Protein Engineering, Vol. 13, No. 4, 291-298,
April 2000
© 2000 Oxford University Press
Mutation of recombinant catalytic subunit
of the protein kinase CK2 that affects catalytic efficiency and specificity
Laboratoire de Chimie Biologique INRA INA-PG and 1 Laboratoire de Génétique des Microorganismes INRA INA-PG, Centre de Biotechnologie Agro-Industrielle, F-78850 Thiverval-Grignon, France and 2 Institut für Biochemie, Universität zu Köln, Zülpicher Strasse 47, D-50374 Cologne, Germany
| Abstract |
|---|
|
|
|---|
In order to understand better the structural and functional relations between protein kinase CK2 catalytic subunit, the triphosphate moiety of ATP, the catalytic metal and the peptidic substrate, we built a structural model of Yarrowia lipolytica protein kinase CK2 catalytic subunit using the recently solved three-dimensional structure of the maize enzyme and the structure of cAMP-dependent protein kinase peptidic inhibitor (1CDK) as templates. The overall structure of the catalytic subunit is close to the structure solved by Niefind et al. It comprises two lobes, which move relative to each other. The peptide used as substrate is tightly bound to the enzyme, at specific locations. Molecular dynamic calculations in combination with the study of the structural model led us to identify amino acid residues close to the triphosphate moiety of ATP and a residue sufficiently far from the peptide that could be mutated so as to modify the specificity of the enzyme. Site-directed mutagenesis was used to replace by charged residues both glycine-48, a residue located within the glycine-rich loop, involved in binding of ATP phosphate moiety, and glycine-177, a residue close to the active site. Kinetic properties of purified wild-type and mutated subunits were studied with respect to ATP, MgCl2 and protein kinase CK2 specific peptide substrates. The catalytic efficiency of the G48D mutant increased by factors of 4 for ATP and 17.5 for the RRRADDSDDDDD peptide. The mutant G48K had a low activity with ATP and no detectable activity with peptide substrates and was also inhibited by magnesium. An increased velocity of ADP release by G48D and the building of an electrostatic barrier between ATP and the peptidic substrate in G48K could explain these results. The kinetic properties of the mutant G177K with ATP were not affected, but the catalytic efficiency for the RRRADDSDDDDD substrate increased sixfold. Lysine 177 could interact with the lysine-rich cluster involved in the specificity of protein kinase CK2 towards acidic substrate, thereby increasing its activity.
Keywords: casein kinase CKII/modeling/mutants/phosphorylation/protein kinase CK2
| Introduction |
|---|
|
|
|---|
Protein kinase CK2, formerly called casein kinase II, is a ubiquitous second messenger independent protein kinase found in all eukaryotic organisms examined (Tuazon and Traugh, 1991
, active per se, and in most cases, of regulatory subunits ß, whose role is not completely understood (Pinna and Meggio, 1997
have been already identified by site-directed mutagenesis, especially the typical tryptophan of the DWG triplet (Jakobi and Traugh, 1992
The bacterially expressed catalytic subunit from Zea mays has recently been crystallized (Guerra et al., 1998
) and its three-dimensional structure has been solved (Niefind et al., 1998
, 1999
). The catalytic subunit of protein kinase CK2 from the yeast Yarrowia lipolytica has recently been cloned (Benetti et al., 1997
) and expressed in a bacterial system (Benetti et al., 1998
). This catalytic subunit exhibits the basic properties of protein kinase CK2. Chothia and Lesk (1986) showed that the greater the amino acid sequence homology, the closer are the scaffold structures. Therefore, from the three-dimensional structure of rmCK2
(recombinant catalytic subunit of CK2 from Z.mays), it has been possible to build up a structural model of ryCK2
(recombinant catalytic subunit of CK2 from Y.lipolytica), including the peptide substrate, which should be close to the real structure. The combination of a molecular modeling and molecular dynamic study allowed us to identify target residues involved in the phosphate binding and also residues that could modify the specificity of the enzyme. We have used the model structure to investigate the role of glycine residues found in the vicinity of the active site. One belongs to the phosphate anchor, the second one not having been identified yet as having a particular role in the enzyme activity. In order to give new catalytic functions to ryCK2
, we have replaced by site-directed mutagenesis amino acid residues of interest. We describe in this paper the properties of ryCK2
mutated proteins G48D (glycine-48
aspartic acid mutated protein), G48K (glycine-48
lysine mutated protein) and G177K (glycine-177
lysine mutated protein).
| Materials and methods |
|---|
|
|
|---|
Enzymes
Taq polymerase was obtained from Appligene, Pfu polymerase from Stratagene, T4 DNA Ligase from Promega, T7 sequenase version 2.0 kit from USB and other restriction enzymes from Promega.
Chemicals
All chemicals were of the best available quality. 32P- and 35S-labeled nucleotides were purchased from Amersham. Isopropylthiol-ß-D-galactoside (IPTG) was obtained from Appligene.
Strains and vectors
Escherichia coli competent cells JM109 were obtained from Promega and E.coli strain BL21 (DE3) pLys from Promega. Expression plasmids were constructed by inserting the sequence coding for CK2
subunit from the yeast Y.lipolytica into the pT7-7 vector (Studier and Rosenberg, 1990
) as already described (Benetti et al., 1997
).
Oligonucleotides
Oligonucleotides used to construct the mutants were synthesized by Oligo Express and Science Tech (France).
Protein modeling and design
Identity between rmCK2
and ryCK2
was deduced from amino acid sequence alignments performed using the Bestfit option of the GCG software (Wisconsin package, version 9.1).
The coordinates of cAMPprotein kinase inhibitor (1CDK) (cAPK) were taken from the Brookhaven Protein Data Bank. Those of the catalytic subunit rmCK2
were from Niefind et al. (1999). Numbering of amino acids residues of the protein kinase CK2 was the same as the numbering of the human protein kinase CK2 catalytic subunit as in Niefind et al. (1998). The amino acid residues of the protein kinase CK2 specific peptide substrate RRRADDSDDD (Sarno et al., 1995
) used in the modeling study were numbered relative to the phosphorylatable residue.
The program BRAGI, version 5.0, for Silicon Graphics Workstations (Schomburg and Reichelt, 1988
) was used to perform loop prediction in the structure of rmCK2
in the case of lack of amino acid homology between the two sequences. The choice of the loop depended on the r.m.s.d. [root mean square deviation (Å)] of the new structure with respect to the rmCK2
. The validity of the results was checked using Ramachandran plots.
For homology modeling, all non-conserved side chains from rmCK2
were substituted according the sequence alignment by side chains from ryCK2
, using the program Side Chain Placement with a Rotamer Library (SCWRL) (Dunbrack and Cohen, 1997
). The same procedure was used to replace the 10 C-terminal side chains of cAPK truncated inhibitor by side chains from CK2
-specific peptidic substrate RRRADDSDDD (Sarno et al., 1995
). Force field calculations and molecular dynamics were performed with the program AMBER, version 4.1 (Weiner and Kollman, 1981
). For the energy minimization, the united atom model was used by performing at least 500 cycles in 500 steps. The results of the molecular dynamics were analyzed using the program CARNAL in MD-analyzer. The simulation for molecular dynamic studies was performed at 300 K. The total simulation times were 50 and 150 ps. The flexibility of the molecule structure was estimated from an analysis of the MD simulation. All the results were analyzed with the BRAGI software and the different models were compared.
Mutagenesis and cloning
Site-directed mutations were introduced by using the megaprimer polymerase chain reaction (PCR). Mutations were introduced in the wild-type ryCK2
using the CGAGTATTTGTCTCGGCCGATTTTC primer for G48D mutant, the GAAAATCGGCCGAAAGAAATACTCG and the CGAGTATTTCTTTCGGCCGATTTTC primers for G48K and the CGCCTCATTGACTGGAAGTTGGCCGAGTTA primer for the G177K mutant.
To build the G48D mutant, the plasmid pT7-7 containing ryCK2
gene was digested by NdeI and was submitted to 20 PCR cycles using the CGAGTATTTGTCTCGGCCGATTTTC (AA1) and CCCTCTAGAAATAATTTTGTTTAAC (T1) oligonucleotides (PCR1 reaction). The plasmid pT7-7 containing ryCK2
gene was digested by SalI and was submitted to 20 PCR cycles using AGCGCGCATATGGACGTGGATTCCGACATCGCCGC (B1) and GGCGCC- GTAGGACCACAGGTCCAA (S2) oligonucleotides (PCR2 reaction). A Pfu and Taq polymerase mixture was used in these reactions in order to avoid the occurrence of additional mutations in the coding sequence. Cycling conditions were as follows: first denaturation was for 5 min at 95°C, followed by addition of polymerases at 72°C and 20 polymerization cycles consisting of a 30 s 95°C denaturation step, followed by a 30s 55°C hybridization step, followed by a 1min 72°C annealing step.
Products of PCR1 and PCR2 reactions were gel purified using Promega Wizard PCR Prep kit, mixed together and submitted to elongation. Reaction conditions were as follows: a first 5min 95°C denaturation, followed by addition of polymerases at 72°C and by five cycles consisting of 30 s 95°C denaturation, 40 s 50°C hybridization and 45 s 72°C annealing. Finally, the mutated DNA fragment produced in the first steps was amplified over 20 cycles as in the first PCR with T1 and S2 oligonucleotides. This final product was gel purified with the Wizard PCR Preps DNA purification kit (Promega), digested by both SalI and NdeI. The DNA fragment was ligated to NdeI/SalI pT7-7 vector DNA which contained ryCK2
coding sequence. This mutant was named Gly48
Asp (G48D).
The second mutation Gly177
Lys (G177K) was introduced using the same procedure. The resulting plasmids DNAs were used to transform E.coli JM109 competent cells. Plasmid DNA was purified with Wizard Prep Kit (Promega) Restriction analysis of mutated clones gave fragments with expected sizes (data not shown).
The third mutation Gly48
Lys (G48K) was introduced following another procedure. Two fragments with different size and both containing the mutation were synthesized by PCR with GAAAATCGGCCGAAAGAAATACTCG and the flanking primer, CGAGTATTTCTTTCGGCCGATTTTC and the primer that flanked the coding sequence. Then, a fragment containing the whole coding sequence was synthesized by overlap extension of the PCR fragments, followed by PCR with the flanking primers. This final product was gel purified, digested and the DNA fragment was ligated to NdeI/SalI digested vector DNA which contained the ryCK2
coding sequence.
Sequencing
To check that no other mutations were introduced during amplification, the subcloned part of the cDNA was manually sequenced using the USB Sequenase version 2.0 sequencing kit with [
-35S]ATP.
Expression of recombinant wild-type and mutated-type proteins
E.coli BL21 (DE3) CaCl2-competent cells transformed with the desired expression vector were grown overnight at 37°C in a LB medium containing 30 µg/ml ampicillin. Erlenmeyer flasks containing 100 ml of LB medium (30 µg/ml ampicillin) were inoculated with 1% (v/v) saturated culture medium and grown at 37°C under vigorous agitation. When the OD at 600 nm reached 0.6, protein expression was induced by 0.5 mM IPTG and the culture was grown for an additional 3 h. Bacteria were spun at 5000 g for 5 min and washed twice with 0.9 g/l NaCl sterile aqueous solution. Then bacteria were resuspended in sterile aqueous 0.1% Triton X100 solution, frozen and stored at 20°C until use.
Electrophoresis
Denaturing electrophoresis were performed on 420% Novex gradient acrylamide gels according to Laemmli (1970). The sample buffer contained 2% (w/w) SDS, 5% (v/v) 2-mercaptoethanol and 10% (v/v) glycerol. Gels were stained with Coomassie Brilliant Blue G-250 using the method of Neuhoff and Arold (1988).
Protein extraction and purification
Bacteria frozen in 0.1% Triton X-100 were thawed. Soluble enzyme was purified from lysed material incubated for 1h at 37°C with DNase I and MgCl2. The resulting solution was filtered on Glass Microfibre filters (Whatman) GF/A and GF/F, then on a Millex-HV 0.45 µm filter (Millipore). The filtered solution was loaded on a P-11 phosphocellulose column and eluted using a 0.21.2 M NaCl gradient in 25 mM TrisHCl buffer, pH 8, containing 100 µM EDTA, 0.5 mM DTT, 0.1 mM pMSF and 10% glycerol. Active fractions were pooled, loaded on a Hitrap-heparin column (Pharmacia) equilibrated with 20 mM TEAHCl buffer, pH 8, containing 200 mM NaCl, 500 µM EDTA, 2 mM DTT, 0.5 mM pMSF and 10% glycerol, and eluted using a 0.21.2 M NaCl gradient. Active fractions were frozen and stored at -20°C.
Protein determination
Protein concentration was estimated using the method of Bradford (1976) with BSA as standard.
CK2 assay
The ry
CK2 was assayed as already described (Chardot and Meunier, 1994
). One unit is the amount of enzyme which incorporates 1 pmol of phosphate per minute in 25 µg of dephosphorylated caseins (0.5 mg/ml), at 23°C, in 100 mM TEA buffer, pH 7.8, containing 100 mM NaCl, 10 mM MgCl2 and 20 µM ATP. The specific radioactivity of ATP is generally close to 11000 c.p.m./pmol. Km for ATP was determined by varying its concentration from 0.5 to 20µM, the casein concentration being saturating (1 mg/ml). The reaction time was 15 min at 23°C for an enzyme concentration of 1nM. In this period, progress curves were linear. Data were analyzed using the LineweaverBurk representation. Enzyme activity for metal ligand (MgCl2) was determined under the same conditions by varying the MgCl2 concentration from 0 to 10 mM.
Enzyme activity for peptide substrate was determined in a 30 µl volume with 50 mM MOPS buffer (pH 6.8) with 150 mM NaCl, 10 mM MgCl2 and various concentrations of CK2 specific peptides (peptide 1, RREEETEEE, Mr = 1206.2; or peptide 2, RRRADDSDDDDD, Mr = 1405.4; Bachem Biochimie, France), 100 µM [
-32P]ATP (2159 c.p.m. pmol1). After 30 min of incubation at 25°C, the reaction mixture was spotted on phosphocellulose paper (P31, Whatman), precipitated with 75 mM phosphoric acid (Kuenzel and Krebs, 1985
) and counted in a Packard Tricarb 1500 liquid scintillation counter.
| Results |
|---|
|
|
|---|
Protein modeling and design
Identity between rmCK2
and ryCK2
was 69%, homology being 77%, as deduced from sequence alignments (Figure 1
). Following these results, a truncated form of ryCK2
missing the 10 N-terminal and the three C-terminal amino acids (Figure 1
) was modeled. A single amino acid gap was located in the ryCK2
sequence, corresponding to the D265E269 region of the Z.mays enzyme (Figure 1
). A loop prediction was performed on the rmCK2
enzyme, using the loop prediction option of the XBragi software. It gave a four residue loop with r.m.s.d. 0.252 Å for the new rmCK2
structure. The new structure was correct according to the Ramachandran plots (not shown) and was used as a template for ryCK2
modeling. New coordinates for ATP were built with the AMBER PREP program to obtain the most probable position of ATP H atoms. Then two magnesium ions (Niefind et al., 1999
) were introduced before final energy minimization. Protein kinase CK2-specific substrate RRRADDSDDD was also added manually in the structure and minimized.
|
After modeling, the protein core structure was found to be very similar to the rmCK2
structure. Then the potential energy was minimized with the AMBER program. The r.m.s.d. between the ryCK2
minimized model and the new maize structure was 1.043 Å. The ryCK2
structural model (Figure 2A
-helix structures and the N-terminal lobe mainly ß-strands. Molecular dynamics results show that the helix-rich lobe and the ß-strand-rich lobe can move relative to one another and this motion is mediated by a flexible hinge (Figure 2
|
Study of ATP Mg environment
The ATP pocket (Figure 2A and C
) is contained within a region delineated by the conserved region VII (the catalytic loop, containing catalytic glycine-177 and aspartate-179) and the p + 1 loop. The ß-phosphate of the nucleotidic substrate is the closest to the glycine-rich loop (Gly46XGly48XX) (2.9 Å) (Figure 2B
). The
-phosphate complexed to asparagine-165, aspartate-160 and aspartate-179 via a magnesium atom bound to a water molecule. The glycine-rich loop has the shape of a lid moving together with the ß-phosphate of ATP between two extreme positions, one being in close vicinity to the phosphorylatable amino acid residue of the proteic substrate (Figure 2B
). The O21 atom of the ß-phosphate is close to G48. The role of G48 is certainly, as already described in the case of cAPK, to make space for an oxygen of the ß-phosphate (Bossemeyer, 1994
).
Structural relations between the peptide and CK2
model
The coordinates of cAPK peptide inhibitor (1CDK) were used as template for the protein kinase CK2-specific peptidic substrate RRRADDSDDD (Sarno et al., 1995
). The side chains of the inhibitor were replaced by the side chains of protein kinase CK2 peptidic substrate and the energy of the system was minimized. The orientation and location of the peptide were not markedly affected by the energy minimization process. Among the five acidic residues of the peptides (n 2, n 1, n + 1, n + 2, n + 3), four were located at distances allowing interactions with positively charged side chains of the enzyme. Asp n 2 OD1 and OD2 were in close vicinity of Arg336 NE and NHE (2.8 and 2.7 Å). Asp n 1 O was close to Arg336 NH2 (2.9 Å) and to Lys158 NZ (2.8 Å). Asp n 1 OD2 could also interact with Gly48 2HA (2.7 Å) and Arg47 NE (3.2). Asp n + 1 OD1 was close to Arg195 NE ( 2.8 Å) and NH2 (2.7 Å), Asp n + 1 OD2 could interact with Lys198 NZ (2.6 Å) and with Asn238 (2.9 Å). Phosphorylatable Ser OG was located at 2.8 Å from ATP
-phosphate O32 and at 3.2 Å from Lys158 NZ. Target amino acids of the peptide substrate are, after modeling, located near to the glycine-rich loop and interact with histidine-160. Moreover, this last residue is found within 3.2 Å from the oxygen located between ribose and
-phosphate from ATP and in the vicinity of Asp n -2.
Expression of the mutated proteins
A protein with an Mr close to 39 000 was accumulated after IPTG induction in each culture of bacteria expressing wild or mutated proteins (data not shown). After lysis of the bacteria, the soluble enzyme was purified as described in Materials and methods. The wild-type enzyme was purified 360 times, to apparent electrophoretic homogeneity. From 250mlof bacterial culture, we could obtain 10µg of enzyme, the specific activity being 26 600 pmol/min/mg (using dephosphorylated caseins as substrate). Homogeneous protein was present at an apparent Mr of 39 000 Da as determined by SDSPAGE (data not shown). Mutant proteins were purified using the same procedure.
Kinetic properties of the mutant purified proteins
Nucleotidic substrate.
Kinetic parameters of wild-type and mutant proteins for ATP are given in Table IA
. Using dephosphorylated caseins as substrate, we found that kcat (ATP) of G48D was 3.6 times higher than kcat of the recombinant wild-type subunit (Table IA
). Km ATP of G48D decreased slightly (6.8 instead of 7.8 µM). The kinetic parameters of G177K for ATP were very close to those of the wild-type catalytic subunit. In the case of G48K, kcat (ATP) decreased 250-fold in comparison with the kcat of the wild-type subunit. Km (ATP) of G48K increased slightly (10.3 instead of 7.8 µM). Finally, the wild-type ryCK2
and mutated G177K proteins had similar kinetic properties for ATP, as deduced from kcat/Km values. Using the same criteria, both mutated G48D and G48K subunits exhibited modified kinetic properties. Kinetic properties were improved for G48D and impaired for kcat for G48K.
|
Peptidic substrates. All catalytic subunits, except G48K mutant (see later), studied in this work could phosphorylate peptides containing either a phosphorylatable serine or a phosphorylatable threonine residue, peptide containing a phosphorylatable S being the best substrate (Table IB
Metal ligand.
Figure 3A
shows that the replacement of glycine-48 by either a positively charged residue (G48K) or a negatively charged residue (G48D) strongly affected the kinetic properties of the subunits with respect to magnesium. Owing to their relatively high phosphate content, dephosphorylated caseins may bind magnesium. Therefore, we determined the kinetic parameters for Mg2+ using the peptide containing a serine as a substrate (RRRRADDSDDDDD). Vmax (100%) was equal to 980 nmol/min/mg for ryCK2
with MgCl2 and to 13 nmol/min/mg for G48K in the absence of magnesium. The activity of G48K decreased on addition of metal ligand (Figure 3B
), but remained level for Mg2+ concentrations higher than 2 mM.
|
| Discussion |
|---|
|
|
|---|
The elucidation of the three-dimensional structure of maize protein kinase CK2
has been a great asset to understanding better some typical features of this enzyme. The high degree of sequence identity between the enzymes of Y.lipolytica and Z.mays (69%) allowed us to build up a structural model, in which a peptide substrate was also added (using the cAPK peptidic inhibitor as template). This was aimed to increase understanding of the structural relationships between the different substrates and the enzyme. As in the case of rmCK2
, the structure of ryCK2
, is mainly composed of two lobes, moving relatively to each other. From the results of the molecular dynamics study presented in this paper, the helix-rich lobe and the ß-strand-rich lobe could move relative to one another and this motion could be mediated by a flexible hinge. Crystallographic studies of cAPK already proved the existence of a transition from open
intermediate
closed forms (Zheng et al., 1993
(basically active) was closer to the closed form of cAPK (Gangal et al., 1998
The glycine-rich loop is a common feature of protein kinases, its third G being replaced by S in the case of protein kinase CK2 catalytic subunits. In our model structure, this loop has the shape of a lid moving close to the ß-phosphate of ATP between two extreme positions, one being in close vicinity to the phosphorylatable amino acid residue of the protein substrate (Figure 2C
). Hanks and Quinn (1988) have already suggested that a possible role for G48 is to bring the phosphate of NTP near the phosphorylatable seryl moiety and Bossemeyer (1994) proposed that this glycine provides room for an oxygen of the ß-phosphate. Mutants G50S and G52A of the cAPK catalytic subunit have been found to exhibit an ~10-fold decrease of affinity for ATP (Grant et al., 1998
). Km of the mutants for the peptide substrate was increased by ~20-fold and the catalytic velocity decreased by sixfold (Hemmer et al., 1997
). The replacement of conserved residue G48 from cAPK (Hanks and Quinn, 1988
) by a lysine residue affected the kinetic properties of the enzyme. Km for Mg2+ decreased, as did the Km for ATP. We replaced the conserved glycine-48 (Bossemeyer, 1994
) by an aspartic acid residue (G48D). This led to an enzyme with improved kinetic properties for ATP. In the case of ryCK2
, both wild-type and G48D exhibit a strong preference for the peptide RRRADDSDDDDD peptide, rather than for the peptide RREEETEEE, and kcat of G48D for each different substrates was several-fold higher than for the wild-type enzyme. The vicinity of the glycine-rich loop and the phosphorylatable residue, especially on insertion of a negatively charged residue, could bring, through steric and electrostatic effects, the
-phosphate of NTP near to the phosphorylatable residue during the transition between open and closed conformation. This could favor faster release of ADP from the ATP pocket, as ADP release is certainly the limiting step of the catalysis at saturating Mg concentration (Shaffer and Adams, 1999
). In the case of cAPK, the phosphoryl transfer is very fast (500/s) while the rate-limiting step is product release (20/s), which also includes the conformational changes that lead to the opening of the cleft (Grant and Adams, 1996
; Lew et al., 1996
; Naryana et al., 1997). Hence the hypothesis of increased velocity of ADP release seems to be the more reasonable to explain our kinetic study and from our modeling results.
The replacement of glycine-48 by lysine (G48K) leads to an enzyme with decreased kcat for ATP and increased Km for ATP. kcat/Km was very low for ATP and for the peptide substrate. In the molecular model, the replacement of the conserved glycine by a positively charged amino acid seems to create an electrostatic barrier between the phosphorylatable residue and the nucleotide substrate. One can hypothesize that either lysine creates a barrier and there would be a weak transfer of phosphate from NTP to the peptidic substrate or it could interact with the
-phosphate strongly enough to prevent the phosphorylation of serine or threonine. The electrostatic barrier hypothesis seems to be the most realistic. Moreover, in contrast to the wild-type and G48D enzymes, G48K is inhibited by the magnesium. We already hypothesized the fact that protein kinase CK2 utilized two magnesium ions (Chardot et al., 1995
), and this was confirmed by crystallography (Niefind et al., 1999
). One of the Mg2+ would complex ATP, while the other would neutralize negative charges located near the active site. At low magnesium concentration, lysine could play a role similar to magnesium, neutralizing negative charges. However, at higher concentrations, when free magnesium is present in the reaction medium, lysine could be displaced by these ions, the glycine-rich loop being twisted.
We also replaced the glycine-177 by a lysine to study the role of this amino acid belonging to the triplet AspTrpGly in conserved region VII (catalytic domain). The kinetic properties of G177K for ATP are almost identical with those of the purified wild-type enzyme. G177K exhibits increased kcat for both peptides used in this study and an increased kcat/Km for RRRADDSDDDDD substrate. Glycine-177 is located far from the NTP substrate but close to the lysine-rich cluster located between the II and III conserved regions. This lysine-rich cluster is crucial for determining the specificity of protein kinase CK2 for substrates containing acidic residues in the neighborhood of the phosphorylatable residue (Sarno et al., 1995
). The replacement of G177 by K could let new interactions take place with the peptide substrate, especially with its acid residues.
In this work, we presented a structural model of the catalytic subunit
of Y.lipolytica protein kinase CK2 which has been partially tested using site-directed mutagenesis. The experimental results showed the fundamental role of the second glycine of the glycine-rich loop (G48). This glycine interacts with the nucleotidic substrate and is so close to the peptide substrate that its replacement by negatively charged residues gives rise to mutants with improved kinetic properties for the peptidic substrates. A systematic replacement of this residue G48 would help in understanding its role better. Moreover, we showed that another glycine, belonging to the catalytic domain, is probably close to the lysine-rich cluster. Its replacement by a lysine improves kinetic properties of ryCK2
for acid peptidic substrates by creating interactions with these acid residues in the peptide. However, wild-type and mutated ryCK2
have a better specificity for the serine residue than for threonine.
The functionality of the glycine belonging or close to the active site has not been completely studied. It is possible to modify the catalytic properties of protein kinase CK2 by modifying the charge network around the triphosphate moiety of ATP. This network is subtle enough that the properties can be modified either with respect to ATP or to the peptide substrate.
| Notes |
|---|
3 To whom correspondence should be addressed. E-mail: thierry.chardot{at}platon.grignon.inra.fr
| Acknowledgments |
|---|
During her stay in Germany, Delphine Chaillot was the recipient of a grant from the Deutscher Akademischer Austauschdienst (D.A.A.D.). Thierry Chardot and Delphine Chaillot were supported by a grant from Ministère Français des Affaires Etrangères (Procope program). The authors thank Andrée Lepingle for expert DNA sequencing, and thanks are due to Professor D.Dalgleish for kindly correcting the manuscript.
| References |
|---|
|
|
|---|
Allende,J.E. and Allende,C.C. (1995) FASEB J., 9, 313323.
Benetti,P.H, Kim,S.I., Canonge,M., Chardot,T. and Meunier,J.-C. (1997) Mol. Gen. Genet., 256, 355364.[Web of Science][Medline]
Benetti,P.H, Kim,S.I., Chaillot,D., Canonge,M., Chardot,T. and Meunier,J.-C. (1998) Protein Express. Purif., 13, 283290.[Web of Science][Medline]
Bossemeyer,D. (1994) Trends Biochem. Sci., 19, 201205.[Web of Science][Medline]
Bradford,M.M.A (1976) Anal. Biochem., 72, 248254.[Web of Science][Medline]
Chardot,T. and Meunier,J.-C. (1994) Int. J. Biochem., 26, 10171024.
Chardot,T., Hui,S. and Meunier,J.C. (1995) C. R. Acad. Sci. III, 318, 937942.[Medline]
Chothia,C. and Lesk,A. (1986) EMBO J., 5, 823.[Web of Science][Medline]
Dunbrack,R.L. and Cohen,F.E.,Jr (1997) Protein Sci., 6, 16611681.[Web of Science][Medline]
Gangal,M., Cox,S., Lew,J., Clifford,T., Garrod,S.M., Aschbaher,M., Taylor,S.S. and Johnson,D.A. (1998) Biochemistry, 37, 1372813735.[Medline]
Grant,B.D. and Adams,J.A. (1996) Biochemistry, 35, 20222029.[Medline]
Grant,B.D., Hemmer,W., Tsigelny,I., Adams,J.A. and Taylor,S.S. (1998) Biochemistry, 37, 77087715.[Medline]
Guerra,B., Niefind,K., Pinna,L.A., Schomburg,D. and Issinger,O.G. (1998) Acta Crystallogr., D54, 143145.
Hanks,S.K and Quinn,A.M. (1988) Science, 241, 4252.
Hanks,S.K. and Quinn,A.M. (1997) Trends Biochem. Sci., 22, 444446.[Web of Science][Medline]
Hanna,D.E., Rethinaswamy,A. and Glover,C.V.C. (1995) J. Biol. Chem., 270, 2590525914.
Hemmer,W., McGlone,M., Tsigelny,I. and Taylor,S.S. (1997) J. Biol. Chem., 272, 1694616954.
Issinger,O.G. (1993) Pharmacol. Ther., 59, 130.[Web of Science][Medline]
Jakobi,R. and Traugh,J.A. (1992) J. Biol Chem., 267, 2289423902.
Jakobi,R and Traugh,J.A. (1995) Eur. J. Biochem., 230, 11111117.[Web of Science][Medline]
Kuenzel,E.A. and Krebs,E.G. (1985) Proc. Natl Acad. Sci. USA, 82, 737741.
Laemmli,U.K. (1970) Nature, 227, 680685.[Medline]
Lew,J., Coruh,N., Tsigelny,I., Garrod,S. and Taylor,S.S. (1996). J. Biol Chem., 272, 15071513.
Litchfield,D.W. and Lüscher,B. (1993) Mol. Cell. Biochem., 127128, 187199.
Marin,O., Meggio,F., Sarno,S, Cesaro,L., Pagano,M.A. and Pinna,L.A. (1999) J. Biol. Chem., 274, 2926029265.
Munstermann,U., Fritz,G., Seitz,G., Lu,Y.P., Schneider,H.R. and Issinger,O.G. (1990) Eur. J. Biochem., 189, 251257.[Web of Science][Medline]
Narayana,N., Cox,S., Xuong,N.H., Ten Eyck,L.F. and Taylor,S.S. (1997) Structure, 5, 921935.[Medline]
Neuhoff,V. and Arold,N. (1988) Electrophoresis, 9, 255262.[Web of Science][Medline]
Niefind,K., Guerra,B., Pinna,L.A., Issinger,O.G. and Schomburg,D. (1998) EMBO J., 17, 24512462.[Web of Science][Medline]
Niefind,K., Pütter,M., Guerra,B., Pinna,L.A., Issinger,O.G. and Schomburg,D. (1999) Nature Struct. Biol., 6, 11001103.[Web of Science][Medline]
Pinna,L.A. and Meggio,F., (1997) Prog. Cell Cycle Res., 3, 7797.[Medline]
Sarno,S., Boldyreff,B., Marin,O., Guerra,B., Meggio,F., Issinger,O.G. and Pinna,L.A. (1995) Biochem. Biophys. Res. Commun., 206, 171179.[Web of Science][Medline]
Schomburg,D. and Reichelt,J. (1988) J. Mol. Graphics, 6, 161165.
Shaffer,J. and Adams,J.A. (1999) Biochemistry, 38, 55725581.[Medline]
Seldin,D.C. and Leder,P. (1995) Science, 267, 894897.
Sternberg,M.J.E. and Taylor,W.R. (1984) FEBS Lett., 175, 387.[Web of Science][Medline]
Studier,F.W. and Rosenberg,A.H (1990) Methods Enzymol., 185, 6089.[Medline]
Tuazon,P.T. and. Traugh,J.A (1991) In Greengard,P. and Robinson.G.A. (eds.) Advances in Second Messenger Proteins, Research Vol. 23, Raven Press, New York, pp. 123164.
Weiner,P.K. and Kollman,P.A. (1981) J. Comput. Chem., 2, 287.[Web of Science]
Wilson,L.K., Dhillon,N., Thorner,J. and Martin,J.S. (1997). J. Biol. Chem., 272, 1296112967.
Zheng,J., Knighton,D.R., Xhuong,N.H., Taylor,S.S., Sowadski,J.M. and Ten Eyck,L.F. (1993). Protein Sci., 2, 15591573.[Web of Science][Medline]
Received November 11, 1999; revised November 29, 1999; accepted January 27, 2000.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



, ryCK2
, G177K;
, G48D. (B) Kinetic properties with the serine peptide as peptidic substrate.