Protein Engineering, Vol. 13, No. 7, 515-518,
July 2000
© 2000 Oxford University Press
Engineering the active center of the 6-phospho-ß-galactosidase from Lactococcus lactis
Arbeitsgruppe Physiologie der Mikroorganismen, Department of Biology, Ruhr-Universität Bochum, D- 44780 Bochum, Germany
| Abstract |
|---|
|
|
|---|
Several amino acids in the active center of the 6-phospho-ß-galactosidase from Lactococcus lactis were replaced by the corresponding residues in homologous enzymes of glycosidase family 1 with different specificities. Three mutants, W429A, K435V/Y437F and S428D/ K435V/Y437F, were constructed. W429A was found to have an improved specificity for glucosides compared with the wild-type, consistent with the theory that the amino acid at this position is relevant for the distinction between galactosides and glucosides. The kcat/Km for o-nitrophenyl-ß-D-glucose-6-phosphate is 8-fold higher than for o-nitrophenyl-ß-D-galactose-6-phosphate which is the preferred substrate of the wild-type enzyme. This suggests that new hydrogen bonds are formed in the mutant between the active site residues, presumably Gln19 or Trp421 and the C-4 hydroxyl group. The two other mutants with the exchanges in the phosphate-binding loop were tested for their ability to bind phosphorylated substrates. The triple mutant is inactive. The double mutant has a dramatically decreased ability to bind o-nitrophenyl-ß-D-galactose-6-phosphate whereas the interaction with o-nitrophenyl-ß-D-galactose is barely altered. This result shows that the 6-phospho-ß-galactosidase and the related cyanogenic ß-glucosidase from Trifolium repens have different recognition mechanisms for substrates although the structures of the active sites are highly conserved.
Keywords: glycosidase family 1/6-phospho-ß-galactosidase/protein engineering/site-directed mutations/substrate specificity
| Introduction |
|---|
|
|
|---|
Lactococcus lactis and many other Gram-positive bacteria take up lactose via the phosphoenol pyruvate-dependent phosphotransferase system. During translocation lactose is phosphorylated at position 6 of its galactose moiety. The resulting lactose-6-phosphate (Lac-6P) is then hydrolyzed by the enzyme 6-phospho-ß-galactosidase (PBGAL) into glucose and galactose-6-phosphate (Gal-6P), which are further degraded via glycolysis and the tagatose pathway, respectively (Hengstenberg et al., 1967
Glycoside hydrolases have been classified into 70 families based on sequence similarities (Henrissat, 1991
; Henrissat and Bairoch, 1996). The PBGALs have been assigned to glycosidase family 1. This family comprises mainly ß-glucosidases, 6-phospho-ß-galactosidases, 6-phospho-ß-glucosidases, lactasephlorizin hydrolases and myrosinases. So far, the crystal structures of five enzymes have been solved, including those of PBGAL from Lactococcus lactis (Wiesmann et al., 1995
) (PDB entry 1PBG) and of cyanogenic ß-glucosidase from Trifolium repens (Barrett et al., 1995
) (PDB entry 1CBG).
The overall structure is highly conserved. All enzymes have the TIM-barrel fold with insertions at the carboxy ends of the ß-strands. Two acidic amino acids at the carboxy ends of the fourth and seventh strands of the (ß
)8-barrel act as general acid/base and nucleophile/leaving group, respectively. The family 1 glycosidases are retaining hydrolases. The nucleophile of the PBGAL from Staphylococcus aureus has been identified by labeling with a substrate analog (Staedtler et al., 1995
).
As one of the crystal structures of PBGAL from L.lactis is a complex with Gal-6P, the identity of the amino acids involved in substrate binding has been concluded from possible hydrogen bonds with Gal-6P (Wiesmann et al., 1997
) (Figure 1
). The active center is in a cavity in the center of the barrel. A long channel connects it with the solvent. Two loops at the entrance of this channel are mobile and close after substrate binding. The cyanogenic ß-glucosidase from T.repens shows 33% sequence identity with PBGAL. The structural homology covers the entire TIM barrel; major deviations occur only at residues 308330 near to the channel entrance. All residues of PBGAL contacting the galactose are conserved in the glucosidase. The phosphate-binding loop has the same overall conformation, but the phosphate-binding residues S428, K435 and Y437 of PBGAL are replaced by D, V and F, respectively. The three 6-phospho-ß-glucosidases of family 1 contain an alanine instead of W429 of the PBGAL.
|
These conserved differences were taken as the basis for mutations of the PBGAL of L.lactis in this work. The mutant enzymes W429A, K435V/Y437F and S428D/K435V/Y437F were tested to determine substrate specificity in family 1 glycosidases.
| Materials and methods |
|---|
|
|
|---|
Materials
Restriction enzymes with corresponding buffers were purchased from MBI Fermentas. All the chromatographic resins were purchased from Pharmacia Biolabs (Uppsala, Sweden). Protein assay reagents and SDSPAGE reagents were purchased from Bio-Rad Laboratories (Hercules, CA). o-Nitrophenyl-ß-D-galactoside (ONPG), o-nitrophenyl-ß-D-glucoside (ONPGlc), p-nitrophenyl-ß-D-galactoside (PNPG) and p-nitrophenyl-ß-D-glucoside (PNPGlc) were purchased from Sigma Chemicals (St. Louis, MO). Synthetic oligonucleotides were purchased from Life Technologies (Karlsruhe, Germany). Additional materials were obtained either from Merck (Darmstadt, Germany) or Serva.
Plasmid construction and cloning
The mutations were introduced by cloning the lacG gene from L.lactis from the plasmid pNZ316 (de Vos and Gasson, 1989
) in bacteriophage M13mp18 for the mutation W429A and in the vector pUC19 for the mutations K435V/Y437F and S428D/K435V/Y437F. The mutation W429A was introduced by using the Eckstein method (Olson and Eckstein, 1990
). The primer used was GGACGTTTTCTCAGTCAAATGG. Base replacements are underlined. The mutations S428D/K435V/Y437F and K435V/Y437V were introduced by PCR by using the Megapriming method (Landt et al., 1990
). The primers used were GGACGTTTTCTGGTCAAATG and GTTATGAAACGTTTGGATTGTTC. Mutations were confirmed by DNA sequencing. For overexpression, the fragment containing the mutation W429A was cloned in the vector pUC20 by restriction with PstI and XbaI. All other mutated genes were cloned in the vector pKS+ by restriction with HindIII and KpnI.
Protein expression and purification
Escherichia coli K12 TG1 (Gibson, 1984
) were transformed with the newly constructed plasmids and grown in 2 l of LuriaBertani medium with 50 µg/ml ampicillin at 37°C. The expression was induced by addition of 0.5 mM IPTG at an OD600 of 0.9. After 4 h the cells were collected by centrifugation at 6000 g for 20 min. The cell pellet was resuspended in 20 ml of purification buffer (50 mM TrisHCl, pH 7.5, 0.1 mM dithiothreitol, 0.1 mM EDTA, 0.1 mM PMSF and 0.1 mM NaN3). Cells were disrupted by sonication in a Sonifier B12 (Branson). Cell lysate was collected by centrifugation at 25 000 g for 45 min. The enzymes were purified as described previously (Wiesmann et al., 1995
).
Substrate synthesis
The nitrophenylated galactosides and glucosides listed in Materials were phosphorylated at C-6 according to Hengstenberg and Morse (1969).
Enzyme kinetics
Different nitrophenylated galactosides and glucosides phosphorylated at C-6 were tested as substrates for the mutant enzymes and the wild-type enzyme. Protein concentrations were determined as described by Bradford (1976). PBGAL activity was assayed by measuring the production of o-nitrophenolate or p-nitrophenolate at 405 nm using a Pharmacia Biochrom 4060 spectrophotometer. The initial rates of hydrolysis were determined at room temperature in 0.1 M sodium phosphate buffer, pH 7.5, and substrate concentrations ranging from 0.04 to 2 mM. Aliquots of 7.5 µg of both wild-type and mutant enzymes were used in the assay mixture. All assays were made in duplicate and the data were analyzed with the Origin program (Microcal, Northampton, MA, USA). Extinction coefficients are 4.8 cm2/µmol for o-nitrophenolate and 18.5 cm2/µmol for p-nitrophenolate.
The change of transition-state binding energy [
(
G)] for substrate hydrolysis caused by the mutation, which was used to estimate the contributions of the relevant interactions of the substrate with the active center to the binding strength in the transition-state complex, was calculated by the equation
, where the subscripts mut and wt refer to mutant and wild-type enzymes, respectively (Fang and Ford, 1998
).
Other analytical procedures
The conformation of the amino acid side chains in the mutant enzymes was calculated by using the program WhatIf (Vriend, 1990
). The resulting pdb files can be obtained from the authors. The presentations of the models were made with RasMol 2.6.
| Results |
|---|
|
|
|---|
Construction, overexpression and purification of the mutant enzymes
The point mutant W429A of the 6-phospho-ß-galactosidase from L.lactis was constructed by mutagenesis by the Eckstein method. In the crystal structure, Trp429 is the only amino acid within hydrogen-bonding distance of the C-4 hydroxyl group of the galactose (Wiesmann et al., 1995
). The double and triple mutants K435V/Y437F and S428D/K435V/Y437F were constructed by PCR by the megapriming method. These amino acids are involved in contacts with the phosphate group of galactose-6-P. The mutations were confirmed by DNA sequencing.
All mutant enzymes were overexpressed in E.coli TG1 and purified to homogeneity, according to SDSPAGE (data not shown). Each of these purified enzymes showed a single band and the same mobility as that of the wild-type. The level of expression of W429A was comparable to that of the wild-type; about 20 mg of pure protein were obtained from 1 l of Escherichia coli culture. For both K435V/Y437F and S428D/K435V/Y437F much lower yields were obtained, resulting in 4 and 0.6 mg/l, respectively.
Kinetic properties of mutant enzymes
The kcat and Km values of the purified enzymes for different galactosides and glucosides were determined and compared with those of the wild-type enzyme (Table I
). The hydrolysis was measured photometrically.
|
The optimal substrate for the wild-type PBGAL was ONPG-6-P. o-Nitrophenylated substrates were preferred to the p-nitrophenylated substrates and galactosides had higher kcat/Km than glucosides. The unphosphorylated ONPG had a kcat which was decreased by a factor of 80 compared with that of ONPG-6-P.
S428D/K435V/Y437F had no detectable activity for any of the substrates tested. The double mutant K435V/Y437F had an increased Km for ONPG as well as an increased kcat, which resulted in a kcat/Km which was decreased by a factor of only 1.2 compared with the wild-type. The Km for ONPG-6-P was increased almost 10-fold and the kcat was reduced by a factor of 30. This mutant therefore had a higher catalytic efficiency for the unphosphorylated than for the phosphorylated substrate. The large decrease in transition-state energy for ONPG-6-P indicated that the mutations significantly destabilized the binding in the transition-state, whereas the binding of ONPG was almost not affected (Table I
).
W429A had a different specificity for the sugar moiety compared with the wild-type. Glucosides were the preferred substrates. The kcat/Km for ONPGlc-6-P was 7.6-fold higher than that for ONPG-6-P. o-Nitrophenylated substrates were preferred, analogous to the wild-type. Compared with the wild-type, the kcat/Km of ONPGlc-6-P decreased 20.5-fold and those of ONPG-6-P, PNPGlc-6-P and PNPG-6-P were 937-, 20.5- and 2414-fold lower, respectively. The differences in transition-state energies were almost the same for glucosides and also almost the same for galactosides, which proves that these differences depend only on the carbohydrate. The
(
G) for glucosides was 7.53 kJ/mol and the
(
G) for the two galactosides was 17.08 and 19.36 kJ/mol, respectively. These results suggest that the mutated Trp429 is indeed crucial for the interaction with the C-4 hydroxyl group of galactose.
| Discussion |
|---|
|
|
|---|
We succeeded in identifying several structurally important residues for the specificity of 6-phospho-ß-galactosidase from L.lactis. The natural substrate is lactose-6-phosphate. The enzyme is specific for galactosides which are phosphorylated at C-6. Based on homology with 6-phospho-ß-glucosidases and ß-glucosidases from family 1 of glycosidases, we selected the four amino acids Trp429, Ser428, Lys435 and Tyr437 which were proposed to determine the specificity. To assess the functions of these individual amino acids, we constructed several point mutants. This enabled us to obtain a deeper insight into the binding mechanism of the enzyme.
The phosphate group interacts in the wild-type enzyme with Ser428 and Tyr437 via hydrogen bonds and Lys435 via a salt bridge. Thus, specificity for phosphorylated substrates is achieved. Compared with the PBGAL, the cyanogenic ß-glucosidase from T.repens has the same overall conformation of the phosphate-binding loop, but the phosphate-binding residues are replaced. We constructed the double mutant K435V/Y437F and the triple mutant S428D/K435V/Y437F to mimic the environment of the loop in the ß-glucosidase in order to find out whether we could produce an enzyme with improved specificity for unphosphorylated substrates. The double mutant had a higher catalytic efficiency for unphosphorylated than for phosphorylated substrates. This was not the result of new interactions with the substrates but rather radically diminished stabilization of the bound substrate. Better interactions would have increased the catalytic efficiency when compared with the wild-type enzyme. The relevant interactions of the mutant with the galactose were only marginally affected, as seen in the transition-state energy. This energy was lowered by only 0.54 kJ/mol for ONPG. The model (Figure 2
) for the mutant supports the assumption that the interaction with the galactose moiety is not altered as the conformation of the other amino acids in the active center is not affected. This is consistent with the kinetic data for ONPG since this substrate does not have any interactions with the phosphate-binding loop either in the wild-type or in the mutant. The transition-state energy for ONPG-6-P was radically decreased by 13.96 kJ/mol. This indicates that the stabilizing interactions with the mutated side-chains were abolished, but were not replaced by new interactions which were expected in analogy with the ß-glucosidase.
|
This mutation permits the evaluation of the stabilizing energy gained by the interaction of the phosphate group and the side chains of Lys435 and Tyr437. The substitution of all three amino acids in the mutant S428D/K435V/Y437F resulted in the complete loss of enzyme activity. As seen in the model, there is steric hindrance between the longer side chain of the aspartate and the substrate. According to these data, the main difference between the ß-glucosidase and the 6-phospho-ß-galactosidase is not caused by the difference in the phosphate-binding loop but rather in the loops near the channel entrance. The 6-phospho-ß-galactosidase is supposed to have mobile loops, thereby assuming a closed conformation after substrate binding as predicted from the crystal data (Wiesmann et al., 1997
In the wild-type structure, the C-4 hydroxyl group of the galactose is within hydrogen-bonding distance only of Trp429 (Wiesmann et al., 1995
). An additional intramolecular hydrogen bond of this hydroxyl group with the phosphate group stabilizes the substrate in the optimal conformation for hydrolysis. The mutant W429A had a higher catalytic efficiency for glucosides than for galactosides. All the kcat/Km were lower than those of the wild-type, but those for the galactosides were significantly smaller than those for the glucosides. The differences in transition-state energy between the wild-type and the mutant for the galactosides indicate that two hydrogen bonds could no longer be formed, assuming that one hydrogen bond contributes ~8 kJ/mol (Namchuk and Withers, 1995
).
The model (Figure 3
) for the mutant supports the assumption that the conformation of the other amino acids in the active center was unaffected by the mutation. As the difference for
(
G) was only 7.53 kJ/mol for glucosides, we propose that a new hydrogen bond is formed between the equatorial hydroxyl group and the amino acids in the active center, presumably with Gln19 or Trp421. This new bond partly compensates the loss of hydrogen bonds between Trp429 and the substrate as well as the intramolecular hydrogen bond. The movement of the sugar towards the nucleophile Glu375 during catalysis is sterically hindered for glucosides by the equatorial C-4 hydroxyl group in the wild-type enzyme. This interference is diminished in the mutant. A similar interaction between the active center of the 6-phospho-ß-glucosidases and the substrates can be assumed. The results support the theory that the amino acid at the position 429 in the 6-phospho-ß-galactosidase is relevant for the distinction between glucosides and galactosides.
|
Most recent studies which are concerned with point mutations in glycosidases concentrate on improvements in thermostability (Fierobe et al., 1996
Site-directed mutagenesis has clarified that the differences in specificity between the 6-phospho-ß-galactosidase from L.lactis and the ß-glucosidase from T.repens do not result from interactions with single amino acids in the phosphate-binding loop but probably from differences in sequences near the channel entrance. Also, we have succeeded in creating the mutant W429A with an improved specificity for glucosides. These findings will provide useful ideas for the design of enzymes with new properties.
| Notes |
|---|
1 To whom correspondence should be addressed. E-mail: wolfgang.hengstenberg{at}ruhr-uni-bochum.de
| Acknowledgments |
|---|
This research was supported by the Graduiertenkolleg Biogenese und Mechanismen komplexer Zellfunktionen of the Deutsche Forschungsgemeinschaft.
| References |
|---|
|
|
|---|
Barrett,T., Suresh,C.G., Dodson,E.F. and Hughes,M.A. (1995) Structure, 3, 951960.[Medline]
Bisset,D.L. and Anderson,R.L. (1973) Biochem. Biophys. Res. Commun., 52, 641647.[Web of Science][Medline]
Bradford,M.M. (1976) Anal. Biochem., 72, 248254.[Web of Science][Medline]
de Vos,W.M. and Gasson,M.J. (1989) J. Gen. Microbiol., 135, 18331846.
Fang,T.Y. and Ford,C. (1998) Protein Eng., 11, 383388.
Fierobe,H.P., Stoffer,B.B., Frandsen,T.P. and Svensson,B. (1996) Biochemistry, 35, 86968704.[Medline]
Gibson,T.J. (1984) PhD Thesis, University of Cambridge.
Hengstenberg,W. and Morse,M.L. (1969) Carbohydr. Res., 10, 463465.
Hengstenberg,W., Egan,J.B. and Morse,M.L. (1967) Proc. Natl Acad. Sci. USA, 58, 274279.
Henrissat,B. (1991) Biochem. J., 280, 309316.
Henrissat,B. and Bairoch,A. (1993) Biochem. J., 293, 781788.
Landt,O., Grunert,H.P. and Hahn,U. (1990) Gene, 96, 125128.[Web of Science][Medline]
Namchuk,M.N. and Withers,S.G. (1995) Biochemistry, 34, 1619416202.[Medline]
Olson,B.O. and Eckstein,F. (1990) Proc. Natl Acad. Sci. USA, 87, 14511455.
Staedtler,P., Hoenig,S., Frank,R., Withers,S.G. and Hengstenberg,W. (1995) Eur. J. Biochem., 232, 658663.[Web of Science][Medline]
Stoffer,B.B., Dupont,C., Frandsen,T.P., Lehmbeck,J. and Svensson,B. (1997) Protein Eng., 10, 8187.
Vriend,G. (1990) J. Mol. Graphics, 8, 5256.[Web of Science][Medline]
Wiesmann,C., Beste,G., Hengstenberg,W. and Schulz,G.E. (1995) Structure, 3, 961968.[Medline]
Wiesmann,C., Hengstenberg,W. and Schulz,G.E. (1997) J. Mol. Biol., 269, 851860.[Web of Science][Medline]
Received February 15, 2000; revised May 12, 2000; accepted May 17, 2000.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


