Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by O'Hara, B. P.
Right arrow Articles by Pearl, L. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O'Hara, B. P.
Right arrow Articles by Pearl, L. H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Protein Engineering, Vol. 13, No. 2, 129-132, February 2000
© 2000 Oxford University Press

Structural adaptation to selective pressure for altered ligand specificity in the Pseudomonas aeruginosa amide receptor, AmiC

Bernard P. O'Hara1,2, Stuart A. Wilson1,4, Alan W.L. Lee1, S.Mark Roe1,3,5, Giuliano Siligardi6, Robert E. Drew1 and Laurence H. Pearl1,3,5,7

1 Department of Biochemistry and Molecular Biology and 3 Joint UCL/LICR X-Ray Crystallography Laboratory, University College London, Gower Street, London WC1E 6BT and 6 Pharmaceutical Optical Spectroscopy Centre, Department of Pharmacy, King's College London, Manresa Road, London SW3 6LX, UK


    Abstract
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 References
 
The AmiC protein in Pseudomonas aeruginosa is the negative regulator and ligand receptor for an amide-inducible aliphatic amidase operon. In the wild-type PAC1 strain, amidase expression is induced by acetamide or lactamide, but not by butyramide. A mutant strain of P.aeruginosa, PAC181, was selected for its sensitivity to induction by butyramide. The molecular basis for the butyramide inducible phenotype of P.aeruginosa PAC181 has now been determined, and results from a Thr->Asn mutation at position 106 in PAC181-AmiC. In the wild-type PAC1-AmiC protein this residue forms part of the side wall of the amide-binding pocket but does not interact with the acetamide ligand directly. In the crystal structure of PAC181-AmiC complexed with butyramide, the Thr->Asn mutation increases the size of the ligand binding site such that the mutant protein is able to close into its `on' configuration even in the presence of butyramide. Although the mutation allows butyramide to be recognized as an inducer of amidase expression, the mutation is structurally sub-optimal, and produces a significant decrease in the stability of the mutant protein.

Keywords: crystallography/ligand specificity/mutation/protein evolution/small molecule binding protein


    Introduction
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 References
 
AmiC is the negative regulatory component of a `molecular switch' which controls amide-inducible expression of the amidase operon of Pseudomonas aeruginosa (Wilson and Drew, 1991Go). Functionally, AmiC controls the activity of a transcription anti-termination factor, AmiR, which is required for transcription of the amidase operon past a {rho}-independent terminator occurring downstream of the constitutive amidase promoter (Drew and Lowe, 1989Go). In the presence of an inducing amide, inhibition of AmiR by AmiC is relieved, and expression of amidase and other genes of the operon (including amiC and amiR) is induced. Sensitivity to amides in vivo is conferred by AmiC, which functions as a cytoplasmic amide receptor, and has been shown to bind acetamide with micromolar affinity in vitro (Wilson et al., 1993Go).

Structurally, AmiC is a two-domain protein related to periplasmic small-molecule binding proteins (SMBPs) such as the Escherichia coli branched amino acid binding protein, LivJ (Sack et al., 1989Go). The crystal structure of an AmiC–acetamide complex determined at 2.1 Å resolution, precisely defined the amide binding site in AmiC (Pearl et al., 1994Go), which lies at the interface of the two domains, which are stabilized in a `closed' conformation by contacts with the bound ligand. This closed-down acetamide-bound form of AmiC represents the `on' configuration of the regulatory system, in which AmiR is free to interact with the leader RNA of the operon transcript, and permit full expression. The mechanism of amide-switched regulation of AmiR by AmiC remains to be determined, but it probably involves disruption of a silencing AmiC–AmiR complex on binding of inducing amides to AmiC (Wilson et al., 1996Go).

Amidase expression in the PAC1 strain of P.aeruginosa is strongly induced by acetamide (one carbon chain) and lactamide or propionamide (two carbon chain) but not by butyramide (three carbon chain), which instead acts as an anti-inducer in vivo and competes for binding to AmiC in vitro. Thus, lengthening of the aliphatic chain by a single carbon converts a strong agonist into an antagonist. We have now cloned and sequenced AmiC from the PAC181 strain of P.aeruginosa, which was generated by classical in vivo selection for its ability to induce amidase expression in the presence of butyramide (Turberville and Clarke, 1981Go). The crystal structure of the AmiC protein from this mutant strain reveals the subtle structural adaptation that enables the butyramide-inducible phenotype, again demonstrating the remarkable adaptability of the `small molecule binding protein' fold to the specific recognition of ligands.


    Material and methods
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 References
 
Cloning and characterization of PAC181 amidase regulatory genes

The genes amiC and amiR were amplified by PCR from PAC181 chromosomal DNA using the oligonucleotides CRA (ATCCGAATTCTCACAGGAGAGGAAACGGATG) and CRL (CCGATGCCGAAGCCTTGATGACGATACCCCTCTT), (Genosys, Cambridge, UK) and Taq DNA polymerase. The amplified DNA fragment was isolated from a preparative agarose gel, cloned initially into pUC19 (pSW181) and characterized by restriction enzyme mapping. The 1.8 kb amiCR fragment was then subcloned into the broad host range vector pMMB66EH (Temple et al., 1990Go) (plasmid pSW1181) and mobilized from E.coli S17-1 into P.aeruginosa PAC327 (amiC, amiR). Amidase activity was determined in intact cells under non-inducing, inducing and repressing conditions as described previously (Drew, 1984Go) and the results presented are the mean values of duplicate assays carried out on at least three separate occasions. One unit represents 1 µM acethydroxamate formed per min. Specific activities are units per mg of bacterial cells.

The nucleotide sequence of the amiC and amiR genes was determined by double-stranded sequencing using pSW181 as template as described previously (Wilson and Drew, 1991Go). Identification of mutations was facilitated by running parallel sequencing reactions of the PAC1 amiC and amiR genes.

Protein expression and purification

The mutant AmiC protein was isolated from P.aeruginosa strain PAC452 harbouring the plasmid pSW1181. Protein was overexpressed and purified essentially as described (Wilson et al., 1991Go), but with 5 mM butyramide (Sigma) present in the culture medium and maintained in all buffers during purification. The mutant PAC181 AmiC protein is much less easily handled than the wild type, and the omission of butyramide from the growth medium and isolation buffers significantly decreased the solubility of the mutant AmiC and prevented effective purification.

Crystallization of PAC181-AmiC–butyramide complex

The solubility profile of the PAC181-AmiC protein in the presence of butyramide proved to be significantly different from that for the PAC1-AmiC with acetamide (Wilson et al., 1991Go), and a new crystallization condition was identified using a sparse matrix screen (Jancarik and Kim, 1991Go). Crystals of diffraction quality were eventually obtained from micro-batch experiments containing 12.8 mg/ml PAC181-AmiC, 5 mM butyramide, 1.36 M sodium citrate and 100 mM HEPES-NaOH (pH 7.5), implemented under paraffin oil in Terasaki dishes (Chayen et al., 1992Go).

X-Ray data collection, processing and refinement

Diffraction data to 2.7 Å resolution were collected at 100 K from a single PAC181-AmiC–butyramide co-crystal, cryoprotected by soaking in 1.5 M sodium citrate, 100 mM HEPES-NaOH and 25% (v/v) glycerol, on a 30 cm MAR Image Plate detector mounted on a Rigaku RU200 rotating anode X-ray generator. Diffraction images were integrated using the MOSFLM package (Leslie, 1995Go) and reduced using the SCALA, AGROVATA and TRUNCATE programs of the CCP4 Suite (CCP4, 1994Go). The scaled and merged data consist of 10 102 unique reflections, 97.8% complete in the range 38 to 2.7 Å (97.2% in the outer shell), with an average of 2.7 observations per reflection, and a merging R-factor of 0.098 (0.185 in the outer shell). Although the crystallization conditions for PAC181-AmiC with butyramide differ significantly from those for PAC1-AmiC with acetamide, the space group of the crystals is the same (P42212), and unit cell parameters (a, 104.15 Å; c, 65.68 Å) are very similar. Initial models were obtained by simulated annealing refinement of the coordinates (PDB code: 1PEA) for the PAC1-AmiC–acetamide complex (Pearl et al., 1994Go) against the PAC181-AmiC–butyramide complex data, using X-PLOR (Brunger, 1992Go), but with coordinates for the bound acetamide and solvent molecules omitted from the start model, and residue 106 modelled as alanine. Difference electron density maps were calculated with {sigma}A-weighted coefficients to minimize model bias (Read, 1986Go), and examined using `O' (Jones et al., 1991Go). Subsequent simulated annealing and conjugate gradient refinement produced the current model consisting of 370 residues, 57 solvent molecules and a butyramide ligand. The crystallographic R-factor is 0.24 and the free-R factor with 5% of the data omitted from refinement is 0.30. The geometric parameters of the model are within the ranges expected at this resolution (Laskowski et al., 1993Go). Coordinates have been deposited in the Protein Data Bank with accession code 1QNL.

CD spectroscopy

Near-UV circular dichroism signals were measured on a nitrogen flushed Jasco J720 spectrapolarimeter. Measurements were made with protein concentrations of 0.4 mg/ml and ligand concentrations of 10 mM using a 1 cm pathlength cuvette. The CD signal at 289 nm was measured as a function of temperature and fit to a van't Hoff equation (Freeman et al., 1998Go). The PAC1-AmiC–acetamide complex displayed a Tm of 84°C; the PAC1-AmiC–butyramide complex a Tm of 79°C and the PAC181-AmiC–butyramide complex a Tm of 59°C.


    Results
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 References
 
Characterization of PAC181 amidase regulatory genes

Amidase activities were determined for P.aeruginosa strains PAC1 (wild-type), PAC181 (butyramide inducible), PAC327 (amiCR) and for PAC327 harbouring the plasmid pSW1181, which contains the 1.8 kb amiCR fragment amplified from PAC181 (see Materials and methods). PAC1 displayed characteristic lactamide inducibility, and PAC181 displayed lactamide and butyramide inducibility as previously described (Turberville and Clarke, 1981Go), but with lactamide inducibility at a lower level than in PAC1 (Table IGo). Despite the regulatory negative phenotype, there is some residual background amidase activity detectable in PAC327, but no induction is observed in the presence of lactamide or butyramide. PAC327 harbouring pSW1181 shows substantial induction of amidase activity in the presence of lactamide or butyramide, confirming that the butyramide inducible phenotype was retained in the cloned PAC181 amiCR fragment. Nucleotide sequencing of the entire fragment revealed only a single mutation from the wild-type PAC1 sequence, a C->A transversion at position 317 in the amiC gene.


View this table:
[in this window]
[in a new window]
 
Table I.. Amidase activity of P.aeruginosa strains
 
Molecular basis of butyramide inducibility of PAC181-AmiC

Earlier studies of the amidase operon had demonstrated that the responsiveness to amide inducers was a function of the AmiC protein (Wilson et al., 1993Go). Phenotypic changes in the response to specific amides by mutant strains would therefore be expected to be accompanied by mutations in the AmiC protein rather than in other components of the operon. The nucleotide sequence of the amiC gene from the butyramide-inducible strain P.aeruginosa PAC181 revealed a single base change relative to the wild-type amiC gene sequence, resulting in the replacement of a threonine residue at 106 in the PAC1-AmiC sequence (SwissProt entry AMIC_PSEAE) with an asparagine. As residue 106 is located close to the amide binding site at the interface of the N- and C-terminal domains of AmiC (Pearl et al., 1994Go), a mutation in this residue would be consistent with a change in amide ligand specificity (Figure 1Go).



View larger version (74K):
[in this window]
[in a new window]
 
Fig. 1. . Structure of AmiC-PAC181 butyramide complex. Secondary structure cartoon of AmiC-PAC181, with the N-terminal domain on the right and the C-terminal domain on the left. The positions of the butyramide ligand bound between the two domains, and the mutation at residue 106, are indicated.

 
To define the structural effect of the Thr106->Asn mutation in PAC181, the crystal structure of PAC181-AmiC was determined in complex with butyramide. Difference Fourier maps calculated after refinement with a model in which only a C{alpha} side chain was included for residue 106, clearly show electron density for asparagine rather than threonine (Figure 2Go), confirming the nucleotide sequence. Clear positive difference electron density is also present for a bound butyramide molecule whose amide head group and {alpha}-carbon are in essentially identical positions to the equivalent atoms of acetamide bound to PAC1-AmiC.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. . Electron density for the 106Thr->Asn mutation. Electron density from an FoFc map with structure factors calculated from the wild-type PAC1-AmiC (PDB code: 1PEA) refined against the PAC181-AmiC diffraction data, with the ligand omitted, and only a C{alpha} included for the side chain of residue 106. The resultant density (contoured at 1.25 Å) confirms the replacement of Thr by Asn at 106, as shown by sequencing of the PAC181-amiC gene, and the presence of butyramide.

 
The mutation of Thr106->Asn removes the {gamma}-methyl group of threonine, which forms part of the side wall of the amide binding pocket in PAC1-AmiC, and thereby increases the volume of the amide-binding site. Butyramide binds to PAC181-AmiC in an unfavourable folded-over conformation in which the {alpha} and ß methylene protons are eclipsed, and the {gamma}-methyl group is in van der Waal's contact with the plane of the amide head group. The ß methylene group is in van der Waal's contact with the {gamma}-methyl of Thr 233, and the {gamma}-methyl packs against the planes of the side chains of Asn106 and Tyr83 (Figure 3Go).



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 3. . Detailed interactions in the AmiC binding site. (a) Acetamide bound to PAC1-AmiC. (b) Butyramide bound to PAC181-AmiC. The loss of the C{alpha} of threonine, which delimits the side of the ligand-binding pocket in PAC1-AmiC, provides a space for the extra two carbons of the butyramide aliphatic chain. Hydrogen bonds are shown as broken cylinders.

 
Adaptation to binding butyramide destabilizes AmiC

In the wild-type PAC1-AmiC, the side-chain {gamma}-hydroxyl group of Thr106 is hydrogen bonded to the peptide oxygen of Cys82 and weakly (3.2 Å), to the side-chain amide of Gln27. The {gamma}-methyl of Thr106 is directed towards the amide-binding pocket, but does not make any direct contact with the bound acetamide in that complex. In the mutant PAC181-AmiC, the side chain of the Asn106 is orientated so that its Cß–C{gamma} bond bisects the direction of the {gamma}-hydroxyl and {gamma}-methyl of the Thr106 in the PAC1-AmiC. The amide nitrogen in the head group of Asn106 picks up the hydrogen bond to the peptide oxygen of Cys82, and makes a strong hydrogen bond (2.7 Å) to the amide head group of Gln27, which changes conformation to make this interaction. Thus, the substitution of Asn for Thr at 106 retains the hydrogen bonding interactions made by Thr106 in the wild-type PAC1-AmiC. However, the amide oxygen of Asn106 in the PAC181 mutant is left buried in a hydrophobic environment, packed against the side chain of Tyr83, and with no hydrogen bonds to the rest of the protein, or to any solvent molecules. The burial of this polar group without any compensating interactions would be expected to be highly unfavourable. Consistent with this, the melting temperature (Tm) measured by near-UV CD (see Materials and methods) for denaturation of PAC181-AmiC with butyramide bound is down-shifted 20 K compared with the Tm of the PAC1-AmiC with butyramide, which is a poor ligand for the wild-type AmiC. Compared with the Tm for PAC1-AmiC with bound acetamide, an optimal ligand, the Tm for PAC181-AmiC with butyramide is decreased by 25 K (Figure 4Go).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4. . Melting curves for AmiC–ligand complexes. Denaturation of AmiC–ligand complexes as a function of temperature, followed by change in the near-UV circular dichroism signal at 289 nm. Curves are for PAC1-AmiC–acetamide complex (•), PAC1-AmiC–butyramide complex ({blacktriangleup}) and PAC181–butyramide complex ({circ}).

 

    Discussion
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 References
 
Before the advent of recombinant DNA technology, biological selection and screening of mutagenized cultures was the only way in which molecular evolution could be studied. With the P.aeruginosa amidase, an advantage at the outset was the differing inducer and substrate specificities of the system (Kelly and Clarke, 1962Go). A large number of both regulatory and structural gene mutations were isolated which allowed growth on novel amide substrates (Clarke and Drew, 1988Go). These novel abilities have been attributed to changes in the amidase itself and to those in the negative regulator, ligand receptor, AmiC. AmiC, a member of the SMBP family, contains a widely used and adaptable ligand binding site. It appears that a single amino acid substitution in a residue close to the binding site in the AmiC of the butyramide inducible strain PAC181 is solely responsible for the new phenotype. PAC181 also contains a single residue substitution within the amidase enzyme itself; Ser->Phe at position 7. This gives an enzyme with higher activity towards butyramide hydrolysis (Turberville and Clarke, 1981Go), although the structural basis for this remains to be determined. PAC181 thus represents a new strain able to use butyramide, a repressor of the wild-type system, to induce expression of a new butyramide hydrolysing enzyme.

In adapting to butyramide induction via the Thr106->Asn mutation, PAC181-AmiC undergoes a significant decrease in its thermostability compared with wild type, and its half-life in vivo would be expected to be correspondingly shorter. However, the selective pressure to which the PAC181-AmiC sequence is a response, requires only that the amidase operon be inducible by butyramide. Thus, so long as the mutant AmiC can be synthesized at a sufficient level, fold and fulfil its biological role, its absolute structural stability need not be optimal. It is protein function that is selected in evolution, not structural stability, a fact often neglected in theoretical analyses of protein structure.


    Acknowledgments
 
We are very grateful to Prof. Patricia H.Clarke FRS for her continuing interest. Work on the amidase operon at UCL has been supported by project grants from the BBSRC and Wellcome Trust to R.E.D. and L.H.P.


    Notes
 
2 Present address: Department of Crystallography, Birkbeck College, Malet Street, London WC1E 7HX, UK Back

4 Present address: Department Biomolecular Sciences, UMIST, PO Box 88, Manchester M60 1QD, UK Back

5 Present address: Section of Structural Biology, Institute of Cancer Research, Chester Beatty Laboratories, 237 Fulham Road, London SW3 6JB, UK Back

7 To whom correspondence should be addressed; email: l.pearl{at}icr.ac.uk Back

Bernard P.O'Hara and Stuart A.Wilson contributed equally to this work


    References
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Discussion
 References
 
Brunger,A. (1992) X-PLOR Version 3.1. A System for X-Ray Crystallography and NMR. Yale University Press, New Haven.

CCP4 (1994) Acta Crystallogr., D50, 760–763.

Chayen,N.E., Stewart,P.D.S. and Blow,D.M. (1992) J. Cryst. Growth, 122, 176–180.

Clarke,P.H. and Drew,R. (1988) Bioscience Rep., 8, 103–120.[Web of Science][Medline]

Drew,R. and Lowe,N. (1989) J. Gen. Microbiol., 135, 817–823.[Abstract/Free Full Text]

Drew,R.E. (1984) J. Gen. Microbiol., 130, 3101–3111.[Abstract/Free Full Text]

Freeman,D.J., Pattenden,G., Drake,A.F. and Siligardi,G. (1998) J. Chem. Soc. Perkin, 2, 129–135.

Jancarik,J. and Kim,S.H. (1991) J. Appl. Crystallogr., 24, 409–411.

Jones,T.A., Zou,J.-Y., Cowan,S.W. and Kjeldgaard,M. (1991) Acta Crystallogr., A47, 110–119.

Kelly,M. and Clarke,P.A. (1962) J. Gen. Microbiol., 27, 305–316.

Laskowski,R.A., Macarthur,M.W., Moss,D.S. and Thornton,J.M. (1993) J. Appl. Crystallogr., 26, 283–291.

Leslie,A.G.W. (1995) MOSFLM Users Guide. MRC Laboratory of Molecular Biology, Cambridge.

Pearl,L.H., O'Hara,B.P., Drew,R.E. and Wilson,S.A. (1994) EMBO J., 13, 5810–5817.[Web of Science][Medline]

Read,R.J. (1986) Acta Crystallogr., A42, 140–149.

Sack,J.S., Saper,M.A. and Quiocho,F.A. (1989) J. Mol. Biol., 206, 171–191.[Web of Science][Medline]

Temple,L., Cuskey,S.M., Perkins,R.E., Bass,R.C., Morales,N.M., Christie,G.E., Olsen,R.H. and Phibbs,P.V. (1990) J. Bacteriol., 172, 6396–6402.[Abstract/Free Full Text]

Turberville,C. and Clarke,P.H. (1981) FEMS Microbiol. Lett., 10, 87–90.

Wilson,S. and Drew,R. (1991) J. Bacteriol., 173, 4914–4921.[Abstract/Free Full Text]

Wilson,S.A., Chayen,N.E., Hemmings,A.M., Drew,R.E. and Pearl,L.H. (1991) J. Mol. Biol., 222, 869–871.[Web of Science][Medline]

Wilson,S.A., Wachira,S.J., Drew,R.E., Jones,D. and Pearl,L.H. (1993) EMBO J., 12, 3637–3642.[Web of Science][Medline]

Wilson,S.A., Wachira,S.J.M., Norman,R.A., Pearl,L.H. and Drew,R.E. (1996) EMBO J., 15, 5907–5916.[Web of Science][Medline]

Received May 10, 1999; revised November 10, 1999; accepted November 16, 1999.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
A.-S. Bessis, P. Rondard, F. Gaven, I. Brabet, N. Triballeau, L. Prezeau, F. Acher, and J.-P. Pin
Closure of the Venus flytrap module of mGlu8 receptor and the activation process: Insights from mutations converting antagonists into agonists
PNAS, August 20, 2002; 99(17): 11097 - 11102.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Galvez, L. Prezeau, G. Milioti, M. Franek, C. Joly, W. Froestl, B. Bettler, H.-O. Bertrand, J. Blahos, and J.-P. Pin
Mapping the Agonist-binding Site of GABAB Type 1 Subunit Sheds Light on the Activation Process of GABAB Receptors
J. Biol. Chem., December 22, 2000; 275(52): 41166 - 41174.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by O'Hara, B. P.
Right arrow Articles by Pearl, L. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by O'Hara, B. P.
Right arrow Articles by Pearl, L. H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?