß1{alpha}1 molecules are labeled N, C, respectively. Disulfide bonds are displayed as ball and stick models. The same color scheme is maintained on the ß1{alpha}1–peptide molecule. In addition, the poly-linker (black) containing a thrombin cleavage site (red) is shown.

 

    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Homology modeling

Sequence alignment of MHC class II molecules from rat, human and mouse species provided a starting point for our studies. The program Sybyl (Tripos Associates, St Louis, MO) was used to generate graphic images using an O2 workstation (Silicon Graphics, Mountain View, CA) and coordinates deposited in the Brookhaven Protein Data Bank (Brookhaven National Laboratories, Upton, NY). Structure-based homology modeling was based on the refined crystallographic coordinates of human DR1 (Brown et al., 1993Go; Murthy and Stern, 1997Go), murine I-Ek molecules (Fremont et al., 1996Go) and scorpion toxins (Zhao et al., 1992Go; Housset et al., 1994Go; Zinn-Justin et al., 1996Go). Amino acid residues in human DR1 (PDB accession numbers 1SEB, 1AQD) were substituted with the rat RT1.B side chains, and the peptide backbone was modeled as a rigid body during structural refinement using local energy minimization.

Cloning the ß 1 {alpha} 1 constructs

dsDNA fragments encoding RT1B {alpha}1 and ß1 domains were prepared from cloned RT1.B {alpha}- and ß-chain coding sequences (Syha et al., 1989Go; Syha-Jedelhauser et al., 1991Go) by PCR amplification. Generation of dsDNA encoding ß1{alpha}1 molecules with covalently coupled antigenic peptides was an extension of the cloning strategy recently described for production of empty ß1{alpha}1 molecules (Burrows et al., 1998Go). Production of the covalent ß1{alpha}1–peptide construct involved adding a 210 bp insertion sequence, what we have termed the `peptide–linker cartridge' DNA fragment, near the 5' end of the fragment encoding ß1{alpha}1. The primers used to generate the ß1{alpha}1–peptide–linker cartridge DNA were the XhoI 5' oligo and the 5'-GAAATCCCGCGGGGAGCCTCCACCTCCAGAGCCT- CGGGGCACTAGTGAGCCTCCACCTCCGAAGTGCACCACTGGGTTCTCATCCTGAGTCCTCTGGCTCTTCTGTGGGGAGTCTCTGCCCTCAGTCC-3' (3'-MBP-72–89/linker ligation oligo). The primers used to generate the 559 bp DNA fragment with a 5' overhang for annealing to the ß1{alpha}1–peptide–linker cartridge cDNA were 5'-GCTCCCCGCGGGATTTCGTGTACCAGTTCAA-3' (5' peptide–linker ligation oligo); and the KpnI 3' oligo. Annealing and extension resulted in the 750 bp full-length ß1{alpha}1–MBP-72–89 construct. PCR was conducted with Taq polymerase (Promega, Madison, WI) and PCR products were isolated by agarose gel electrophoresis and purified using Gene Clean (Bio 101, Inc., La Jolla, CA). ß1{alpha}1 and ß1{alpha}1–MBP-72–89 cDNAs were moved into cloning vector pCR2.1 (Invitrogen, Carlsbad, CA) using Invitrogen's TA Cloning® kit. Modifications at the 5' and 3' ends of the ß1{alpha}1 and ß1{alpha}1–MBP-72–89 cDNAs were made for directional subcloning into pET21d+ (Novagen, Madison, WI; Studier et al., 1990Go). These primers were 5'-CAGGGACCATGGGCAGAGACTCCCCA-3' (NcoI 5' oligo); 5'-GCCTCCTCGAGTTAGTTGACAGCTTGGGTT-3' (XhoI 3' oligo); and, to generate molecules having six histidine residues as a C-terminal extension for streamlining purification, 5'-CTCGAGTTAGTGGTGGTGGTGGTGGTGGTTGACAGCTTGGGTTGAATT-3' (His6-XhoI 3' oligo).

The primers used to generate the MBP-55–69–linker cartridge were 5'-TATTACCATGGGCAGAGACTCCTCCGGCAAGGATTCGCATCATGCGGCGCGGACGACCCACTACG- GTGGAGGTGGAGGCTCACTAGTGCCCC-3' (5' MBP-55–69 oligo); 5'-GGGGCACTAGTGAGCCTCCACCTCCACCGTAGTGGGTCGTCCGCGCCGCATGATGCGAATCCTTGCCGGAGGAGTCTCTGCCCATGGTAATA-3' (3' MBP-55–69 oligo). These were gel purified, annealed and then cut with NcoI and XhoI for ligation into ß1{alpha}1–MBP-72–89 digested with NcoI and XhoI, to produce a plasmid encoding the ß1{alpha}1–MBP-55–69 covalent construct.

The primers used to generate the CM-2–linker cartridge were 5'-TATTACCATGGGCAGAGACTCCAAACTGGAA-CTGCAGTCCGCTCTGGAAGAAGCTGAAGCTTCCCTGGAACACGGAGGTGGAGGCTCACTAGTGCCCC-3' (5' CM-2 oligo); 5'-GGGGCACTAGTGAGCCTCCACCTCCGTGTTCCAGGGAAGCTTCAGCTTCTTCCAGAGCGGACTGCAGTTCCAGTTTGGAGTCTCTGCCCATGGTAATA-3' (3' CM-2 oligo). These were gel purified, annealed and then cut with NcoI and XhoI for ligation into ß1{alpha}1–MBP-72–89 digested with NcoI and XhoI, to produce a plasmid encoding the ß1{alpha}1–CM-2 covalent construct. All of the constructs have been confirmed by DNA sequencing.

EExpression and in vitro folding of the ß 1 {alpha}1 constructs

Escherichia coli strain BL21(DE3) cells were transformed with the pET21d+/ß1{alpha}1 and pET21d+/ß1{alpha}1/peptide vectors. Bacteria were grown in 1 l cultures to mid-logarithmic phase (OD600 0.6–0.8) in Luria-Bertani (LB) broth containing carbenicillin (50 µg/ml) at 37°C. Recombinant protein production was induced by addition of 0.5 mM isopropyl ß-D-thiogalactoside (IPTG). After incubation for 3 h, the cells were centrifuged and stored at –80°C before processing. All subsequent manipulations of the cells were at 4°C. The cell pellets were resuspended in ice-cold PBS, pH 7.4, and sonicated for 4x20 s with the cell suspension cooled in a salt/ice/water bath. The cell suspension was then centrifuged, the supernatant fraction was poured off, the cell pellet resuspended and washed three times in PBS and then resuspended in 20 mM ethanolamine/6 M urea, pH 10, for 4 h. After centrifugation, the supernatant containing the solubilized recombinant protein of interest was collected and stored at 4°C until purification. The recombinant proteins of interest were purified and concentrated by FPLC ion-exchange chromatography using Source 30Q anion-exchange media (Pharmacia Biotech, Piscataway, NJ) in an XK26/20 column (Pharmacia Biotech), using a step gradient with 20 mM ethanolamine/6 M urea/1 M NaCl, pH 10. After purification, the protein was dialyzed against 20 mM ethanolamine, pH 10.0, which removed the urea and allowed refolding of the recombinant protein. This step was critical. Basic buffers were required for all of the ß1{alpha}1 molecular constructs to fold correctly, after which they could be dialyzed into PBS at 4°C and concentrated by centrifugal ultrafiltration with Centricon-10 membranes (Amicon, Beverly, MA). For purification to homogeneity, a final step was included using size exclusion chromatography on Superdex 75 media (Pharmacia Biotech) in an HR16/50 column (Pharmacia Biotech). The final yield of purified protein varied between 15 and 30 mg/l of bacterial culture.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Homology modeling studies of rat MHC class II RT1.B and its antigen binding domain were conducted based on the crystal structures of human DR (Madden et al., 1991Go; Brown et al., 1993Go; Murthy and Stern, 1997Go) and murine I-Ek (Fremont et al., 1996Go) with covalently bound single peptides (Table IGo). The primary sequences of rat, human and mouse MHC class II were aligned (Figure 2Go). Of the 256 {alpha}-chain amino acids, 76 were identical (30%). Of the 265 ß-chain amino acids, 93 were identical (35%). Of particular interest, the primary sequence location of disulfide-bonding cysteines was conserved in all three species, and the backbone traces of the solved structures showed strong homology when superimposed, implying an evolutionarily conserved structural motif, with side-chain substitutions designed to allow differential antigenic-peptide binding in the peptide-binding groove.


View this table:
[in this window]
[in a new window]
 
Table I. MHC class II molecules with solved crystal structures
 


View larger version (85K):
[in this window]
[in a new window]
 
Fig. 2. Primary sequence alignment of representative rat, human and murine MHC class II molecules. The {alpha} and ß polypeptides of rat RT1.B, human HLA DQ, DR, DP and murine I-A and I-E MHC class II molecules are shown. The {alpha}1 and ß1 domains as well as the putative transmembrane (TM) domains are labeled. Homologous residues within the {alpha}1 and ß1 domains are highlighted in magenta. Conserved cysteine residues are shown in yellow.

 
Our analysis of these structures focused on the solvent accessible surface of the ß-sheet platform/anti-parallel {alpha}-helix that comprise the domain(s) involved in peptide binding and T cell recognition. The {alpha}1 and ß1 domains of the class II molecules analyzed showed an extensive hydrogen-bonding network and a tightly packed and buried hydrophobic core. This tertiary structure appears similar to the molecular interactions that provide structural integrity and thermodynamic stability to the {alpha}-helix/ß-sheet scaffold characteristic of scorpion toxins (Zhao et al., 1992Go; Housset, 1994; Zinn-Justin et al., 1996Go). Side chain densities for regions that correspond to primary sequence in between the ß1 and ß2 domains of human DR1 (1SEB, Jardetzky et al., 1994) as well as murine I-Ek (1IEA, 1IEB; Fremont et al., 1996) showed evidence of disorder in the crystal structures, supporting the notion that these are linker regions between the two domains with a high degree of freedom of movement in solution. Furthermore, crystals of MHC class II I-Ek contained a number of water molecules between the membrane proximal surface of the ß-sheet platform and the membrane distal surfaces of the {alpha}2 and ß2 Ig-fold domains. Calculations regarding the surface area of interaction between domains were quantified by creating a molecular surface for the ß1{alpha}1 and {alpha}2ß2 Ig-fold domains with an algorithm developed by Connolly (1986) and using the crystallographic coordinates for human DR1 available from the Brookhaven Protein Data Base (PDB ID code 1AQD). In this algorithm the molecular surfaces are represented by `critical points' describing holes and knobs. Holes (maxima of a shape function) are matched with knobs (minima). The surface areas of the ß1{alpha}1 and {alpha}2ß2-Ig-fold domains were calculated independently, defined by accessibility to a probe of radius 0.14 nm, about the size of a water molecule. The surface area of the MHC class II {alpha}ß-heterodimer was 156 nm2, while that of the ß1{alpha}1 construct was 81 nm2 and the {alpha}2ß2-Ig-fold domains was 90 nm2. Approximately 15 nm2 (18.5%) of the ß1{alpha}1 surface is buried by the interface with the Ig-fold domains in the MHC class II {alpha}ß-heterodimer. Side-chain interactions between the ß1{alpha}1-peptide binding and Ig-fold domains ({alpha}2 and ß2) were analyzed as shown in Figure 3Go. These interactions appear to be dominated by polar interactions with hydrophobic interactions potentially serving as a `lubricant' in a highly flexible `ball and socket' type inter face.



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 3. Interaction surface between Ig-fold domains and the ß1{alpha}1 peptide binding/T cell recognition domain. The interaction surface was modeled and refined using the high resolution human class II DR1 structure 1AQD (Murthy et al., 1997). Color scheme: {alpha}-chain, red; ß-chain, blue. Bound antigenic peptide is green, with the N-termini colored orange. The N- and C-termini of MHC class II are labeled N, C, respectively. Cysteines are colored yellow. The interaction surface between the Ig-fold domains and the ß1{alpha}1 peptide binding/T cell recognition domain is colored green. Water molecules within this interface in the 1AQD crystal structure are shown as red spheres. The side chains of residues from the {alpha}1 domain that make up this interaction surface are shown as ball and stick structures. A set of conserved residues (F26–E30) from the {alpha}1 domain reside within a dominant pocket of this interaction surface. The domains have been separated from the interaction surface by ~1.2 nm for clarity.

 
Our modeling studies and the nature of these side-chain interactions predicted that the antigen binding domain would remain stable in the absence of the {alpha}2 and ß2 Ig-fold domains. Novel genes were constructed by splicing sequence encoding the N-terminus of the RT1.B {alpha}1 domain to sequence encoding the C-terminus of the ß1 domain. In addition, covalently coupled ß1{alpha}1–peptide molecules were produced, which involved engineering an insertion sequence that encoded a covalently coupled antigenic peptide and a thrombin cleavage site embedded within a flexible linker. Within this linker a unique SpeI restriction endonuclease site allowed production of ß1{alpha}1 molecules with different covalently coupled peptides by simply cutting the ß1{alpha}1–peptide construct and directionally cloning in the DNA fragment of interest. Our preliminary studies involved the `empty ß1{alpha}1' molecule (Burrows et al., 1998Go) and four constructs with covalently coupled rat and guinea pig antigenic peptides: ß1{alpha}1–Rt-MBP-72–89, ß1{alpha}1–Gp-MBP-72–89, ß1{alpha}1–Gp-MBP-55–69 and ß1{alpha}1–Rt-CM-2 (Figure 4Go).



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 4. Nucleotide and protein sequences of the ß1{alpha}1–peptide constructs. (a) The nucleotide and primary amino acid sequence for the `empty' ß1{alpha}1 construct (Burrows et al., 1998). Unique NcoI, PstI, and XhoI restriction sites are in bold. The end of the ß1 domain and start of the {alpha}1 domain are indicated. (b) In-frame peptide/linker insertion encoding the rat (T12) and Guinea pig (S12) MBP-72–89 peptides (bold), a flexible linker with an embedded thrombin cleavage site (Fremont et al., 1996), and a unique SpeI restriction site which can be used for rapidly exchanging the encoded N-terminal peptide. The only amino acid difference between the two sequences (*) is residue 12; Thr in rat, Ser in Guinea pig. (c) NcoI–SpeI fragment encoding Gp-MBP-55–69 (bold). (d) NcoI–SpeI fragment encoding CM-2 (bold).

 
Expression and production of ß1{alpha}1 constructs

Protein expression was tested in a number of different E.coli strains, including a thioredoxin reductase mutant which allows disulfide bond formation in the cytoplasm (Derman, 1993). With such a small molecule, it became apparent early on in our studies that the greatest yield of material could be readily obtained by harvesting protein expressed as insoluble inclusion bodies in E.coli strain BL21(DE3). This allowed us to avoid problems with proteases associated with large scale production of recombinant protein in bacteria. After purification, the protein was dialyzed against 20 mM ethanolamine, pH 10.0, which removed the urea and allowed refolding of the recombinant protein. The same methodology was used to make the empty ß1{alpha}1 and covalent complexes of ß1{alpha}1 with MBP-72–89, and control peptides Gp-MBP-55–69 and CM-2. Both the rat and guinea pig MBP-72–89 covalent constructs (rat, Rt-MBP-72–89: PQKSQRTQDENPVVHF; guinea pig, Gp-MBP-72–89: PQKSQRSQDENPVVHF) have been produced, and the MBP-55–69 peptide is the guinea pig sequence (Figure 4Go). The final yields of ß1{alpha}1 and covalent ß1{alpha}1–peptide molecules was approximately 15–30 mg/l culture.

Biochemical characterization

The presence of the native disulfide bond between cysteines ß15 and ß79 (empty ß1{alpha}1 amino acid numbering) was demonstrated by a gel shift assay in which identical samples with or without the reducing agent ß-mercaptoethanol (ß-ME) were boiled 5 min prior to SDS–PAGE. In the absence of ß-ME disulfide bonds are retained and proteins typically move through acrylamide gels faster due to their more compact structure (Burrows et al., 1998Go). All of the ß1{alpha}1 and Rt-ß1{alpha}1–peptide molecules produced showed this pattern, indicating the presence of the native conserved disulfide bond (data not shown). These data represent a primary confirmation of the conformational integrity of the molecules. Samples of the ß1{alpha}1 and covalent ß1{alpha}1–peptide molecules from SDS–PAGE were transferred to a PVDF membrane for immunoblotting using the rat MHC class II RT1.B specific monoclonal antibody OX-6 as previously described (Burrows et al., 1998Go). All of the ß1{alpha}1 and ß1{alpha}1–peptide molecules were recognized by this antibody (data not shown).

Structural analysis

Circular dichroism (CD) reveals that the ß1{alpha}1 molecules have highly ordered secondary structures. The empty ß1{alpha}1 molecule contained approximately 30% {alpha}-helix, 15% ß-strand, 26% ß-turn and 29% random coil structures. The covalent ß1{alpha}1–MBP-72–89 and ß1{alpha}1–CM-2 showed similar, although not identical, secondary structural features (Figure 5Go). Comparison with the secondary structures of class II molecules determined by X-ray crystallography (Madden et al., 1991Go; Brown, et al., 1993; Fremont et al., 1996Go) provided strong evidence that the ß1{alpha}1 and ß1{alpha}1–peptide molecules shared the ß-sheet platform/anti-parallel {alpha}-helix secondary structure common to all class II antigen binding domains (Table IIGo). Thermal denaturation studies revealed a high degree of cooperativity and stability of the molecules (Figure 6Go). The biological integrity of these molecules has been demonstrated by their ability to detect and inhibit rat encephalitogenic T cells and treat experimental autoimmune encephalomyelitis (Burrows et al., 1998Go; Burrows,G.G., manuscript submitted).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5. Circular dichroism of the ß1{alpha}1 molecules show highly ordered structures. CD measurements were performed at 20°C on a Jasco J-500 instrument using 0.1 mm cells from 260 to 180 nm in 50 mM potassium phosphate, 50 mM sodium fluoride, pH 7.8. Analysis of the secondary structure was performed with the variable selection method (Compton and Johnson, 1986Go). ß1{alpha}1 (empty), covalent ß1{alpha}1–MBP-72–89 and covalent ß1{alpha}1–CM-2 spectra are shown.

 

View this table:
[in this window]
[in a new window]
 
Table II. Secondary structure content of ß1{alpha}1 and MHC class II
 


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 6. Thermal denaturation shows a high degree of cooperativity and stability of the ß1{alpha}1 molecules. The CD spectra was monitored at 222 nm as a function of temperature. The heating rate was 10°C/h. The graph charts the percent of unfolding as a function of temperature. 1.0 corresponds to the completely unfolded structure.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The data presented above demonstrate clearly that the ß1{alpha}1 construct with or without an associated antigenic peptide retain structural and conformational integrity consistent with refolded native MHC class II molecules. MHC class II molecules as modeled in Figure 1Go form a stable heterodimer that binds and presents antigenic peptides to the appropriate TCR. While there is substantial structural and theoretical evidence to support this model (Brown et al., 1993Go; Ploegh and Benaroch, 1993Go; Schafer et al., 1995Go; Fremont et al., 1996Go; Murthy and Stern, 1997Go), the precise role that contextual information may play in antigen presentation, T cell recognition and T cell activation remains to be elucidated. We have constructed soluble single-chain molecules derived from the antigen-binding ß1 and {alpha}1 domains of MHC class II. These molecules lack the {alpha}2 domain, the ß2 domain known to bind to CD4 and the transmembrane and intra-cytoplasmic sequences. The reduced size and complexity of the ß1{alpha}1 constructs gave us the ability to express and purify the molecules from bacterial inclusion bodies in high yield (15–30 mg/l cell culture). The ß1{alpha}1 molecules refolded upon dialysis into PBS and had excellent solubility in aqueous buffers.

Our approach used molecular modeling, combining structural information from X-ray crystallographic data with recombinant DNA technology to design and produce single chain TCR ligands based on the natural MHC class II peptide binding/T cell recognition domain. In the native molecule this domain is derived from portions of the {alpha} and ß polypeptide chains which fold together to form a tertiary structure, most simply described as a ß-sheet platform upon which two anti-parallel helical segments interact to form an antigen-binding groove. A similar structure is formed by a single exon encoding the alpha-1 and alpha-2 domains of MHC class I molecules, with the exception that the peptide-binding groove of MHC class II is open-ended, allowing the engineering of single-exon constructs that encode the peptide binding/T cell recognition domain and an antigenic peptide ligand. Our extension of this work towards designing covalent {alpha}1{alpha}2–peptide MHC class I molecules has been supported by recent structural data demonstrating an MHC class I molecule with a peptide extending from one end of a class I MHC binding site (Collins et al., 1994). While a pharmacological approach to T cell mediated diseases is still in its infancy, development of the ß1{alpha}1 molecules described in this report will allow careful evaluation of the specific role played by the ß1{alpha}1 domain, independent from the platform {alpha}2ß2-Ig-fold domains.

ß1{alpha}1/{alpha}2ß2-Ig-fold interface

Modeling studies have highlighted a number of interesting features regarding the interface between the ß1{alpha}1 and {alpha}2ß2-Ig-fold domains. The {alpha}1 and ß1 domains showed an extensive hydrogen-bonding network and a tightly packed and buried hydrophobic core. The ß1{alpha}1 domain may have the ability to move as a single entity independent from the {alpha}2ß2-Ig-fold `platform'. Besides evidence of a high degree of mobility in the side-chains that make up the linker regions between these two domains (Jardetzky et al., 1994Go; Fremont et al., 1996Go), crystals of MHC class II I-Ek contained a number of water molecules within this interface (Fremont et al., 1996Go; Murthy and Stern, 1997Go). The interface between the ß1{alpha}1 and {alpha}2ß2-Ig-fold domains appears to be dominated by polar interactions, with hydrophobic residues potentially serving as a `lubricant' in a highly flexible `ball and socket' type interface (Burrows,G.G., manuscript in preparation). Flexibility at this interface may be required for freedom of movement within the {alpha}1 and ß1 domains for binding/exchange of peptide antigen. Alternatively or in combination, this interaction surface may play a potential role in communicating information about the MHC class II–peptide molecules interaction with TCRs back to the APC.

Conserved ß1-domain disulfide bond

The ß1-domain of MHC class II molecules contains a disulfide bond that covalently couples the C-terminal end of its {alpha}-helical segment to the first strand of the anti-parallel ß-sheet platform contributed by the ß1 domain. This structure is conserved among MHC class II molecules from rat, human and mouse, and appears to serve a critical function, acting as a `linchpin' that allows primary sequence diversity in the molecule while maintaining its tertiary structure. Critical analysis of the primary sequence using a helical wheel diagram of amino acid residues within two helical turns (7.2 residues) of cysteine 79 as well as analysis of the ß-sheet platform around cysteine 15 reveal a number of interesting features of the molecule, the most significant being very high diversity along the peptide-binding groove face of the helix and ß-sheet platform. Interestingly, a face of the helix composed of residues L68, E69, R72, A73, D76, R80 and Y83 is conserved among all rat, human and mouse class II and may serve an as yet undefined function, such as interaction with other components of the TCR complex. Site-directed mutagenesis studies using the novel ß1{alpha}1 molecules described in this report will allow careful dissection of the specific role played by each of these residues.

Circular dichroism spectra

The circular dichroic spectra indicate that the ß1{alpha}1 molecules are highly ordered and that the secondary structural content is consistent with the known features of the peptide binding/T cell recognition domains ({alpha}1 and ß1 domains). Thermal stability measurements indicate that the ß1{alpha}1 molecules are very stable and unfold cooperatively. Both the covalent ß1{alpha}1–MBP-72–89 and ß1{alpha}1–CM-2 molecules show a greater thermal stability than the empty ß1{alpha}1 molecule, while the ß1{alpha}1–CM-2 covalent construct with a six-histidine tag on the C-terminal is less stable than the empty ß1{alpha}1. An explanation for this observation may be that the histidine tag helps destabilize the hydrogen-bonded ß-sheet platform above 60°C. Evidence that the CM-2 peptide is constrained within the binding groove at room temperature is provided by the CD spectra, which show no gross increase in {alpha}-helical content compared with the other ß1{alpha}1 molecules.

From a drug engineering and design perspective this prototypic molecule represents a major breakthrough. Development of the ß1{alpha}1 molecules described in this report separates for the first time the peptide binding ß1{alpha}1 domains from the platform {alpha}2ß2 Ig-fold domains, allowing studies of their biochemical and biological properties independently, both from each other and from the vast network of information exchange that occurs at the cell surface interface between APC and T cell during MHC–peptide engagement with the T cell receptor. Because of their simplicity, biochemical stability, biological properties and structural similarity with human class II homologues, the rat ß1{alpha}1 constructs described here raises the possibility of using this construct as a template for engineering human homologues for treatment of autoimmune diseases. Development of ligands that bind T cell receptors in an antigen-specific manner will have a number of practical applications, and have been the subject of intense research by a number of different laboratories over the last decade (Matsui et al., 1991Go; Sharma et al., 1991Go; Nag et al., 1993 Nag et al., 1996; Kozono et al., 1994Go; Rhode et al., 1996Go). Practical applications include the ability to target, label and/or purify antigen-specific T cells, activate T cells in combination with other molecules and to treat conditions mediated by antigen-specific T cells (Burrows et al., 1998Go).


    Acknowledgments
 
The authors acknowledge generous support from The Medical Research Foundation, a pilot project from the National Multiple Sclerosis Society, the Department of Veterans Affairs and the Nancy Davis Center Without Walls. RT1.B {alpha}- and ß-chain cDNA coding sequences ({alpha}6, ß118, respectively) were a generous gift from Dr Konrad Reske, Mainz, Germany.


    Notes
 
4 To whom correspondence should be addressed Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Arimilli,S., Cardoso,C., Mukku,P., Baichwal,V. and Nag,B. (1995) J. Biol. Chem., 270, 971–977.[Abstract/Free Full Text]

Bourdette,D.N. et al. (1991) J. Neurosci. Res., 30, 308–315.[Web of Science][Medline]

Brogdon,J., Eckels,D.D., Davies,C., White,S. and Doyle,C. (1998) J. Immunol., 161, 5472–5480.[Abstract/Free Full Text]

Brown,J.H., Jardetzky,T.S., Gorga,J.C., Stern,L.J., Urban,R.G. and Strominger,J.L. (1993) Nature 364, 33–39.

Burrows,G.G. Ariail,K., Celnik,B., Gambee,J.E., Bebo,B.F., Offner,H. and Vandenbark,A.A. (1996) J. Neurosci. Res., 45, 803–811.[Web of Science][Medline]

Burrows,G.G., Bebo,B.F.Jr., Adlard,K.L., Vandenbark,A.A. and Offner,H. (1998) J. Immunol., 161, 5987–5996.[Abstract/Free Full Text]

Buus,S., Sette,A. and Grey,H.M. (1987) Immunol. Rev., 98, 115.[Web of Science][Medline]

Cammarota,G. et al. (1992) Nature 356, 799–801.

Caspi,R.R. et al. (1988) J. Immunol., 140, 1490–1495.[Abstract]

Chicz,R.M. and Urban,R.G. (1994) Dev. Immunol. Today, 15, 155.

Cobbold,S.P., Nash,J.A., Prospero,T.D. and Waldham,H. (1988) Nature, 312, 548–551.

Compton,L.A., and Johnson,W.C.,Jr. (1986) Anal. Biochem., 155, 155–167.[Web of Science][Medline]

Connolly,M.L. (1986) Biopolymers, 25, 1229–1247.[Web of Science][Medline]

Cush,J.J. and Lipsky,P.E. (1988) Arthritis Rheum., 31, 1230–1238.[Web of Science][Medline]

Derman,A.I., Prinz,W.A., Belin,D. and Beckwith,J. (1993) Science, 262, 1744.[Abstract/Free Full Text]

Desbarats,J., Freed,J.H., Campbell,P.A., and Newell,M.K. (1996) Proc. Natl Acad. Sci. USA, 93, 11014–11018.[Abstract/Free Full Text]

Dessen,A., Lawrence,C.M., Cupo,S., Zaller,D.M. and Wiley,D.C. (1997) Immunity, 7, 473–478.[Web of Science][Medline]

Ferrin,T.E., Huang,C.C., Jarvis,L.E. and Langridge,R. (1988) J. Mol. Graphics, 6, 13–27.

Fleury,S., Lamarre,D., Meloche,S., Ryu,S.E., Cantin,C., Hendrickson,W.A. and Sekaly,R.P. (1991) Cell, 66, 1037–1049.[Web of Science][Medline]

Fremont,D.H., Hendrickson,W.A, Marrack,P. and Kappler,J. (1996) Science, 272, 1001–1004.[Abstract]

Hashim,G.A., Day,E.D., Fredane,L., Intintola,P. and Carvalho,E. (1986) J. Neurosci. Res., 16, 467–478.[Web of Science][Medline]

Hayball,J.D. Fidler,S.J. Palliser,D. Rees,A.D. Lamb,J.R. and Lake,R.A. (1997) Immunol. Cell Biol., 75, 148–153.[Medline]

Housset,D., Habersetzer-Rochat,C., Astier,J.P. and Fontecilla-Camps,J.C. (1994) J. Mol. Biol., 238, 88–91.[Web of Science][Medline]

Huang,B., Yachou,A., Fleury,S., Hendrickson,W. and Sekaly,R. (1997) J. Immunol., 158, 216–225.[Abstract]

Jardetzky,T.S., Brown,J.H., Gorga,J.C., Stern,L.J., Urban,R.G., Chi,Y.I., Stauffacher,C., Strominger,J.L. and Wiley,D.C. (1994) Nature, 368, 711–715.[Medline]

King,J. and Leimmli,U.K. (1973) J. Mol. Biol., 75, 315–337.[Web of Science][Medline]

König,R., Huang,L.Y. and Germain,R. (1992) Nature, 356, 796–798.[Medline]

König,R. Shen,X. and Germain,R.N. (1995) J. Exp. Med., 182, 779–787.[Abstract/Free Full Text]

Kozono,H., White,J., Clements,J., Marrack,P. and Kappler,J. (1994) Nature, 369, 151–154.[Medline]

Madden,D.R., Gorga,J.C., Strominger,J.L. and Wiley,D.C. (1991) Nature, 353, 321–325.[Medline]

Manavalan,P. and Johnson,W.C.,Jr. (1987) Anal. Biochem., 167, 76–85.[Web of Science][Medline]

Martenson,R.E. (1984) Myelin Basic Protein Speciation. In Experimental Allergic Encephalomy Elitis: A Useful Model for Multiple Sclerosis. Alan R.Liss, Inc., New York, pp. 511–521.

Matsui,K. et al. (1991) Science, 254, 1788–1791.[Abstract/Free Full Text]

Moebius,U., Pallai,P., Harrison,S.C. and Reinherz,E.L. (1993) Proc. Natl Acad. Sci. USA, 90, 8259–8263.[Abstract/Free Full Text]

Murthy,V.L. and Stern,L.J. (1997) Stucture, 5, 1385.[Medline]

Nag,B., Passmore,D., Kendrick,T., Bhayani,H. and Sharma,S.D. (1992) J. Biol. Chem., 267, 22624–22629.[Abstract/Free Full Text]

Nag,B., Deshpande,S.V., Sharma,S.D. and Clark,B.R. (1993a) J. Biol. Chem., 268, 14360–14366.[Abstract/Free Full Text]

Nag,B. et al. (1993b) Proc. Natl Acad. Sci. USA, 90, 1604–1608.[Abstract/Free Full Text]

Nag,B., ArimilliS., Mukku,P.V. and Astafieva,I. (1996a) J. Biol. Chem., 271, 10413–10418.[Abstract/Free Full Text]

Nag,B., Kendrick,T., Arimilli,S., Yu,S.C. and Sriram,S. (1996b) Immunol., 170, 25–33.

Nicolle,M.W. et al. (1994) J. Clin Invest., 93, 1361–1369.

Ploegh,H. and Benaroch,P. (1993) Nature, 364, 16–17.[Medline]

Quill,H. and Schwartz,R.H. (1987) J. Immunol., 138, 3704–3712.[Abstract]

Rammensee,H.-G., Friede,T. and Stevanovic,S. (1995) Immunogenetics, 41, 178.[Web of Science][Medline]

Rhode,P.R. et al. (1996) J. Immunol., 157, 4885–4891.[Abstract]

Schafer,P.H., Pierce,S.K. and Jardetzky,T.S. (1995) Seminars Immunol., 7, 389–398.[Medline]

Schwartz,R.H. (1996) J. Exp. Med., 184, 1–8.[Free Full Text]

Sharma,S.D. et al. (1991) Proc. Natl Acad. Sci. USA, 88, 11465–11469.[Abstract/Free Full Text]

Spack,E.G. et al. (1995) J. Autoimmun., 8, 787–807.[Web of Science][Medline]

Steinman,L. (1993) Sci. Am., 269, 106–114.

Stern,L.J., Brown,J.H., Jardetzky,T.S., Gorga,J.C., Urban,R.G. and Strominger,J.L. and Wiley,D.C. (1994) Nature, 368, 215.[Medline]

Studier,F.W., Rosenberg,A.H., Dunn,J.J. and Dubendorff,J.W. (1990) Methods Enzymol., 185, 60.[Medline]

Swanborg,R.H. (1983) J. Immunol., 130, 1503–1505.[Abstract]

Syha,J., Henkes,W. and Reske,K. (1989) Nucleic Acids. Res., 17, 3985.[Free Full Text]

Syha-Jedelhauser,J., Wendling,U. and Reske,K. (1991) Biochim. Biophys. Acta, 1089, 414–416.[Medline]

Tampe,R. and McConnell,H.M. (1991) Proc. Natl Acad. Sci. USA, 88, 4661.[Abstract/Free Full Text]

Thompson,D. and Larson,G. (1992) Biotechniques, 12, 656–658.[Web of Science][Medline]

Vandenbark,A.A., Gill,T. and Offner,H. (1985) J. Immunol., 135, 223–228.[Abstract]

Vandenbark,A.A., Vainiene,M., Celnik,B., Hashim,G.A., Buenafe,A.C. and Offner,H. (1994) J. Immunol., 15, 852–861.

Wegmann,K.W., Zhao,W., Griffin,A.C. and Hickey,W.F. (1994) J. Immunol., 153, 892–900.[Abstract]

Weinberg,A.D. et al. (1994) J. Immunol., 152, 4712–5721.[Abstract]

Weinberg,A.D. et al. (1992) J. Immunol., 148, 2109–2117.[Abstract]

Zhao,B., Carson,M., Ealick,S.E. and Bugg,C.E. (1992) J. Mol. Biol., 227, 239.[Web of Science][Medline]

Zinn-Justin,S., Guenneugues,M., Drakopoulou,E., Gilquin,B., Vita,C. and Menez,A. (1996) Biochemistry, 35, 8535–8543.[Medline]

Received February 2, 1999; revised April 9, 1999; accepted April 26, 1999.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
StrokeHome page
S. Subramanian, B. Zhang, Y. Kosaka, G. G. Burrows, M. R. Grafe, A. A. Vandenbark, P. D. Hurn, and H. Offner
Recombinant T Cell Receptor Ligand Treats Experimental Stroke
Stroke, July 1, 2009; 40(7): 2539 - 2545.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. Sinha, S. Subramanian, L. Miller, T. M. Proctor, C. Roberts, G. G. Burrows, A. A. Vandenbark, and H. Offner
Cytokine Switch and Bystander Suppression of Autoimmune Responses to Multiple Antigens in Experimental Autoimmune Encephalomyelitis by a Single Recombinant T-Cell Receptor Ligand
J. Neurosci., March 25, 2009; 29(12): 3816 - 3823.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Huan, L. J. Kaler, J. L. Mooney, S. Subramanian, C. Hopke, A. A. Vandenbark, E. F. Rosloniec, G. G. Burrows, and H. Offner
MHC Class II Derived Recombinant T Cell Receptor Ligands Protect DBA/1LacJ Mice from Collagen-Induced Arthritis
J. Immunol., January 15, 2008; 180(2): 1249 - 1257.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. Sinha, S. Subramanian, T. M. Proctor, L. J. Kaler, M. Grafe, R. Dahan, J. Huan, A. A. Vandenbark, G. G. Burrows, and H. Offner
A Promising Therapeutic Approach for Multiple Sclerosis: Recombinant T-Cell Receptor Ligands Modulate Experimental Autoimmune Encephalomyelitis by Reducing Interleukin-17 Production and Inhibiting Migration of Encephalitogenic Cells into the CNS
J. Neurosci., November 14, 2007; 27(46): 12531 - 12539.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. P. Fontenot, T. S. Keizer, M. McCleskey, D. G. Mack, R. Meza-Romero, J. Huan, D. M. Edwards, Y. K. Chou, A. A. Vandenbark, B. Scott, et al.
Recombinant HLA-DP2 Binds Beryllium and Tolerizes Beryllium-Specific Pathogenic CD4+ T Cells
J. Immunol., September 15, 2006; 177(6): 3874 - 3883.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. L. Jones, S. E. Brophy, A. J. Bankovich, L. A. Colf, N. A. Hanick, K. C. Garcia, and D. M. Kranz
Engineering and Characterization of a Stabilized {alpha}1/{alpha}2 Module of the Class I Major Histocompatibility Complex Product Ld
J. Biol. Chem., September 1, 2006; 281(35): 25734 - 25744.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
G. Adamus, G. G. Burrows, A. A. Vandenbark, and H. Offner
Treatment of Autoimmune Anterior Uveitis with Recombinant TCR Ligands.
Invest. Ophthalmol. Vis. Sci., June 1, 2006; 47(6): 2555 - 2561.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Offner, S. Subramanian, C. Wang, M. Afentoulis, A. A. Vandenbark, J. Huan, and G. G. Burrows
Treatment of Passive Experimental Autoimmune Encephalomyelitis in SJL Mice with a Recombinant TCR Ligand Induces IL-13 and Prevents Axonal Injury
J. Immunol., September 15, 2005; 175(6): 4103 - 4111.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Huan, S. Subramanian, R. Jones, C. Rich, J. Link, J. Mooney, D. N. Bourdette, A. A. Vandenbark, G. G. Burrows, and H. Offner
Monomeric Recombinant TCR Ligand Reduces Relapse Rate and Severity of Experimental Autoimmune Encephalomyelitis in SJL/J Mice through Cytokine Switch
J. Immunol., April 1, 2004; 172(7): 4556 - 4566.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Wang, J. L. Mooney, R. Meza-Romero, Y. K. Chou, J. Huan, A. A. Vandenbark, H. Offner, and G. G. Burrows
Recombinant TCR Ligand Induces Early TCR Signaling and a Unique Pattern of Downstream Activation
J. Immunol., August 15, 2003; 171(4): 1934 - 1940.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. H. McMahan, L. Watson, R. Meza-Romero, G. G. Burrows, D. N. Bourdette, and A. C. Buenafe
Production, Characterization, and Immunogenicity of a Soluble Rat Single Chain T Cell Receptor Specific for an Encephalitogenic Peptide
J. Biol. Chem., August 15, 2003; 278(33): 30961 - 30970.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. A. Vandenbark, C. Rich, J. Mooney, A. Zamora, C. Wang, J. Huan, L. Fugger, H. Offner, R. Jones, and G. G. Burrows
Recombinant TCR Ligand Induces Tolerance to Myelin Oligodendrocyte Glycoprotein 35-55 Peptide and Reverses Clinical and Histological Signs of Chronic Experimental Autoimmune Encephalomyelitis in HLA-DR2 Transgenic Mice
J. Immunol., July 1, 2003; 171(1): 127 - 133.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. G. Burrows, Y. K. Chou, C. Wang, J. W. Chang, T. P. Finn, N. E. Culbertson, J. Kim, D. N. Bourdette, D. A. Lewinsohn, D. M. Lewinsohn, et al.
Rudimentary TCR Signaling Triggers Default IL-10 Secretion by Human Th1 Cells
J. Immunol., October 15, 2001; 167(8): 4386 - 4395.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. G. Burrows, K. L. Adlard, B. F. Bebo Jr., J. W. Chang, K. Tenditnyy, A. A. Vandenbark, and H. Offner
Regulation of Encephalitogenic T Cells with Recombinant TCR Ligands
J. Immunol., June 15, 2000; 164(12): 6366 - 6371.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. W. Chang, D. E. Mechling, H.-P. Bachinger, and G. G. Burrows
Design, Engineering, and Production of Human Recombinant T Cell Receptor Ligands Derived from Human Leukocyte Antigen DR2
J. Biol. Chem., June 22, 2001; 276(26): 24170 - 24176.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Burrows, G.G.
Right arrow Articles by Vandenbark, A.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burrows, G.G.
Right arrow Articles by Vandenbark, A.A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?