Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Steele, D. L.
Right arrow Articles by Birktoft, J.J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Steele, D. L.
Right arrow Articles by Birktoft, J.J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Protein Engineering, Vol. 13, No. 6, 397-405, June 2000
© 2000 Oxford University Press

Expression, characterization and structure determination of an active site mutant (Glu202–Gln) of mini-stromelysin-1

Darin L. Steele1,2,3, O. El-Kabbani4, P. Dunten5, L.Jack Windsor6, R.Ursula Kammlott5, R.L. Crowther5, C. Michoud5, Jeffrey A. Engler1,2,3,7 and J.J. Birktoft5,8

1 Department of Biochemistry and Molecular Genetics, 2 Oral Cancer Research Center and 3 Research Center in Oral Biology, University of Alabama at Birmingham, Birmingham, AL 35294, USA, 4 Department of Medicinal Chemistry, Victorian College of Pharmacy, Parkville, Vic. 3052, Australia, 5 Roche Research Center, Hoffmann-La Roche Inc., Nutley, NJ 07110, and 6 Department of Oral Biology, Indiana University, Indianapolis, IN 46202, USA


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Human stromelysin-1 is a member of the matrix metalloproteinase (MMP) family of enzymes. The active site glutamic acid of the MMPs is conserved throughout the family and plays a pivotal role in the catalytic mechanism. The structural and functional consequences of a glutamate to glutamine substitution in the active site of stromelysin-1 were investigated in this study. In contrast to the wild-type enzyme, the glutamine-substituted mutant was not active in a zymogram assay where gelatin was the substrate, was not activated by organomercurials and showed no activity against a peptide substrate. The glutamine-substituted mutant did, however, bind to TIMP-1, the tissue inhibitor of metalloproteinases, after cleavage of the propeptide with trypsin. A second construct containing the glutamine substitution but lacking the propeptide was also inactive in the proteolysis assays and capable of TIMP-1 binding. X-ray structures of the wild-type and mutant proteins complexed with the propeptide-based inhibitor Ro-26-2812 were solved and in both structures the inhibitor binds in an orientation the reverse of that of the propeptide in the pro-form of the enzyme. The inhibitor makes no specific interactions with the active site glutamate and a comparison of the wild-type and mutant structures revealed no major structural changes resulting from the glutamate to glutamine substitution.

Keywords: APMA, p-aminophenylmercuric acetate/BME, ß-mercaptoethanol/BSA, bovine serum albumin/DYT, double yeast tryptone/ECM, extracellular matrix/IPTG, isopropyl-ß-D-thiogalactopyranoside/mAb, monoclonal antibody/Mca-P-L-G-L-Dpa-A-R, (7-methoxycoumarin-4-yl)acetyl-Pro-Leu-Gly-Leu-[3-(2,4-dinitrophenyl)-L-2/3-diaminopropionyl]-Ala-Arg-NH2/ mini-SL-1, hemopexin-like domain deletion of stromelysin-1/ MMP, matrix metalloproteinase/ pAb, polyclonal antibody/ Ro-26-2812, methyl 2-(2-{2-[(biphenyl-4-ylmethyl)amino]-3-mercaptopropionylamino}acetylamino)-3-methylbutyrate/ SDS, sodium dodecyl sulfate/ SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis/ SL-1, stromelysin-1, MMP-3/ TIMP, tissue inhibitor of metalloproteinases


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
The extracellular matrix (ECM) is a multi-functional scaffold that is essential for the structural integrity of tissues. The normal tissue remodeling events of growth and development, angiogenesis and wound healing require matrix remodeling events whereby the ECM is degraded and resorbed in order for maturing cells to divide and spread, followed by the synthesis of new ECM. The matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases, which collectively are capable of degrading most of the constituents of the ECM (for reviews, see Woessner, 1991; Birkedal-Hansen et al., 1993). Failure to regulate the activity of the MMPs results in tissue destruction, as seen in osteoarthritis and rheumatoid arthritis (Okada et al., 1992Go; Walakovits et al., 1992Go), and also in the malignant phenotype of metastatic cells in cancer (Stetler-Stevenson et al., 1992Go). Recently, increased MMP activity has been detected in patients with Lyme disease (Perides et al., 1998Go). The involvement of the MMPs in such diverse pathological conditions has promoted them, in industry and academia alike, as targets of structural studies for drug development.

The structural and functional homology in the MMP family extends across five domains: (i) a signal peptide which is cleaved off upon secretion, (ii) a propeptide region containing a single cysteine residue which is involved in maintaining latency, (iii) a catalytic domain that coordinates the active site zinc, (iv) a proline-rich hinge region and (v) a hemopexin-like domain which is believed to play a role in enzyme specificity. Exceptions to this arrangement include matrilysin, which lacks the carboxy-terminal hemopexin-like domain, the gelatinases, which have three tandem fibronectin type II motif insertions within the catalytic domain, and the membrane-type MMPs, which have a membrane-spanning region.

The sequence alignment of the catalytic domains of several MMPs illustrates the conservation of several key residues responsible for the activity of the enzymes (Figure 1Go). Within the conserved sequence HEXGHXXGXXH are the three histidine residues utilized in the coordination of the active site zinc. The catalytic activity of the MMPs is believed to occur via the nucleophilic attack of a water molecule, charged by the active site glutamic acid residue (Hangauer et al., 1984Go). Mutation of the glutamic acid to a glutamine residue in human gelatinase A (Crabbe et al., 1994Go) and collagenase-1 (Windsor et al., 1994Go) results in catalytically compromised enzymes.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 1. . Conservation of the active site glutamic acid throughout the MMPs. A sequence alignment of the active site residues for members of the MMP family demonstrates the conservation of the HEXGHXXGXXH sequence throughout the enzymes. The glutamic acid proposed to be involved in charging a nucleophilic water with substrate cleavage has been highlighted. Abbreviations: SL-1 = human stromelysin-1 (Wilhelm et al., 1987Go); SL-2 = human stromelysin-2 (Muller et al., 1988Go); SL-3 = human stromelysin-3 (Basset et al., 1990Go); CL-1 = human fibroblast collagenase (Goldberg et al., 1986Go); PMN CL = human neutrophil collagenase (Hasty et al., 1990); CL-3 = human collagenase-3 (Knauper et al., 1996); GelA = human 72 kDa gelatinase (Collier et al., 1988); GelB = human 92kDa gelatinase (Goldberg et al., 1989Go); MMP7 = human matrilysin (Muller et al., 1988Go); MTMMP1 = human membrane-type matrix metalloproteinase-1 (Sato et al., 1994Go); MTMMP2 = human membrane-type matrix metalloproteinase-2 (Will and Hinzmann, 1995Go); MTMMP3 = human membrane-type matrix metalloproteinase-3 (Takino et al., 1995Go).

 
This paper describes the expression and characterization of mutant forms of human stromelysin-1 where site-directed mutagenesis was used to exchange the active site glutamic acid with a glutamine residue, in order to study the effect of this mutation on the activity and the structure of the enzyme. The mutation proved to be beneficial in the purification process by rendering the enzyme inactive and yielding a more stable protein for crystallization studies. Crystals were obtained for both the mutant and wild-type enzymes complexed with the same inhibitor. The first structure to be described is a complex between the biphenyl inhibitor methyl 2-(2-{2-[(biphenyl-4-ylmethyl)amino]-3-mercaptopropionylamino}acetylamino)-3-methylbutyrate (Ro-26-2812) and a trypsin cleaved form of the wild-type stromelysin-1 enzyme (wtSL-1) consisting of the catalytic domain residues Phe83–Thr255. The second structure described is a complex between the same Ro-26-2812 inhibitor and a mutant form of the human stromelysin-1 protein [mini-SL-1 {Delta}pro (E–Q)], which includes residues Met82–Pro252. The Ro-26-2812 inhibitor is a peptidomimetic compound with an IC50 against wild-type stromelysin-1 of 1.6 µM and is composed of a biphenyl P1' moiety linked to the propeptide-based amino acid sequence Cys-Gly-Val (Figure 5AGo). The inhibitor is observed to bind in reverse orientation relative to the mode of binding of the propeptide in the pro-form of stromelysin (Becker et al., 1995Go). The structural comparison of the two crystal forms of the enzyme reveals no significant differences between the mutant and wild-type complex structures.




View larger version (76K):
[in this window]
[in a new window]
 
Fig. 5. . Mini-SL-1 {Delta}pro (E–Q) and the wtSL-1 active site inhibitor interactions. (A) Schematic diagram of the inhibitor Ro-26-2812 and its interactions in the active site. (B) A stereo Ribbons (Carson, 1997) illustration of the positioning of the Ro-26-2812 inhibitor within the active site of mini-SL-1 {Delta}pro (E–Q). The four hydrogen bonds between the inhibitor and the protein and the coordination of the active site zinc by the inhibitor cysteine moiety are highlighted in purple. (C) Symmetry related C-terminus in active site of wtSL-1. Three residues (Pro253, Glu254 and Thr255) of the C-terminus of a symmetry-related molecule lie across the active site of molecule A of the wtSL-1 dimer. The carboxy-terminus of a symmetry-related threonine residue coordinates the active site catalytic zinc while hydrogen bonds are formed between molecule A and symmetry-related residues.

 

    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Protein expression

The mini-SL-1 expression plasmid was created as described previously (Windsor et al., 1997Go). Briefly, the SL-1 cDNA was removed by digesting the pBS'SL plasmid [a gift from Dr G.I.Goldberg (Wilhelm et al., 1986Go)] with EcoRI and BamHI followed by the addition of BamHI linkers to the restriction fragment. This fragment was then digested with BamHI and ligated into the BamHI site of the pGEMEX-1 expression vector (Promega, Madison, WI). The expression plasmid pGXSL-1 was produced by removing the coding regions for gene 10 of pGEMEX-1 and the signal peptide of stromelysin-1 using site-directed mutagenesis with the primer 5' GGAGATATACATATGTATCCGCTGGATGGAGCTC 3'. The hemopexin-like domain was removed by introducing stop codons after amino acid 252 using the primer 5' TATGGACCTCCCCCGGATCCCTGATAGAGATATGTAGAAG 3'. The protein produced from this plasmid (pGXmini-SL-1) was referred to as mini-SL-1.

The expression plasmid pGXmini-SL-1 (E–Q) was produced from the pGXmini-SL-1 plasmid by mutation of residue number 202 from a glutamic acid to a glutamine using the primer 5' TCGTTGCTGCTCATCAGATTGGCCACTCC 3'.

Finally, the expression plasmid pGXmini-SL-1 {Delta}pro (E–Q) was produced by removing the propeptide coding region for amino acids 1–83 from the pGXmini-SL-1 (E–Q) expression vector with the primer 5' GGGCGAATTGGGTAAGAAGGAGATATACATATGTTCAGAACCTTTCCT 3'.

DNA sequencing was used to confirm the presence of each of these mutations (Sanger et al., 1977Go; Biggin et al., 1983Go). Escherichia coli BL-21 (DE3) cells (Studier and Moffatt, 1986Go) were transformed with each construct and grown in 1 l of double yeast tryptone (DYT) with 50 µg/ml ampicillin overnight at 37°C. The overnight culture was used to inoculate 24 l of DYT with 50 µg/ml ampicillin in a Microferm Fermenter (New Brunswick Scientific, Edison, NJ) where the cells were grown under controlled temperature, mixing and aeration conditions to a density of 108 cells/ml. Isopropyl-ß-D-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM to induce transcription from a chromosomal copy of the T7 polymerase gene. After 3–4 h of induction, the cells were harvested using a 0.22 µm Pellicon filtration system (Millipore, Bedford, MA) and pelleted via centrifugation.

wtSL-1 expression

The wild-type human stromelysin-1 protein (wtSL-1) was recombinantly expressed as the pro-form of the enzyme, consisting of residues Leu16 to Thr255. The enzyme was purified using a polyclonal anti-prostromelysin-1 antibody as described (Fotouhi et al., 1994Go) and activated using trypsin-coated beads prior to concentration and co-crystallization with the Ro-26-2812 inhibitor.

Protein extraction and purification

The cell pellets were resuspended in 50 mM Tris–HCl (pH 7.5), 0.2 M NaCl, 5 mM CaCl2 and 1 µM ZnCl2 (buffer A) and passed through a French press (10 000–15 000 psi) to disrupt the cells. The protein-laden inclusion bodies were pelleted by centrifugation and then washed in buffer A. The inclusion bodies were pelleted again and then resuspended in 6 M urea in buffer A to solubilize the protein. After 2–3 h at 4°C on an orbital shaker, the extracts were centrifuged and the supernatants passed over a Sephacryl S-200 HR (Pharmacia, Piscataway, NJ) column (88x2.5 cm i.d.) equilibrated with 6 M urea in buffer A. Fractions containing the protein of interest were identified by SDS–PAGE, pooled and dialyzed against buffer A to remove the urea. Monoclonal antibody IID4 raised against human stromelysin-1 was coupled to CNBr-activated Sepharose 4B (Pharmacia, Uppsala, Sweden) and used to purify the protein further as described by Windsor et al. (1993). The protein was eluted from the antibody affinity column with 6 M urea in buffer A and dialyzed against buffer A alone to remove the urea. The protein concentration was determined by the Bradford method (Bradford, 1976Go) using bovine serum albumin (BSA) for standardization.

Antibodies

The Tissue Inhibitor of Metalloproteinase-1 (TIMP-1) protein was purified as described previously (Caterina et al., 1997Go) and used to make polyclonal and monoclonal antibodies according to previously described methods (Birkedal-Hansen, 1987Go).

Gelatin zymography

Gelatin (1 mg/ml) was copolymerized in 10% SDS–PAGE gels. After electrophoresis, the gels were washed for 20 min in 2.5% Triton X-100 and 3 mM NaN3 followed by a 20 min wash in the same buffer containing 50 mM Tris–HCl (pH 7.5), 5 mM CaCl2 and 1 µM ZnCl2. The gels were next equilibrated for 20 min in 50 mM Tris–HCl (pH 7.5), 5 mM CaCl2, 1 µM ZnCl2 and 3 mM NaN3 and then incubated at 37°C for 16 h in the same buffer. The gels were then stained with Coomassie Brilliant Blue to reveal the lytic zones indicating areas of enzymatic activity.

Amino acid sequencing

Amino acid sequencing was used to verify the amino termini of the purified proteins expressed from each plasmid. The proteins were transblotted from 10% SDS–PAGE gels to Immobilon-P paper (Millipore) in 10 mM CAPS [3-(cyclohexylamino)-1-propanesulfonic acid] buffer (pH 11) and 10% methanol at 300 mA for 1 h as described by the manufacturer (LeGendre, 1990Go). The Immobilon-P membrane was then stained with Coomassie Brilliant Blue to reveal the protein bands. The bands of interest were then excised and sequenced on a Porton PI2050E Peptide Microsequencer.

Trypsin cleavage and TIMP-1 capture

TIMP-1 protein was produced from HeLa cells infected with a recombinant vaccinia virus transformed with the human TIMP-1 gene and purified from the culture media using heparin-Sepharose chromatography in conjunction with C4 reversed-phase HPLC (Caterina et al., 1997Go). Samples of the mini-SL-1, mini-SL-1 (E–Q) and mini-SL-1 {Delta}pro (E–Q) proteins were incubated with N-tosyl-L-phenylalanyl chloromethyl ketone (TPCK)-treated trypsin (20 µg/ml) in buffer A at 22°C for 20 min. The trypsin reactions were stopped by the addition of soybean trypsin inhibitor (300 µg/ml). An equimolar ratio of TIMP-1 to mini-SL-1 protein was added to each sample and incubated for 1 h at 37°C. The reactions were stopped with the addition of buffer containing 0.1% SDS and ß-mercaptoethanol (BME) (DeClerck et al., 1991Go). The samples were analyzed by Western blotting for complex formation using 5 µg/ml of anti-TIMP-1 monoclonal antibody (mAb) NaTIA2.

Peptide cleavage rates

The mini-SL-1, mini-SL-1 (E–Q) and mini-SL-1 {Delta}pro (E–Q) proteins were treated with p-aminophenylmercuric acetate (APMA) and incubated at 23°C with the coumarinyl peptide Mca-P-L-G-L-Dpa-A-R (0.5 µM final concentration) in buffer A. Fluorescence was monitored using a SLM Aminco SPF spectrofluorimeter with an excitation wavelength of 328 nm and an emission wavelength of 393 nm. Since [S0] << Km, kcat/Km was calculated from the equation .

Concentration and crystallization of the stromelysin–inhibitor complexes

The wtSL-1 and the mini-SL-1 {Delta}pro (E–Q) protein were dialyzed against 1 mM Tris–HCl (pH 7.5), 100 mM NaCl, 5 mM CaCl2 and 1 µM ZnCl2, concentrated to 10 mg/ml using a Centriprep 10 (Amicon, Beverly, MA) and incubated with the inhibitor Ro-26-2812 at 4°C for a minimum of 6 h. Initial crystallization experiments with the wtSL-1 enzyme indicated that a 2:1 molar ratio of inhibitor over protein produced the best quality crystals for structural studies. Crystals were grown by hanging drop vapor diffusion in Linbro boxes at 22°C in drops consisting of two volumes of each protein–inhibitor solution mixed with one volume of well solution (Gilliland and Davies, 1984Go). Crystals approximately 200x100x75 µm in size were obtained from well solutions containing 100 mM cacodylate buffer (pH range 6.5–7.0), 30% PEG (4000; 5000 monomethyl ether (MME); 6000; or 8000), 50 mM CaCl2 and 200 mM KCl. The crystals were soaked in the appropriate well solutions containing a 1% step gradient toward a final concentration of 15% glycerol and frozen for data collection.

Data collection

The data for each crystal form were collected on an ADSC San Diego multiwire area detector and processed using the ADSC software. The X-ray source was a Rigaku RU-200 rotating-anode generator operating at 50 kV/90 mA, which provided monochromator filtered Cu K{alpha} radiation of 1.54 Å wavelength. The mini-SL-1 {Delta}pro (E–Q) and the wild-type SL-1 crystals belong to the space group P212121 with two molecules (A and B) per asymmetric unit and unit cell dimensions a = 120.1, b = 47.0, c = 54.9 Å and {alpha} = ß = {gamma} = 90° and a = 37.7, b = 78.1, c = 105.7 Å and {alpha} = ß = {gamma} = 90°, respectively.

Structure determination and refinement

The rotation and translation solutions were determined by the molecular replacement method with the program AMoRe (Navaza, 1994Go). The starting model for the wtSL-1 complex with Ro-26-2812 was an unliganded stromelysin structure refined to an R-factor of 19% against data extending to 1.74 Å. Molecule B of the refined wtSL-1 structure, stripped of the inhibitor, was subsequently used as starting model for the mini-SL-1 {Delta}pro (E–Q) structure solution. The graphics programs TOM (Jones, 1982Go) and O (Jones et al., 1991Go) were used to fit the model within the density and for the placement of water molecules. The initial inspection of electron density around the active site revealed clear and distinct density for the unbiased fitting of the Ro-26-2812 inhibitor. The programs X-PLOR (Brünger et al., 1990Go) and REFMAC (Murshudov et al., 1997Go) were used for the subsequent structure refinement between cycles of model fitting. Restrained, isotropic, individual atom B-factors were refined within REFMAC. Omit maps were calculated at five amino acid intervals followed by graphics sessions for model optimization. In both structures there are two independent molecules per asymmetric unit. The mini-SL-1 {Delta}pro (E–Q) model includes residues Phe86 to Asp252, 71 water molecules, four zinc ions, six calcium ions and two inhibitor molecules. The final model has an R-factor of 22% (Table IGo). The wtSL-1 model includes residues Phe83 to Thr255, 213 water molecules, four zinc ions, six calcium ions and one inhibitor molecule. The final model has an R-factor of 20% (Table IGo). The two residues classified as Ramachandran outliers in both structures are involved in binding metal ions. Coordinates have been deposited with the Protein Data Bank (Berman et al., 2000Go) as entries 1C8T and 1C3I for the mini-SL-1 {Delta}pro (E–Q) and wtSL-1 models, respectively.


View this table:
[in this window]
[in a new window]
 
Table I.. Crystallographic data
 
Structure comparisons

The structural comparisons made with the program LSQMAN (Kleywegt, 1996Go) were based on C{alpha} atom coordinates and required the C{alpha} atoms of matching residues in the superposed molecules to be within 3.8 Å of one another. Residues further apart than this were not included in the r.m.s. distance calculations. Matching fragments were also required to be at least five residues in length to be included in the r.m.s. distance calculations.


    Results and discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Expression and purification of stromelysin

The `mini' forms of the enzymes, mini-SL-1 and mini-SL-1 (E–Q), which consist of the propeptide and the catalytic domain and mini-SL-1 {Delta}pro (E–Q), which consists of the catalytic domain alone, were expressed in E.coli BL-21 (DE3) cells. Each of the recombinant proteins contained an additional N-terminal Met residue which was added during E.coli expression. The proteins also contained a carboxy-terminal Ser252Pro point mutation, which came about from the addition of the BamHI restriction site during the construction of the expression vectors. The proteins were purified using size exclusion chromatography followed by affinity chromatography. The purified protein from each stromelysin-1 construct was >98% pure as determined by densitometry of Coomassie Brilliant Blue-stained gels (Figure 2Go) or silver-stained gels (data not shown). A fourth construct, wtSL-1, with three additional residues at the C-terminus (Pro253, Glu254 and Thr255) was used for the crystallographic work described below.




View larger version (88K):
[in this window]
[in a new window]
 
Fig. 2. . Expression and purification. The mini-SL-1 proteins were expressed in E.coli BL-21 cells, extracted and purified by size exclusion chromatography followed by affinity purification. (A) The BL-21 cells were harvested, pelleted and passed through a French press (10 000–15 000 psi). The cell debris was pelleted via centrifugation and the supernatant (lane 1) was retained for assessment. The pellets were resuspended and washed in buffer followed by centrifugation to pellet the inclusion bodies. The wash supernatant (lane 2) was retained and the pellet resuspended in 6 M urea in buffer and placed on an orbital shaker for 2–3 h followed by centrifugation to remove the remaining debris from the 6 M urea supernatant (lane 3). Finally, the 6 M urea extracts were purified by size exclusion followed by affinity purification (lane 4). (B) Western blot of the purified mini-SL-1 proteins. Lane 1, mini-SL-1; lane 2, mini-SL-1 (E–Q); lane 3, mini-SL-1 {Delta}pro (E–Q).

 
TIMP-1 capture

Complexes that are formed between the tissue inhibitors of metalloproteinases (TIMPs) and the MMPs can be visualized in SDS–PAGE gels (DeClerck et al., 1991Go). Moreover, proteolytic activity is not necessary for complex formation as demonstrated by the ability of the E200-Q mutation of collagenase-1 to form complexes (Windsor et al., 1994Go). Therefore, the potential to form TIMP complexes was used to assess the ability of the recombinant `mini' proteins to fold correctly. The tissue inhibitors of metalloproteinases will form complexes with MMPs only after the propeptide cysteine has dissociated from the catalytic zinc (the so-called `switch open' forms of the MMPs). In order to generate the `switch open' form of the recombinant `mini' proteins, trypsin was used to remove the propeptide (Figure 3AGo). The trypsin-treated mini-SL-1, mini-SL-1 (E–Q) and mini-SL-1 {Delta}pro (E–Q) proteins formed SDS stable complexes with TIMP-1, as demonstrated by Western blotting with anti-TIMP-1 monoclonal antibody (Figure 3BGo). Thus all of the bacterially expressed proteins refolded properly, as evidenced by their ability to bind TIMP-1.




View larger version (54K):
[in this window]
[in a new window]
 
Fig. 3. . Trypsin activation and TIMP-1 complex formation. (A) The mini-SL-1 proteins (40 µg/ml) were incubated with TPCK-trypsin (20 µg/ml) for 20 min at 22°C and the reactions terminated by the addition of soybean trypsin inhibitor (300 µg/ml). The trypsin-treated samples were analyzed by Western blot analysis using anti-SL-1 mAbs IID4 and IIID3 (Galazka et al., 1999). (B) The mini-SL-1 trypsin-treated enzymes were incubated with TIMP-1 (40 µg/ml) for 1 h at 22°C and complex formation was assessed by Western blot analysis using anti-TIMP-1 mAb NaTIA2.

 
Enzyme activity

To assess the consequences of the E202Q substitution on catalytic activity, the three `mini' proteins were assayed for autolytic activation and catalytic activity against gelatin and a fluorescent peptide substrate. The two constructs which include the propeptide required activation before activity could be assayed. Conformational perturbants, such as SDS, are known to promote the activation of MMPs and, once activated, MMPs will degrade gelatin copolymerized within an SDS–PAGE gel (Birkedal-Hansen and Taylor, 1982Go). In this zymogram assay, the mini-SL-1 protein cleaved the gelatin within the gel, while the mini-SL-1 (E–Q) and mini-SL-1 {Delta}pro (E–Q) proteins showed no visible activity (Figure 4AGo). MMPs may also be activated with organomercurials (e.g. APMA), which promote the autolytic cleavage of the propeptide. APMA-induced activation was used to confirm the results of the zymogram assay. The mini-SL-1 enzyme underwent the reduction in molecular weight consistent with the removal of the propeptide, while the mini-SL-1 (E–Q) protein remained intact (Figure 4BGo). Finally, the APMA-treated proteins were assayed for their ability to cleave the fluorescent peptide derivative Mca-P-L-G-L-Dpa-A-R (Knight et al., 1992Go). The APMA-treated mini-SL-1 (E–Q) and mini-SL-1 {Delta}pro (E–Q) proteins showed no activity toward the peptide (Table IIGo). kcat/Km for the APMA-activated mini-SL-1 protein was 33.2 µM–1 h–1, which is comparable to previously reported values for wild-type stromelysin-1 (Knight et al., 1992Go; Wilhelm et al., 1993Go; Abramson et al., 1995Go; Windsor et al., 1997Go). Given that the sole difference between the mini-SL-1 (E–Q) and mini-SL-1 proteins is the Glu to Gln mutation, the inactivity of the (E–Q) mutant can be attributed to the loss of the catalytic base at the active site due to mutation of Glu202. These results confirm the importance of the active site Glu in the MMPs, as previously demonstrated for collagenase-1 and gelatinase A (Crabbe et al., 1994Go; Windsor et al., 1994Go).



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 4. . Gelatin zymography. (A) The purified mini-SL-1 proteins were incubated at 37°C for 12 h in the presence and absence of 1 mM APMA, resolved on a 10% SDS–PAGE gel copolymerized with 1 mg/ml gelatin, incubated at 37°C for 16 h and then stained with Coomassie Brilliant Blue to visualize the lytic bands. (B) Companion samples were resolved on a 10% SDS–PAGE gel and then stained with Coomassie Brilliant Blue.

 

View this table:
[in this window]
[in a new window]
 
Table II.. Cleavage of the MCA-peptide [the values are the average of three experiments minus background (peptide alone)]
 
Protein crystallization and structural characterization

The wild-type stromelysin protein (wtSL-1) consisting of residues Phe83–Thr255 was co-crystallized with the synthetic Ro-26-2812 inhibitor. The mini-SL-1 {Delta}pro (E–Q) protein, which consists of residues Met82–Pro252, was used for the structural studies and co-crystallized with the synthetic Ro-26-2812 inhibitor. The crystals from both complexes belonged to the space group P212121 and diffracted to 1.83 Å for the wtSL-1–Ro-26-2812 complex and to 2.6 Å for the mini-SL-1 {Delta}pro (E–Q)–Ro-26-2812 complex. Each protein crystallized with two molecules per asymmetric unit, with unit cell dimensions a = 37.7, b = 78.1, c = 105.7 Å and {alpha} = ß = {gamma} = 90° for the wtSL-1–Ro-26-2812 complex and a = 120.1, b = 47.0, c = 54.9 Å and {alpha} = ß = {gamma} = 90° for the mini-SL-1 {Delta}pro (E–Q)–Ro-26-2812 complex.

The overall fold of the two enzyme forms and the coordination of the catalytic zinc, structural zinc and calcium ions are homologous to each other and the previously described structures of the stromelysin enzyme (Becker et al., 1995Go; Van Doren et al., 1993Go, 1995Go; Dhanaraj et al., 1996Go; Gomis-Rüth et al., 1997Go). The fold consists of three {alpha}-helices (A, B and C) and a five-stranded ß-sheet consisting of four parallel strands (1, 2, 3 and 5) and one antiparallel strand (4). Minor differences between the inhibited structures are found at the N- and C-termini, the loop regions and in the crystal packing.

The wtSL-1–Ro-26-2812 structure

In the wild-type structure there are two molecules in the asymmetric unit (molecules A and B). The Ro-26-2812 inhibitor binds to the active site of molecule B while the carboxy-terminus of a symmetry-related molecule binds in the active site of molecule A. Similar crystal contacts have been described for crystal structures of collagenase (Lovejoy et al., 1994Go), although in the case of collagenase the amino-terminus of a neighboring symmetry-related molecule occupies the active site.

Description of molecule B of the wtSL-1–Ro-26-2812 structure

The inhibitor Ro-26-2812 is a peptidomimetic inhibitor with an IC50 of 1.6 µM. The inhibitor binds within the active site of molecule B of the dimer making several hydrogen bonding interactions with the active site S1' to S3' positions (Figure 5A and BGo). The catalytic zinc in the active site is coordinated by the sulfur (2.2 Å) of the inhibitor cysteine moiety, while the biphenyl group fits snugly into the S1' hydrophobic pocket. The carboxyl oxygen of the inhibitor cysteine moiety forms a hydrogen bond with the backbone amide nitrogen of LeuB164 (2.6 Å). The carboxyl oxygen of the inhibitor glycine moiety hydrogen bonds with the backbone amide nitrogen of TyrB223 (3.0 Å) and the backbone amide of the glycine moiety hydrogen bonds with the carboxyl oxygen of ProB221 (3.2 Å). The backbone amide of the valine moiety forms a hydrogen bond with the backbone carboxyl oxygen of AsnB162 (3.0 Å).

Both the propeptide in the pro-form of the enzyme and the tripeptide inhibitor Ro-26-2812 bind in such a fashion to satisfy the hydrogen-bonding network in the S1' to S3' sites. However, the propeptide-based sequence of the inhibitor, Cys-Gly-Val, binds in an orientation opposite to that seen in the crystallographic structure of the pro-form of the enzyme (Becker et al., 1995Go). In the context of the propeptide, the Gly and Val residues of the Cys-Gly-Val sequence occupy the S1 and S2 sites and form few specific interactions with the enzyme. None of the main-chain carboxyl oxygens of the Cys-Gly-Val sequence motif in the propeptide accept hydrogen bonds from the protein, nor does the Val main-chain amide nitrogen donate a hydrogen bond. The orientation of the Cys-Gly-Val tripeptide is reversed in the structure with Ro-26-2812 bound, as the tripeptide binds in an extended conformation parallel to residues 221–223 and antiparallel to residues 162–164 of stromelysin. This mode of binding fulfills the hydrogen-bonding requirements of the main-chain and places the biphenyl moiety deep into the S1' pocket.

Description of molecule A of the wtSL-1–Ro-26-2812 structure

Four carboxy-terminal residues of a symmetry-related molecule fit into the active site of molecule A (Figure 5CGo). The carboxy-terminal oxygens of the symmetry-related ThrB255 residue coordinate the active site zinc while residues GluB254 and SerB252 form hydrogen bonds with neighboring residues of molecule A. The carboxyl oxygen and the backbone amide of the symmetry-related GluB254 form hydrogen bonds with the backbone amide and the carboxyl oxygen of AlaA167, respectively. The carboxyl oxygen of the symmetry-related SerB252 forms a water-mediated hydrogen bond with the backbone amide of AlaA169. In comparison with molecule B, the absence of bound inhibitor in molecule A allows the side chain of TyrA223 to rotate across the S1' pocket, which would ordinarily be occupied by the inhibitor P1' biphenyl moiety. The extension of the carboxy-terminus by three residues introduces hydrogen bond contacts between the molecules of the crystal, which may have helped produce more ordered crystals than those obtained from the shorter mini-SL-1 {Delta}pro (E–Q) protein.

The mini-SL-1 {Delta}pro (E–Q)–Ro-26-2812 structure

The mini-SL-1 {Delta}pro (E–Q)–Ro-26-2812 structure also has two molecules in the asymmetric unit (molecules A and B) with the Ro-26-2812 inhibitor bound within the active site clefts of both molecules A and B. The Ro-26-2812 inhibitor is bound in the same manner and orientation as that of the inhibitor in molecule B of the wtSL-1–Ro-26-2812 complex, making several hydrogen bonding interactions with the active site S1' to S3' positions (Figure 5A and BGo). The carboxyl oxygen of the inhibitor cysteine moiety forms hydrogen bonds with the backbone amides of Leu164 and Ala165. The carboxyl oxygen and the amide nitrogen of the inhibitor glycine moiety form hydrogen bonds with the Tyr223 backbone amide and the Asn162 carboxyl oxygen, respectively. The amide nitrogen of the inhibitor valine moiety forms a hydrogen bond with the backbone carboxyl of Asn162. These hydrogen bonds secure the loop prior to ß-strand 4 at Asn162, Leu164 and Ala165 and the C-terminal helix following the `Met turn' (Bode et al., 1993Go) close to the active site helix. At a resolution of 2.6 Å, the electron-density map cannot distinguish between the N and O atoms of the Gln202 side chain and therefore the choice of rotamer for the mutated residue is somewhat uncertain. The rotamer chosen places the side chain's amide, rather than carbonyl, near the inhibitor's cysteine thiolate.

Overall structural comparison

The program lsqkab (Kabsch, 1976Go) from the CCP4 software package (Collaborative Computational Project, Number 4, 1994Go) was used to superimpose molecule B of the wtSL-1 structure with molecule B of the mini-SL-1 {Delta}pro (E–Q) structure. A visual comparison of the two stromelysin structures reveals neither local nor global changes to the fold of the enzyme (Figure 6Go). Further, in the active site the side chains of Gln202 in the mutant and Glu202 in the wild-type adopt the same conformation (Figure 6Go). Hence the glutamate to glutamine mutation appears to be a conservative change with respect to the preservation of both the overall fold of the enzyme and the active site's architecture.



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 6. . Structural comparison between the mini-SL-1 {Delta}pro (E–Q) and the wtSL-1 proteins. A Ribbons illustration of the overall structural identity between the mini-SL-1 {Delta}pro (E–Q) and the wtSL-1 structures. The ribbon tracing of the mini-SL-1 {Delta}pro (E–Q) main chain is depicted in lighter colors (light blue for helices, light green for strands and yellow for loops). Side chains for the active site histidine residues responsible for coordinating the active site zinc, the glutamine residue of mini-SL-1 {Delta}pro (E–Q) and the wild-type glutamic acid involved in catalysis are shown.

 
The overall similarity of the structures was assessed using the program LSQMAN (Kleywegt, 1996Go) to perform superpositions between pairs of molecules and calculate a quantitative measure of similarity (the r.m.s. distance measure based on matching C{alpha} atoms). A high-resolution (1.7 Å) structure taken from the Protein Data Bank was included in the comparisons [PDB entry 1HFS, consisting of residues 88–247 (Esser et al., 1997Go)]. The comparisons require the C{alpha} atoms of matching residues in the superposed molecules to be within 3.8 Å of one another. The superpositions show that apart from differences at the chain termini and in one flexible loop around residues 223–231, the structures are all very similar (Table IIIGo). The conformation of the flexible loop 223–231 in molecule A of wtSL-1 differs from all other molecules in the comparison. This difference is not surprising, given that the loop forms part of the lining of the S1' pocket and the S1' pocket of molecule A in wtSL-1 is not occupied by an inhibitor. The first residue matched in the superpositions, at the N-terminus, can be seen to vary depending on the molecules involved (Table IIIGo). In the mini-SL-1 {Delta}pro (E–Q) enzyme, the expression strategy required the addition of an amino-terminal methionine residue. The addition of this residue precludes the formation of a salt link between the amino-terminal ammonium group of Phe83 and the side chain carboxylate of a highly conserved aspartic acid (Asp237) as seen in the wtSL-1 structure. In the mini-SL-1 {Delta}pro (E–Q) structure Phe83 is not visible, the first residue for which electron density is present is Phe86 and the high B-factors for residues 86–89 indicate that this part of the chain is fairly flexible. Residues preceding Gly88 are not included in any of the superpositions involving the mini-SL-1 {Delta}pro (E–Q) structures, apart from the comparison of molecule A with molecule B of mini-SL-1 {Delta}pro (E–Q) itself. The flexibility of the N-terminus of stromelysin was noted previously by Dhanaraj et al. (1996) in a report describing a structure for which the first residue visible in the electron density was Pro90. Thus, looking at both the active site, where the inhibitor Ro-26-2812 makes the same set of interactions in the wtSL-1 and mini-SL-1 {Delta}pro (E–Q) structures and the overall structural comparisons (Figure 6Go and Table IIIGo), the glutamate to glutamine substitution appears not to have perturbed the structure of the enzyme.


View this table:
[in this window]
[in a new window]
 
Table III.. Structural comparisons
 
Outlook

The variety of substrates susceptible to the activity of stromelysin draws attention toward targeting this enzyme in particular. In addition to being an activator of collagenase-1, stromelysin is capable of cleaving proteoglycans, fibronectin, laminin, collagen types III, IV and IX and procollagen type I. Tissue inhibitors of metalloproteinases (TIMPs) are naturally occurring inhibitors of the MMPs which form complexes with the MMPs in a one-to-one stoichiometric fashion. Owing to their size, the TIMPs are not the therapeutic agents of choice; hence there has been intense effort to generate potent and specific small molecule inhibitors of stromelysin-1 and the other members of the MMP family. Initial inhibitor compounds were peptidomimetic inhibitors based on the prodomain of the enzymes (Fotouhi et al., 1994Go). The work described here shows that peptide inhibitors based on the sequence of the propeptide can bind to the active site of stromelysin-1 in reverse orientation relative to the mode of binding of the propeptide. The structural results provide a foundation for further work to improve upon the potency of this class of inhibitors. Recent structural work by Pavlovsky et al. (1999) characterized complexes between stromelysin and several non-peptidic inhibitors. Pavlovsky et al.'s results show that it is indeed possible to design potent stromelysin inhibitors completely lacking any peptide bonds.

Continuing crystallographic studies will require homogeneous preparations of MMPs at high concentrations. In cases where inhibitors are not available, MMPs can break down upon autolytic processing of the propeptide. In our hands, the autolytic activity of the human mini-stromelysin-1 (mini-SL-1) enzyme resulted in heterogeneous mixtures of the enzyme (data not shown). Here, we have demonstrated that the mutation of the active site glutamic acid of human stromelysin-1 to a glutamine residue produces a catalytically incompetent enzyme. In addition, these structural studies demonstrate that the mutation of this residue does not perturb the fold of the enzyme. We therefore consider this mutation to be a useful tool for structure-based drug design studies of MMPs, especially in cases such as that presented here, where no crucial interactions to the active site glutamate are made. Ultimately, the design and synthesis of potent and specific inhibitors toward each member of the MMP family will prove to be invaluable in the treatment of the degenerative diseases of the ECM.


    Notes
 
7 To whom correspondence should be addressed. E-mail: jengler{at}bmg.bhs.uab.edu Back

8 Present address: X-tal Designs, Box 20620, New York, NY 10025, USA Back


    Acknowledgments
 
The authors thank Dr G.I.Goldberg for providing the cDNA for stromelysin-1. They also thank Dr John Baker for amino acid sequence analyses, Dr Grazyna Galazka for the construction of the plasmid pGXSL-1 for full-length stromelysin-1 and Dr Susan B.LeBlanc for constructing the pGXmini-SL-1 plasmid. Dr Wayne Levin and Elcin Duffy are thanked for their help with purification of stromelysin-1 for crystallization. The expert technical assistance of Greg Harber, Stephanie Hallit and Hoa Trummell is acknowledged. The authors thank Angela C.Hanglow and Alejandro Lugo for the IC50 assays performed on the Ro-26-2812 inhibitor and Drs Nader Fotouhi and Amy Swain for comments on the manuscript. This work was supported by USPHS grants DE08228 (to S.M.Michalek), AR44701 (to L.J.Windsor), DE/CA 11910 (to J.A.Engler) and DE10631 (to J.A.Engler). The synthesis of oligonucleotide primers for site-directed mutagenesis and for DNA sequencing was supported by NCI grant CA-13148 to the UAB Comprehensive Cancer Center.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Abramson,S., Conner,G., Nagase,H., Neuhaus,I. and Woessner,J.F. (1995) J. Biol. Chem., 270, 16016–16022.[Abstract/Free Full Text]

Basset,P. et al. (1990) Nature, 348, 699–704.[Medline]

Becker,J.W. et al. (1995) Protein Sci., 4, 1966–1976.[Web of Science][Medline]

Berman,H.M., Westbrook,J., Feng,Z., Gilliland, G., Bhat,T.N., Weissig,H., Shindyalov,I.N. and Bourne,P.E. (2000) Nucleic Acids Res., 28, 235–242.[Abstract/Free Full Text]

Biggin,M.D., Gibson,T.J. and Hong,G.F. (1983) Proc. Natl Acad. Sci. USA, 80, 3963–3965.[Abstract/Free Full Text]

Birkedal-Hansen,H. (1987) Methods Enzymol., 144, 140–171.[Web of Science][Medline]

Birkedal-Hansen,H. and Taylor,R.E. (1982) Biochem. Biophys. Res. Commun., 107, 1173–1178.[Web of Science][Medline]

Birkedal-Hansen,H., Moore,W.G.I., Bodden,M.K., Windsor,L.J., Birkedal-Hansen,B., DeCarlo,A. and Engler,J.A. (1993) Crit. Rev. Oral Biol. Med., 4, 197–250.[Abstract/Free Full Text]

Bode,W., Gomis-Rüth,F.-X. and Stöcker,W. (1993) FEBS Lett., 331, 134–140.[Web of Science][Medline]

Bradford,M.M. (1976) Anal. Biochem., 72, 248–254.[Web of Science][Medline]

Brünger, A.T., Krukowski, A. and Erickson, J.W. (1990) Acta Crystallogr., A46, 585–93.

Carson,M. (1997) Methods Enzymol., 277, 493–505.[Web of Science][Medline]

Caterina,N.C.M., Windsor,L.J., Yermovsky,A.E., Bodden,M.K., Taylor,K.B., Birkedal-Hansen,H. and Engler,J.A. (1997) J. Biol. Chem., 272, 32141–32149.[Abstract/Free Full Text]

Collaborative Computational Project, Number 4 (1994) Acta Crystallogr., D50, 760–763.

Collier,I.E., Wilhelm,S.M., Eisen,A.Z., Marmer,B.L., Grant,G.A., Seltzer,J.L., Kronberger,A., He,C., Bauer,E.A. and Goldberg,G.I. (1988) J. Biol. Chem., 267, 6579–6587.

Crabbe,T., Zucker,S., Cockett,M., Willenbrock,F., Tickle,S., O'Connell,J.P., Scothern,J.M., Murphy,G. and Docherty,A.J.P. (1994) Biochemistry, 33, 6684–6690.[Medline]

Dhanaraj,V., Ye,Q.-Z., Johnson,L.L., Hupe,D.J., Ortwine,D.F., Dunbar,J.B., Rubin,J.R., Pavlovsky,A., Humblet,C. and Blundell,T.L. (1996) Structure, 4, 375–386.[Medline]

DeClerck,Y.A., Yean,T.D., Lu,H.S., Ting,J. and Langley,K.E. (1991) J. Biol. Chem., 266, 3893–3899.[Abstract/Free Full Text]

Esser,C.K. et al. (1997) J. Med. Chem., 40, 1026–1040.[Web of Science][Medline]

Fotouhi,N., Lugo,A., Visnick,M., Lusch,L., Walsky,R., Coffey,J.W. and Hanglow,A.C. (1994) J. Biol. Chem., 269, 30227–30231.[Abstract/Free Full Text]

Galazka,G., Windsor,L.J., Birkedal-Hansen,H. and Engler,J.A. (1999) Biochemistry, 38, 1316–1322.[Medline]

Gilliland,G.L. and Davies,D.R. (1984) Methods Enzymol., 104, 370–381.[Web of Science][Medline]

Goldberg,G.I., Wilhelm,S.M., Kronberger,A., Bauer,E.A., Grant,G.E. and Eisen,A.Z. (1986) J. Biol. Chem., 261, 6600–6605.[Abstract/Free Full Text]

Goldberg,G.I., Marmer,B.L., Grant,G.A., Eisen,A.Z., Wilhelm,S. and He,C. (1989) Proc. Natl Acad. Sci. USA, 86, 8207–8211.[Abstract/Free Full Text]

Gomis-Rüth,F. et al. (1997) Nature, 389, 77–81.[Medline]

Hangauer,D.G., Monzingo,A.F. and Matthews,B.W. (1984) Biochemistry, 23, 5730–5741.[Medline]

Hasty,K.A., Pourmotabbed,T.F., Goldberg,G.I., Thompson,J.P., Spinella,D.G., Stevens,M. and Mainardi,C.L. (1990) J. Biol. Chem., 265, 11421–11424.[Abstract/Free Full Text]

Jones,T.A. (1982) In Sayre,D. (ed.), Computational Crystallography. Clarendon Press, Oxford, pp. 303–317.

Jones,T.A., Zou,J.Y., Cowan,S.W. and Kjeldgaard,M. (1991) Acta Crystallogr., A47, 110–119.

Kabsch,W. (1976) Acta Crystallogr., A32, 922–923.

Kleywegt,G.J. (1996) Acta Crystallogr., D52, 842–857.

Knauper,V., Lopez-Otin,C., Smith,B., Knight,B. and Murphy,G. (1996) J. Biol. Chem., 271, 1544–1550.[Abstract/Free Full Text]

Knight,C.G., Willenbrock,F. and Murphy,G. (1992) FEBS Lett., 296, 263–266.[Web of Science][Medline]

LeGendre,N. (1990) Biotechniques, 9, 788–805.[Medline]

Lovejoy,B., Hassell,A.M., Luther,M.A., Weigl,D. and Jordan,S.R. (1994) Biochemistry, 33, 8207–8217.[Medline]

Muller,D., Quantin,B., Gesnel,M.-C., Millon-Collard,R., Abecassis,J. and Breathnach,R. (1988) Biochem. J., 253, 187–192.[Web of Science][Medline]

Murshudov,G.N., Vagin,A.A. and Dodson,E.J. (1997) Acta Crystallogr., D53, 240–255.

Navaza,J. (1994) Acta Crystallogr., A50, 157–163.

Okada,Y., Shinmei,M., Tanaka,O., Naka,K., Kimura,A., Nakanishi,I., Bayliss,M.T., Iwata,K. and Nagase,H. (1992) Lab. Invest., 66, 680–690.[Web of Science][Medline]

Pavlovsky,A.G. et al. (1999) Protein Sci., 8, 1455–1462.[Web of Science][Medline]

Perides,G., Charness,M.E., Tanner,L.M., Peter,O., Satz,N., Steere,A.C. and Klempner,M.S. (1998) J. Infect. Dis., 177, 401–408.[Web of Science][Medline]

Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc. Natl Acad. Sci. USA, 74, 5463–5467.[Abstract/Free Full Text]

Sato,H., Takino,T., Okada,Y., Cao,J., Shinagawa,A., Yamamoto,E. and Seiki,M. (1994) Nature, 370, 61–65.[Medline]

Stetler-Stevenson,W.G., Liotta,L.A. and Brown,P.D. (1992) Cancer Treat. Res., 61, 21–41.[Medline]

Studier,F.W. and Moffatt,B.A. (1986) J. Mol. Biol., 189, 113–130.[Web of Science][Medline]

Takino,T., Sato,H., Shinagawa,A. and Seiki,M. (1995) J. Biol. Chem., 270, 23013–23020.[Abstract/Free Full Text]

Van Doren,S.R., Kurochkin,A.V., Ye,Q.-Z., Johnson,L.L., Hupe,D.J. and Zuiderweg,E.R.P. (1993) Biochemistry, 32, 13109–13122.[Medline]

Van Doren,S.R., Kurochkin,A.V., Hu,W., Ye,Q.-Z., Johnson,L.L., Hupe,D.J. and Zuiderweg,E.R.P. (1995) Protein Sci., 4, 2487–2498.[Web of Science][Medline]

Walakovits,L.A., Moore,V.L., Bhardwaj,N., Gallick,G.S. and Lark,M.W. (1992) Arthritis Rheumatism, 35, 35–42.[Web of Science][Medline]

Wilhelm,S., Shao,Z., Housley,T., Seperack,P., Baumann,A., Gunja-Smith,Z. and Woessner,J.F. (1993) J. Biol. Chem., 268, 21906–21913.[Abstract/Free Full Text]

Wilhelm,S.M., Eisen,A.Z., Teter,M., Clark,S.D., Kronberger,A. and Goldberg,G. (1986) Biochemistry, 83, 3756–3760.

Wilhelm,S.M., Collier,I.E., Kronberger,A., Eisen,A.Z., Marmer,B.L., Grant,E.A., Bauer,E.A. and Goldberg,G.I. (1987) Proc. Natl Acad. Sci. USA, 84, 6725–6729.[Abstract/Free Full Text]

Will,H. and Hinzmann,B. (1995) Eur. J. Biochem., 231, 602–608.[Web of Science][Medline]

Windsor,L.J., Grenett,H., Birkedal-Hansen,B., Bodden,M.K., Engler,J.A. and Birkedal-Hansen,H. (1993) Cell-type-specific regulation of SL-1 and SL-2 genes: Induction of SL-2, but not the SL-1, in human keratinocytes in response to cytokines and phorbolesters. J. Biol. Chem., 268, 17341–17347.[Abstract/Free Full Text]

Windsor,L.J., Bodden,M.K., Birkedal-Hansen,B., Engler,J.A. and Birkedal-Hansen,H. (1994) J. Biol. Chem., 269, 26201–26207.[Abstract/Free Full Text]

Windsor,L.J., Steele,D.L., LeBlanc,S.B. and Taylor,K.B. (1997) Biochim. Biophys. Acta, 1334, 261–272.[Medline]

Woessner,J.F.,Jr (1991) FASEB J., 5, 2145–2154.[Abstract]

Received November 15, 1999; revised February 21, 2000; accepted April 12, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
H. Yi, J. Gruszczynska-Biegala, D. Wood, Z. Zhao, and A. Zolkiewska
Cooperation of the Metalloprotease, Disintegrin, and Cysteine-rich Domains of ADAM12 during Inhibition of Myogenic Differentiation
J. Biol. Chem., June 24, 2005; 280(25): 23475 - 23483.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
S. Saffarian, I. E. Collier, B. L. Marmer, E. L. Elson, and G. Goldberg
Interstitial Collagenase Is a Brownian Ratchet Driven by Proteolysis of Collagen
Science, October 1, 2004; 306(5693): 108 - 111.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. V. Rozanov, E. I. Deryugina, B. I. Ratnikov, E. Z. Monosov, G. N. Marchenko, J. P. Quigley, and A. Y. Strongin
Mutation Analysis of Membrane Type-1 Matrix Metalloproteinase (MT1-MMP). THE ROLE OF THE CYTOPLASMIC TAIL CYS574, THE ACTIVE SITE GLU240, AND FURIN CLEAVAGE MOTIFS IN OLIGOMERIZATION, PROCESSING, AND SELF-PROTEOLYSIS OF MT1-MMP EXPRESSED IN BREAST CARCINOMA CELLS
J. Biol. Chem., July 6, 2001; 276(28): 25705 - 25714.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (11)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Steele, D. L.
Right arrow Articles by Birktoft, J.J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Steele, D. L.
Right arrow Articles by Birktoft, J.J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?