Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (23)
Right arrowRequest Permissions
Citing Articles
Right arrowScopus Links
Google Scholar
Right arrow Articles by Lanio, T.
Right arrow Articles by Pingoud, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lanio, T.
Right arrow Articles by Pingoud, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Protein Engineering, Vol. 13, No. 4, 275-281, April 2000
© 2000 Oxford University Press

On the possibilities and limitations of rational protein design to expand the specificity of restriction enzymes: a case study employing EcoRV as the target

Thomas Lanio, Albert Jeltsch and Alfred Pingoud1

Institut für Biochemie, FB 08, Justus-Liebig-Universität, Heinrich-Buff-Ring 58, D-35392 Giessen, Germany.


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The restriction endonuclease EcoRV has been characterized in structural and functional terms in great detail. Based on this detailed information we employed a structure-guided approach to engineer variants of EcoRV that should be able to discriminate between differently flanked EcoRV recognition sites. In crystal structures of EcoRV complexed with d(CGGGATATCCC)2 and d(AAAGATATCTT)2, Lys104 and Ala181 closely approach the two base pairs flanking the GATATC recognition site and thus were proposed to be a reasonable starting point for the rational extension of site specificity in EcoRV [Horton,N.C. and Perona,J.J. (1998) J. Biol. Chem., 273, 21721–21729]. To test this proposal, several single (K104R, A181E, A181K) and double mutants of EcoRV (K104R/A181E, K104R/A181K) were generated. A detailed characterization of all variants examined shows that only the substitution of Ala181 by Glu leads to a considerably altered selectivity with both oligodeoxynucleotide and macromolecular DNA substrates, but not the predicted one, as these variants prefer cleavage of a TA flanked site over all other sites, under all conditions tested. The substitution of Lys104 by Arg, in contrast, which appeared to be very promising on the basis of the crystallographic analysis, does not lead to variants which differ very much from the EcoRV wild-type enzyme with respect to the flanking sequence preferences. The K104R/A181E and K104R/A181K double mutants show nearly the same preferences as the A181E and A181K single mutants. We conclude that even for the very well characterized restriction enzyme EcoRV, properties that determine specificity and selectivity are difficult to model on the basis of the available structural information.

Keywords: DNA recognition/EcoRV/protein engineering/rational protein design/site-directed mutagenesis/specificity


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Type II restriction endonucleases belong to the most important enzymes in molecular biology and molecular medicine. These homodimeric enzymes recognize and cleave DNA in short palindromic sequences comprising 4–8 base pairs with very high accuracy. Independent of the sequence context, the canonical site is cleaved several orders of magnitude faster than all other sites, including sites which differ at only one base pair from the canonical recognition site (reviews: Roberts and Halford, 1993; Pingoud and Jeltsch, 1997). Today, more than 2000 restriction endonucleases with ~200 different specificities are known, among them only a few with longer than a 6 base pair (bp) recognition site (Roberts and Macelis, 1999Go). The biological function of restriction enzymes is to cleave phage DNA invading a bacterium and thereby to protect the bacterial cell from infection. As palindromic sites comprising 8 bp statistically occur only every 65536 bp and phage genomes usually are short (104–105 bp), a restriction enzyme with an 8 or even 10 bp recognition site could not fulfil this role efficiently. Restriction endonucleases having a recognition sequence of >=8 bp, therefore, in general do not provide a selective advantage for the bacterial host and in consequence to date only 3.5% of all possible 8 bp cutters are available from natural sources (Roberts and Macelis, 1999Go) and most likely not many more will be found by screening bacterial strains. On the other hand, rare cutting enzymes could be particularly useful for the manipulation of large DNA fragments, e.g. human genes, which are often larger than 5 kb. A possible way to overcome the shortage of naturally occurring `rare cutters' is the engineering of existing restriction enzymes to recognize a more extended sequence than their natural recognition sequence.

The restriction endonuclease EcoRV (recognition site: GATATC) is one of the best characterized type II restriction enzymes and, therefore, within this class of enzymes is an ideal target for a rational protein design. Besides detailed biochemical analysis (review: Pingoud and Jeltsch, 1997), a wealth of structural information is available for this enzyme including the structure of the free enzyme (Winkler et al., 1993Go), a structure of the enzyme bound non-specifically to DNA (Winkler et al., 1993Go), different structures of specific EcoRV substrate (Kostrewa and Winkler, 1995Go; Perona and Martin, 1997Go; Horton and Perona, 1998aGo) and EcoRV product complexes (Kostrewa and Winkler, 1995Go; Horton and Perona, 1998bGo) as well as structures of EcoRV variants bound to specific substrates (Horton and Perona, 1998bGo) and of EcoRV bound to modified substrates (Martin et al., 1999Go). All these structural studies as well as biochemical studies using chemically modified substrates (Thorogood et al., 1996Go) and EcoRV variants (Wenz et al., 1996Go) show that EcoRV in addition to contacts with its recognition sequence interacts also with base pairs upstream and downstream of its recognition site. These additional contacts may explain the site preferences of EcoRV observed under certain conditions (Taylor and Halford, 1992Go; Lanio et al., 1998Go; Schöttler et al., 1998Go). Hence it seems to be possible to create new protein–DNA contacts to the base pairs flanking the GATATC recognition site which could enable the nuclease to recognize an extended site comprising up to 10 bp. Crystallographic analyses of EcoRV with short oligodeoxynucleotides differing in the base pairs adjacent to the recognition site, suggest a promising starting point for a rational protein engineering project. Two amino acid residues, Lys104 and Ala181, form water-mediated contacts to the neighboring base pairs upstream (Ala181) and downstream (Lys104) of the recognition site (Horton and Perona, 1998aGo). In the complex with d(CGGGATATCCC)2, Lys104 interacts through water molecules with the exocyclic N-4 amino group of the flanking cytosines on the 3'-side of the recognition sequence. These contacts are not seen with the d(AAAGATATCTT)2 substrate, presumably because they are prevented by steric exclusion of water molecules due to the presence of the 5-methyl group of thymine (Horton and Perona, 1998aGo). These water-mediated contacts to a base next to the recognition sequence could in principle be replaced by a specific hydrogen bond, if the lysine is replaced by the slightly larger arginine. Changing a water-mediated contact to a specific hydrogen bond should enable the resulting variant to discriminate against substrates which could not provide that additional contact. In the case of Lys104 a change to arginine has been suggested in order to create a direct contact on the 3'-side with the O-4 of a flanking thymine or the O-6 of a flanking guanine (Horton and Perona, 1998aGo). On the 5'-side, the side chain of Ala181 points towards the base pair flanking the recognition site. This residue has been investigated by site-directed mutagenesis recently and some of the variants generated were shown to display an extended specificity towards differently flanked sites, such as A181E, A181F, A181I and A181K (Schöttler et al., 1998Go). Therefore, combination of variants at positions 104 and 181 appeared to be very promising for the design of an 8 or 10 bp cutter, as discussed by Horton and Perona (1998a) and illustrated in Figure 1Go. As shown in Table IGo, combinations of different substitutions at positions 104 and 181 should result in several EcoRV variants with an extended specificity towards differently flanked substrates (Horton and Perona, 1998aGo). For example, combination of the Lys104 to Arg with the Ala181 to Glu substitution should result in a double mutant with a preference for CGATATCG. We have produced and characterized all the variants given in Table IGo. While some of the variants show preferences that are different from the wild-type enzyme, none of them displays the postulated preferences. Furthermore, the combination of amino acid substitutions does not lead to synergistic effects.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 1. . Models of possible interactions of EcoRV mutants with flanking DNA. These models were constructed by Horton and Perona (1998a) using subunit II of the dGC cocrystal structure as the starting point. Mutations in the protein were introduced and torsion angles varied systematically. Optimal least-squares superpositions of alternative base pairs were carried out using atoms in the glycosidic bonds and the glycosidic torsion angles were adjusted to match those in the dGC structure. (A) The K104R/A181E mutant interacting with flanking CG base pair. Here a 3'-G (GUA10) replaces the 3'-C visualized in the dGC structure. CYT9 is the 3'-base of the target site GATATC. Dotted black lines indicate modeled hydrogen bonds or nearest approach distances with the distance between the two electronegative atoms indicated in Å. The specific recognition of the outer base pair of the target site by Gly182 and Gly184 is also shown. (B) The K104R/A181K mutant interacting with a flanking TA base pair, where a 3'-T (THY10) replaces the 3'-C in the dGC structure. (C) The K104R/A181K mutant interacting with a flanking GC base pair. Here the flanking pair is as visualized in the dGC structure with a 3'-C nucleotide adjacent to the target site (reproduced with permission of the authors).

 

View this table:
[in this window]
[in a new window]
 
Table I. . Predicted preferences of single and double mutants of EcoRV with amino acid substitutions at positions 104 and 181 according to Horton and Perona (1998a)
 

    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Site-directed mutagenesis of the ecoRV gene, overexpression and purification of mutant proteins

Mutagenesis was performed using a PCR megaprimer technique as described (Roth et al., 1998Go). Together with the mutation, one of the PCR primers introduces a characteristic restriction site into the gene to allow for a fast screening of the presence of the mutation. The mutant genes were cleaved with NsiI and SalI and cloned into the plasmid pHis (Wenz et al., 1994Go). Both strands of the complete ecoRV gene of all clones were sequenced using an ABI 373 sequencer (Applied Biosystems). Expression of the EcoRV mutants was induced in 3 ml of LB medium at a cell density of 1 OD600 by addition of IPTG to a final concentration of 1 mM. The His6-tagged mutants were purified using Ni-NTA magnetic agarose beads (5% suspension) (Qiagen, Hilden, Germany). Harvested cells were resuspended in 600 µl of binding buffer [30 mM potassium phosphate, pH 7.5, 0.1 mM DTE, 0.01% (w/v) lubrol, 500 mM NaCl, 20 mM imidazole] and after sonication (2x30 s on ice), cell debris was removed by centrifugation and 200 µl of the supernatant were transferred into the wells of a 96-well microplate. A volume of 20 µl of a suspension of agarose beads was added to the supernatant and vortex mixed at 600 r.p.m. for 30 min at 4°C. The microplate was then placed on a 96-well magnet (Qiagen) for 1 min and the supernatant was removed with a pipet. The beads were washed twice with binding buffer. To elute the His6-tagged protein, 50 µl of elution buffer [30 mM potassium phosphate, pH 7.5, 0.1 mM DTE, 0.01% (w/v) lubrol, 500 mM NaCl, 200 mM imidazole] were added and the eluates were collected after placing the microplate on the magnet for 1 min. Protein preparations obtained contained >90% pure EcoRV and were free of contaminating nuclease activity. Typical yields were 5 µg in 50 µl (corresponding to a 1–2 µM EcoRV solution) starting from a 3 ml of culture. For detailed characterization, larger amounts of certain variants were prepared as described (Wenz et al., 1994Go).

DNA-cleavage assays

We employed the following 20mer oligodeoxynucleotides as substrates for EcoRV: 20AT, d(GATCGAAGATATCTTCGATC)2; 20CG, d(GATCGACGATATCGTCGATC)2; 20GC, d(GATCGAGGATATCCTCGATC)2; and 20TA, d(GATCGA-TGATATCATCGATC)2 (the EcoRV recognition sequence is highlighted in bold face and the different nucleotides flanking the recognition site are underlined). All oligodeoxynucleotides were purchased from Interactiva (Ulm, Germany). After purification by denaturing polyacrylamide gel electrophoresis, the oligodeoxynucleotides were labeled at the 5'-end using T4 polynucleotide kinase. If not stated otherwise, all cleavage reactions were carried out in 20 mM Tris–HCl, pH 7.5, 50 mM NaCl, 10 mM MgCl2, 100 µg/ml BSA (bovine serum albumin) at ambient temperature.

Reaction mixtures for determination of Km and kcat values contained 0.01–10 µM of radioactively labeled oligodeoxynucleotide. Reactions were started by addition of enzyme at a concentration which was at least 10-fold lower than the substrate concentration. After defined time intervals, 2 µl aliquots were withdrawn from the reaction mixture, spotted on to a DEAE-cellulose plate (Macherey–Nagel, Düren, Germany) and subjected to homochromatography (Brownlee and Sanger, 1969Go). For the quantification of substrate and product concentrations, an Instant Imager was used (Canberra Packard). Initial velocities (v0) were calculated from the linear part of individual reaction progress curves obtained at five or more different substrate concentrations. The Km and kcat values were calculated from v0 vs c diagrams by a best fit to the Michaelis–Menten equation. Errors were calculated to be within 10–30%.

The oligodeoxynucleotides used as substrates for EcoRV (see above) were cloned into the EcoRI site of pUC8 as described (Schöttler et al., 1998Go). For the DNA cleavage kinetics, 15 nM plasmid was digested with appropriate dilutions of EcoRV variants (1.5 and 15 nM) at 37°C in the standard cleavage buffer containing 1 or 10 mM MgCl2. After defined time intervals, 15 µl aliquots were withdrawn, the reaction stopped with 5 µl 5-fold gel loading buffer containing 250 mM EDTA and analyzed by agarose gel electrophoresis. After ethidium bromide staining, quantification of substrate and product concentrations was carried out by integration of the intensities of the respective bands on a digitized image. Initial rates (k) were obtained from the linear part of the reaction progress curves.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Mutagenesis and expression of the EcoRV variants

EcoRV mutants at positions 104 and 181 were generated by PCR mutagenesis. All mutants and the wild-type enzyme carry an N-terminal His6 tag which allows purification by affinity chromatography using Ni-NTA agarose beads. A volume of 3 ml of Escherichia coli cell culture on average yielded 5 µg of a recombinant protein preparation of >90% purity as judged by SDS–PAGE.

Cleavage of oligodeoxynucleotides

To measure the preferences of wild-type EcoRV and the EcoRV variants for flanking sequences, cleavage experiments were performed with four self-complementary 20mer oligodeoxynucleotides which differ from each other only in the neighboring positions 5' and 3' to the GATATC recognition site. The results of the cleavage experiments are summarized in Table IIGo. As described previously (Schöttler et al., 1998Go), the wild-type enzyme cleaves the oligodeoxynucleotides with a CG, GC and TA flanked recognition site with almost the same rate (kcat/KM) and the oligodeoxynucleotide with the AT flanked recognition site more slowly. Unlike the wild-type enzyme, the K104R variant cleaves the AT flanked site with a high activity and slightly disfavors the GC flanked site (Figure 2Go). It had been predicted by Horton and Perona (1998a) that this variant forms a contact to the O4 of a thymine or to the O6 of a guanine flanking the recognition sequence at the 3'-side. However, whereas CG-flanked sites are preferred over AT-flanked sites by the wild-type enzyme, this preference is lost for the K104R variant, indicating that K104R presumably does not form the postulated contact to the O6 of guanine or, if it does, that this contact is not accompanied by a preference for AT- and CG-flanked EcoRV sites. A different result had been obtained for the A181K and A181E variants (Schöttler et al., 1998Go): the A181K variant prefers sites flanked by a purine at the 5'-side, most probably due to a hydrogen bond between the amino group of the lysine side chain and N7 of purine and cleaves the CG- and TA-flanked sites more than one order of magnitude more slowly than the GC-flanked site (Table IIGo, Figure 2Go). In contrast, the A181E variant strongly prefers sites with a pyrimidine at the 5'-side and cleaves the TA-flanked site at least 10 times faster than sites with a purine at the 5'-side, albeit displaying a very low catalytic activity compared with the wild-type enzyme (Table IIGo, Figure 2Go). The decrease in catalytic activity can be explained by the additional charge of a deprotonated glutamic acid residue within the protein–DNA interface, which is likely to disturb substrate binding (increase in KM) but not necessarily the catalytic step (unaltered kcat). The residual activity and the high specificity of the variant can be explained by a hydrogen bond between the partially protonated carboxylate of Glu181 and O4 of thymine (Schöttler et al., 1998Go).


View this table:
[in this window]
[in a new window]
 
Table II.. Kinetic parameters, Km and kcat, for the cleavage of four differently flanked oligodeoxynucleotides by wild-type EcoRV and EcoRV variants
 


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 2. . kcat/Km values (M–1 s–1x106) for the cleavage of oligodeoxynucleotides containing differently flanked EcoRV sites by EcoRV variants carrying substitutions at positions 104 and 181. Note the different scales in (A) and (B).

 
According to the suggestion of Horton and Perona (1998a), the double mutant K104R/A181E should strongly prefer the CG-flanked substrate, whereas K104R/A181K should cleave an AT-flanked site much faster than all other sites (Table IGo, Figure 1Go). As shown in Table IIGo and Figure 2Go, the double mutants A181K/K104R and A181E/K104R show nearly the same kinetic parameters as the single mutants A181K and A181E. Hence a combination of the substitution Lys104 -> Arg with the substitution Ala181 -> Glu and Ala181 -> Lys, respectively, leads only to minor alterations in the kinetic parameters of the EcoRV variants.

Cleavage of macromolecular substrates

To analyze whether macromolecular substrates are cleaved with the same preferences as oligodeoxynucleotide substrates, steady-state and pre-steady-state cleavage experiments with plasmids containing the four different 20mer oligodeoxynucleotide sequences were performed (Table IIIGo, Figure 3Go). The wild-type enzyme, the K104R and the A181K variants display hardly any selectivity towards differently flanked EcoRV sites, under both steady-state and single-turnover conditions. Only at low MgCl2 concentrations does A181K display the same preference with plasmid substrates as with oligodeoxynucleotide substrates. The A181K variant, however, is considerably less active than the wild-type enzyme with macromolecular substrates. The enzymatic activity of the A181K variant is restored to wild-type level by the additional substitution of Lys104 by Arg whereas the selectivity observed at low MgCl2 concentration is lost. The resulting double mutant has wild-type activity under steady-state conditions and displays, like the wild-type enzyme and the single mutant, little preference regarding the 5'- and 3'-flanking regions. Under-single turnover conditions with 10 mM MgCl2, the K104R single mutant is less active than the wild-type enzyme, but, like the wild-type enzyme, has almost no preferences for flanking regions. In contrast, the activity and selectivity of the A181E mutant are higher with macromolecular substrates than with oligodeoxynucleotide substrates. The low activity of A181E with oligodeoxynucleotides is mainly due to a high Km. Presumably, this deficiency is not observed with plasmids, because macromolecular DNA has a higher surface density of negative charge than oligodeoxynucleotides (Zhang et al., 1996Go), resulting in an improved substrate binding. The additional substitution of Lys104 by arginine in the A181E context does not have a major influence regarding the cleavage of plasmid substrates.


View this table:
[in this window]
[in a new window]
 
Table III.. Rate constants, k (min–1), for the cleavage of plasmids with four differently flanked EcoRV recognition sites by EcoRV and EcoRV variants
 


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 3. . Initial rates (min–1) for the cleavage of plasmid substrates containing differently flanked EcoRV recognition sites by EcoRV variants carrying substitutions at positions 104 and 181.

 
The strong increase of the wild-type activity under single-turnover conditions compared with steady-state conditions reveals product dissociation to be the rate-limiting step for the cleavage reaction. In contrast, the rate of DNA cleavage by all variants is not increased under single-turnover conditions, indicating that for them the catalytic step or a step preceding it is rate limiting.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
In spite of the availability of detailed structural data, rational protein design with type II restriction endonucleases as targets turns out to be very difficult. The recognition process that leads to the activation of the catalytic centers of restriction enzymes is highly redundant and involves not only hydrogen bonds and van der Waals contacts to the bases of the recognition site (direct readout), but also a multitude of interactions, some of them water mediated, between the protein and the sugar–phosphate backbone of the DNA (indirect readout) (Rosenberg, 1991Go; Kostrewa and Winkler, 1995Go; Perona and Martin, 1997Go; Wah et al., 1997Go). This may be the reason why all attempts to change the specificity of restriction enzymes have failed so far (Jeltsch et al., 1996Go), with the notable exception of specificity changes directed towards chemically modified substrates (Lanio et al., 1996Go). In contrast, designing new contacts of the protein to the DNA outside the original recognition sequence appears to be a more manageable task, in particular in the case of EcoRV, which is one of the best characterized enzymes acting on DNA. Structural analyses of wild-type enzyme complexed with differently flanked substrates reveals that two amino acid side chains closely approach the bases flanking the recognition site (Winkler et al., 1993Go; Horton and Perona, 1998aGo). Based on these crystallographic data, a proposal for the design of EcoRV variants with an enhanced selectivity had been put forward by Horton and Perona (1998a). They had suggested generating single and double EcoRV mutants with amino acid substitutions at positions Lys104 and Ala181. The resulting variants should be able to distinguish between differently flanked GATATC sites. All these variants have been generated by us and thoroughly characterized. However, none of them has the preferences expected by Horton and Perona. A181E predicted to prefer 5' C-flanked sites in fact best cleaves 5' T-flanked sites. A181K seems to prefer a purine 5' adjacent to the recognition site as proposed, but this preference is observed only under certain cleavage conditions. The Lys104 to arginine exchange has almost no influence on the DNA cleavage of EcoRV. Combining arginine at position 104 with lysine and glutamic acid at position 181 does not improve the specificity of the single mutants but leads only to minor differences regarding site preferences. Taken together, the results of our cleavage experiments show that the predicted contacts do not exist or at least do not have the expected effect, i.e. do not influence the transition state.

We conclude that on the basis of structures of enzyme–substrate complexes, it seems to be very difficult to predict amino acid exchanges that would lead to an extended specificity. One reason for the problems encountered could be that in the co-crystals obtained so far, EcoRV cannot be activated by Mg2+ ions soaked into the crystals. Thus, structures of wild-type EcoRV or certain variants complexed to their specific substrate do not necessarily represent the ground state of the enzymatic reaction. If they did, it could be that the designed mutations cannot provide much additional discrimination, possibly because one or two additional hydrogen bonding contacts using long side chains are not sufficient. More important, however, no structural information on the transition state of EcoRV is available, such that predictions regarding the effects of single amino acid substitutions are unreliable. We believe that generating EcoRV variants with extended specificity by protein engineering requires the design of cooperative conformational changes that couple recognition to catalysis. The amino acid substitutions required to facilitate such conformational changes can hardly be predicted. At present, our lack of understanding of the key steps, together with a thorough evaluation of their entropic and enthalpic contributions, in the mechanism of action of EcoRV which lead to the activation of the catalytic centers prevents a successful rational protein design for target site expansion of EcoRV and requires random mutagenesis/selection approaches. In fact, directed evolution approaches have already been demonstrated to be successful for the generation of EcoRV variants with extended specificity (Lanio et al., 1998Go)


    Notes
 
1 To whom correspondence should be addressed E-mail: alfred.m.pingoud{at}chemie.bio.uni-giessen.de Back


    Acknowledgments
 
We thank Dr J.Perona for communicating results prior to publication. The financial support of the Deutsche Forschungsgemeinschaft, the Bundesministerium für Bildung, Wissenschaft, Forschung und Technologie and the European Community is gratefully acknowledged.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Brownlee,G.G. and Sanger,F. (1969) Eur J Biochem., 11, 395–399.[Web of Science][Medline]

Horton,N.C. and Perona,J.J. (1998a) J. Biol. Chem., 273, 21721–21729.[Abstract/Free Full Text]

Horton,N.C. and Perona,J.J. (1998b) J. Mol. Biol., 277, 779–787.[Web of Science][Medline]

Jeltsch,A., Wenz,C., Wende,W., Selent,U. and Pingoud,A. (1996) Trends Biotechnol., 14, 235–238.[Web of Science][Medline]

Kostrewa,D. and Winkler,F.K. (1995) Biochemistry, 34, 683–696.[Medline]

Lanio,T., Selent,U., Wenz,C., Wende,W., Schulz,A., Adiraj,M., Katti,S.B. and Pingoud,A. (1996) Protein Engng, 9, 1005–1010.[Abstract/Free Full Text]

Lanio,T., Jeltsch,A. and Pingoud,A. (1998) J. Mol. Biol., 283, 59–69.[Web of Science][Medline]

Martin,A.M., Horton,N.C., Lusetti,S., Reich,N.O. and Perona,J.J. (1999) Biochemistry, 38, 8430–8439.[Medline]

Newman,M., Strzelecka,T., Dorner,L.F., Schildkraut,I. and Aggarwal,A.K. (1995) Science, 269, 656–663.[Abstract/Free Full Text]

Newman,M., Lunnen,K., Wilson,G., Greci,J., Schildkraut,I. and Phillips,S.E. (1998) EMBO J., 17, 5466–5476.[Web of Science][Medline]

Perona,J.J. and Martin,A.M. (1997) J. Mol. Biol., 273, 207–225.[Web of Science][Medline]

Pingoud,A. and Jeltsch,A. (1997) Eur. J. Biochem., 246, 1–22.[Web of Science][Medline]

Roberts,R.J. and Halford,S.E. (1993) Nucleases. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 35–88.

Roberts,R.J. and Macelis,D. (1999) Nucleic Acids Res., 27, 312–313.[Abstract/Free Full Text]

Rosenberg,J.M. (1991) Curr. Opin. Struct. Biol., 1, 104–113.

Roth,M., Helm-Kruse,S., Friedrich,T. and Jeltsch,A. (1998) J. Biol. Chem., 273, 17333–17342.[Abstract/Free Full Text]

Schöttler,S., Wenz,C., Lanio,T., Jeltsch,A. and Pingoud,A. (1998) Eur. J. Biochem., 258, 184–191.[Web of Science][Medline]

Taylor,J.D. and Halford,S.E. (1992) Biochemistry, 31, 90–97.[Medline]

Thorogood,H., Grasby,J.A. and Connolly,B.A. (1996) J. Biol. Chem., 271, 8855–8862.[Abstract/Free Full Text]

Wah,D.A., Hirsch,J.A., Dorner,L.F., Schildkraut,I. and Aggarwal,A.K. (1997) Nature, 388, 97–100.[Medline]

Wenz,C., Selent,U., Wende,W., Jeltsch,A., Wolfes,H. and Pingoud,A. (1994) Biochim. Biophys. Acta, 1219, 73–80.[Medline]

Wenz,C., Jeltsch,A. and Pingoud,A. (1996) J. Biol. Chem., 271, 5565–5573.[Abstract/Free Full Text]

Winkler,F.K., Banner,D.W., Oefner,C., Tsernoglou,D., Brown,R.S., Heathman,S.P., Bryan,R.K., Martin,P.D., Petratos,K. and Wilson,K.S. (1993) EMBO J., 12, 1781–1795.[Web of Science][Medline]

Zhang,W., Bond,J.P., Anderson,C.F., Lohman,T.M. and Record,M.T., Jr (1996) Proc. Natl Acad. Sci. USA, 93, 2511–2516.[Abstract/Free Full Text]

Received November 1, 1999; revised January 18, 2000; accepted February 8, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
R. D. Morgan and Y. A. Luyten
Rational engineering of type II restriction endonuclease DNA binding and cleavage specificity
Nucleic Acids Res., August 1, 2009; 37(15): 5222 - 5233.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Zeevi, A. Tovkach, and T. Tzfira
Increasing cloning possibilities using artificial zinc finger nucleases
PNAS, September 2, 2008; 105(35): 12785 - 12790.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Saravanan, K. Vasu, and V. Nagaraja
Evolution of sequence specificity in a restriction endonuclease by a point mutation
PNAS, July 29, 2008; 105(30): 10344 - 10347.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Smith, S. Grizot, S. Arnould, A. Duclert, J.-C. Epinat, P. Chames, J. Prieto, P. Redondo, F. J. Blanco, J. Bravo, et al.
A combinatorial approach to create artificial homing endonucleases cleaving chosen sequences
Nucleic Acids Res., December 2, 2006; 34(22): e149 - e149.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. C. Samuelson, R. D. Morgan, J. S. Benner, T. E. Claus, S. L. Packard, and S.-y. Xu
Engineering a rare-cutting restriction enzyme: genetic screening and selection of NotI variants
Nucleic Acids Res., February 2, 2006; 34(3): 796 - 805.
[Abstract] [Full Text] [PDF]


Home page
Protein Eng Des SelHome page
A. A. Chmiel, M. Radlinska, S. D. Pawlak, D. Krowarsch, J. M. Bujnicki, and K. J. Skowronek
A theoretical model of restriction endonuclease NlaIV in complex with DNA, predicted by fold recognition and validated by site-directed mutagenesis and circular dichroism spectroscopy
Protein Eng. Des. Sel., April 1, 2005; 18(4): 181 - 189.
[Abstract] [Full Text] [PDF]


Home page
Protein Eng Des SelHome page
H. M. Cohen, D. S. Tawfik, and A. D. Griffiths
Altering the sequence specificity of HaeIII methyltransferase by directed evolution using in vitro compartmentalization
Protein Eng. Des. Sel., January 1, 2004; 17(1): 3 - 11.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Pingoud and A. Jeltsch
Structure and function of type II restriction endonucleases
Nucleic Acids Res., September 15, 2001; 29(18): 3705 - 3727.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (23)
Right arrowRequest Permissions
Right arrowScopus Links
Google Scholar
Right arrow Articles by Lanio, T.
Right arrow Articles by Pingoud, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lanio, T.
Right arrow Articles by Pingoud, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?