Protein Engineering, Vol. 14, No. 11, 903-909,
November 2001
© 2001 Oxford University Press
The mouse guanylate kinase double mutant E72Q/D103N is a functional adenylate kinase
Department of Pharmaceutical Sciences, P.O. Box 646534, Washington State University, Pullman, WA 99164-6534, USA
| Abstract |
|---|
|
|
|---|
Guanylate kinase catalyzes the phosphorylation of either GMP to GDP or dGMP to dGDP and is an important enzyme in nucleotide metabolic pathways. Because of its essential intracellular role, guanylate kinase is a target for a number of cancer chemotherapeutic agents such as 6-thioguanine and 8-azaguanine and is involved in antiviral drug activation. Guanylate kinase shares a similarity in function and structure to other nucleoside monophosphate kinases especially with that of the well-studied adenylate kinase. Amino acid substitutions were made within the GMP binding site of mouse guanylate kinase to alter the polarity of the side chains that interact with GMP as a means of evaluating the role that these residues play on substrate interaction. One of these mutants, E72Q/D103N, was shown by functional complementation and enzyme assays to embody both guanylate kinase activity and a novel adenylate kinase activity.
Keywords: adenylate kinase/genetic complementation/guanylate kinase/site-directed mutagenesis
| Introduction |
|---|
|
|
|---|
Guanylate kinase (GMK, ATP:GMP phosphotransferase, EC 2.7.4.8) catalyzes the reaction (d)GMP + ATP
(d)GDP + ADP, where (d)GMP indicates GMP or dGMP (Woods and Byrant, 1991
GMP
GDP
GTP
cGMP). This latter activity is thought to regulate the supply of guanosine nucleotides to signal transduction pathway components (Woods and Byrant, 1991
Guanylate kinase closely resembles the enzyme reaction and biological functions of another small nucleotide metabolizing enzyme, adenylate kinase (ADK), an enzyme responsible for the phosphorylation of (d)AMP. There are also remarkable similarities at the X-ray structural level (Muller and Schulz, 1992
; Stehle and Schulz, 1992
). One key difference is in the active site. In the structure of yeast GMK, the only GMK structure available, the guanine binding site is rather polar. Two charged residues, E69 and D100, are the main contributors to this polarity. In ADK, the residues that interact with adenine at the same relative position are non-polar. It has been postulated that the charge differences between these two active sites dictates the substrate utilization of the respective enzyme (Stehle and Schulz, 1992
). To examine this, we replaced the residues E72 and D103 in mouse GMK (corresponding to E69 and D100 in yeast GMK) with glutamine and asparagine residues, respectively, individually and as a double mutant and compared the properties of the mutant GMKs with those of the wild-type GMK and ADK.
| Materials and methods |
|---|
|
|
|---|
Bacterial and yeast strains
Escherichia coli strain NM522 [F' lacIq
(lacZ)-M15proA+B+/supE thi
(lac-proAB)
(hsdMS-mcrB)5(rk-mk-McrBC-)] was used as a recipient for certain cloning procedures. Escherichia coli strain CJ236 (F+ LAM-, ung-1, relA1, dut-1, spoT1, thi-1) was used to produce single-stranded DNA for site-directed mutagenesis. Escherichia coli strain CV2 [fhuA22,
phoA8, adk-2(ts), ompF627(T2R), fadL701, relA1, glpR2(Const), glpD3, pit-10 spoT1] was used for adenylate kinase complementation experiments. E.coli CV2 was obtained from the E.coli Genetic Stock Center. Saccharomyces cerevisiae strain NE759.11D, a gift from Dr Yoh-ichi Shimma (National Institute of Bioscience and Human Technology, Japan) [MATa, guk1 (= nes25-1) leu2 ura3 met3 ade8 his3] was used for guanylate kinase complementation experiments. BL21(DE3) tdk- {F- ompT[lon] hsdSb (rB-mB-) gal dcm met (DE3)} was used for pETHT vector constructs and protein overexpression. Escherichia coli strain SY211, a gift from Dr William Summers (Yale University), is BL21(DE3) tdk- carrying pLysS (Novagen) and was used for expression from the pETHT:D103N construct.
Materials
Restriction endonucleases and T4 DNA ligase were purchased from Gibco BRL or New England Biolabs. Oligonucleotides used for site-directed mutagenesis and DNA sequencing were obtained from Operon or Genset. Enzyme assay reagents and other chemicals were purchased from Sigma except where designated otherwise. Adenylate kinase from rabbit muscle was also obtained from Sigma (2180 U/mg, where 1 U is defined as the conversion of 2 µmol of ADP to ATP and AMP per minute at 37°C). Nickel columns (Ni-NTA Spin Kit) used to purify wild-type and mutant guanylate kinases were purchased from Qiagen.
Construction of guanylate kinase mutants
pYX212:mgmk was used as a starting point for site-directed mutagenesis. The mouse gmk cDNA was subcloned from pET23d:mgmk into pYX212 as an NcoI/HinDIII fragment (Brady et al., 1996
). The E.coliyeast shuttle vector contains a TPI constitutive promoter (Ingenius R & D Systems). The oligonucleotide, 5' CTCAGCATGTTGAATGAAGTCC 3', introduces the E72Q mutation and corresponds to a loss of a unique SphI site. The oligonucleotide 5' CCTTGTAGGTTGACATCTAGC 3' introduces the D103N mutation and corresponds to a loss of a SalI site. Site-directed mutagenesis was carried out as described by Kunkel (1985). Mutations were identified by loss of either the SalI site (D103N) or the SphI site (E72Q). The resulting mutant sequences were confirmed and the plasmids were designated pYX212:E72Q and pYX212:D103N. pYX212:D103N was used as the template for a second site-directed mutagenesis to introduce the E72Q mutation. The resulting sequence was confirmed and the plasmid was designated pYX212:E72Q/D103N.
Vector constructs
For genetic complementation of bacteria, the wild-type and mutant guanylate kinase genes were subcloned as an NcoI/HinDIII fragment into pBADB (Invitrogen). The E.coli expression vector pBADB contains an arabinose inducible promoter. These were designated pBAD:mgmk, pBAD:E72Q, pBAD:D103N and pBAD:E72Q/D103N. All constructs were confirmed by sequencing.
For overexpression, the NcoI/BamHI fragment from either pBADB:mgmk, pBAD:E72Q or pBAD:E72Q/D103N was subcloned into pETHT (Brady et al., 1996
). The resulting plasmids were designated pETHT:mgmk, pETHT:E72Q and pETHT:E72Q/D103N. The sequence of each subclone was confirmed.
The pETHT:D103N vector was constructed by using pETHT:E72Q/D103N as a template for site-directed mutagenesis to reverse the E72Q mutation. The oligonucleotide used for this reversal was 5' CTCAGCATGCTCAATGAAGTCC 3' and results in the re-introduction of the SphI site. The resulting plasmid was designated pETHT:D103N and was confirmed by sequencing.
Genetic complementation media
Yeast transformants were grown in complete minus uracil medium (c-ura; 6.7 g yeast nitrogen base without amino acids, 1.92 g synthetic drop out medium minus uracil and 2% glucose per liter). For bacterial complementation studies, M9ZB [10 g Difco tryptone, 5 g NaCl, diluted to 889 ml with water then 100 ml 10x M9 salts (30 g KH2PO4, 67.8 g Na2HPO4, 5 g NaCl, 10 g NH4Cl), 1 ml 1 M MgSO4, 100 µl 1 M CaCl2 and 10 ml 20% glucose added per liter] containing carbenicillin at 50 µg/ml was supplemented with 0.2% arabinose to induce expression from the pBAD vector. The temperatures for permissive and non-permissive conditions for both plate and broth cultures were established using the appropriate controls.
Overexpression of guanylate kinase in E.coli
pETHT:mgmk, pETHT:E72Q and pETHT:E72Q/D103N were electroporated into competent E.coli BL21(DE3) tdk- cells. pETHT:D103N was electroporated into E.coli SY211 to prevent leaky expression. We found it necessary to use tight regulation of gene expression when using pETHT:D103N to prevent genetic rearrangements from occurring. This was not a problem with D103N expressed from pYX212 or pBADB. Bacterial strains used for overexpression were grown at 37°C in M9ZB. Induction of these strains with 0.4 mM isopropyl-1-thio-ß-D-galactopyranoside (IPTG) for 3 h was performed by the method of Studier et al. (Studier et al., 1990
) as described in the pET System Manual (Novagen).
Enzyme purification
Following induction by IPTG, the Qiagen Ni-NTA Spin Kit was used to purify protein under native conditions from 50 ml of culture as according to the manufacturer. The lysis buffer was prepared with 10 mM imidazole, the wash buffer with 20 mM imidazole and the elution buffer with 250 mM imidazole. Protein concentrations were quantitated by the Bradford method using reagents supplied by Bio-Rad. Known concentrations of bovine serum albumin were used to generate a calibration curve.
Spectrophotometric assays for guanylate kinase and adenylate kinase activities
Enzyme activity was measured using a lactate dehydrogenasepyruvate kinase coupled assay as described by Agarwal et al. (Agarwal et al., 1978
) for guanylate kinase activity and by Reinstein et al. (Reinstein et al., 1988
) for adenylate kinase activity. The change in A340 was measured over time at 25°C using a Bio-Rad Smart Spec 3000. This monitors the forward reaction of ATP + G(A)MP to 2G(A)DP.
| Results |
|---|
|
|
|---|
Genetic complementation
To examine the ability of the wild-type or mutant guanylate kinases to complement a temperature-sensitive guanylate kinase yeast strain, NE759.11D (gmkts) cells (Shimmaet al., 1997
) were transformed by electroporation with either pYX212, pYX212:mgmk, pYX212:E72Q, pYX212:D103N or pYX212:E72Q/D103N and transformants were selected on complete minus uracil medium (c-ura). Individual colonies were picked and streaked on to c-ura medium and grown at permissive (28°C) or non-permissive (39.7°C) temperatures. The ability of transformants to grow at the non-permissive temperature indicates that the transformant expresses functional guanylate kinase activity. Figure 1
shows that at the permissive temperature all transformats grew as expected. Under non-permissive conditions, pYX212 (vector only) was not able to complement the gmk-deficient yeast. Whereas the wild-type mgmk, D103N and E72Q/D103N constructs clearly complement, pYX212:E72Q displays low or marginal guanylate kinase activity.
|
A temperature-sensitive adenylate kinase E.coli strain, CV2, was transformed with either pBAD, pBAD:mgmk, pBAD:E72Q, pBAD:D103N, pBADB:E72Q/D103N or pEAK90, a control vector containing the gene for E.coli adenylate kinase (Reinstein et al., 1988
|
|
Growth curves
Yeast gmkts (NE759.11D) cells harboring pYX212, pYX212:mgmk, pYX212:E72Q, pYX212:D103N or pYX212:E72Q/D103N were used to inoculate 5 ml of c-ura and were grown for 2 days at 28°C. A 50 ml volume of c-ura was inoculated with the culture to reach an OD600 of
0.15. Cultures were then grown at either 25 or 39.7°C and monitored for growth by reading the OD600 every 3060 min. The results of representative growth curves at permissive and non-permissive temperatures are shown in Figure 3
. The growth experiments were repeated with similar results. At the permissive temperature all cultures grew although those without guanylate kinase (vector alone) or mutant guanylate kinase grew less well than the wild-type expressing transformant. Under restrictive conditions only the wild-type and D103N mutant grew. Their growth was at a substantially reduced rate compared with growth at the permissive temperature. These results suggest that even a reduced amount of plasmid-expressed guanylate kinase activity enhances growth of the gmkts strain.
|
Bacterial adkts CV2 transformants harboring pBAD, pBAD:mgmk, pBAD:E72Q, pBAD:D103N, pBAD:E72Q/D103N or pEAK90 were used to inoculate 5 ml of M9ZB containing carbenicillin and arabinose broth and were grown overnight at 28°C. A 50 ml volume of M9ZB containing carbenicillin and arabinose broth was inoculated with enough overnight culture to reach an OD600 of
0.1. Cultures were grown at either 28 or 38.5°C and monitored for growth by reading the OD600 every 30 min. The results of representative growth curves at permissive and non-permissive temperatures are shown in Figure 4
|
Protein expression and purification
Induction of pETHT constructs with IPTG led to high levels of protein expression. Proteins were purified under native conditions according to the Qiagen Ni-NTA Spin Kit directions. A small sample (1 µg) of each purified protein was loaded on to a 15% polyacrylamideSDS containing gel. All proteins were purified to near homogeneity.
Enzyme assays
To extend the complementation studies and growth curve results, we sought to assay the purified enzymes for guanylate kinase and adenylate kinase activity directly. As shown in Figure 5
, the ability of the mutant guanylate kinases (E72Q, D103N and E72Q/D103N) to phosphorylate GMP was quite altered with respect to the wild-type GMK. All assays were performed at least twice and the averages plotted. Table II
shows the specific activity of the mutant and wild-type enzymes calculated from the graphs in Figures 5 and 6![]()
. At enzyme and substrate concentrations at which the wild-type GMK demonstrated high activity, only D103N displayed moderate activity at 28.6% that of wild-type. This is reflected in the 5-fold reduction in specific activity observed between D103N and wild-type mgmk (Table II
). When 10-fold more enzyme and 100-fold more GMP were used in the assay, E72Q and E72Q/D103N demonstrated fair activity while commercially purchased adenylate kinase did not (Figure 5B
and Table II
). From these results, the enzymes assayed can be ranked according to their GMK activity from highest to lowest as follows: wild-type GMK > D103N > E72Q/D103N > E72Q > ADK.
|
|
|
Adenylate kinase assays were performed according to the method of Reinstein et al. (Reinstein et al., 1988
Molecular model
Taken from the crystal structure determinations of yeast guanylate kinase and E.coli adenylate kinase (Muller and Schulz, 1992
; Stehle and Schulz, 1992
), Figure 7
displays the relevant and corresponding residues (mouse guanylate kinase designations) that interact with the respective nucleotides. The E69 side chain of yeast guanylate kinase (E72 in mgmk) forms interactions with the N1 and N11 of guanine and also with S80 of yeast guanylate kinase (T83 in mgmk) (Figure 7B
). This corresponds to Q92 of adenylate kinase and its interactions with N1 and N10B of adenine and adenylate kinase residues D61 and R88 (Figure 7A
). The guanine N3 and N11 form hydrogen bonds with the backbone of D100 in yeast guanylate kinase (D103 in mgmk) whereas the corresponding V59 of adenylate kinase interact with N3B of adenine. In the double mgmk mutant, interactions between guanylate and E72Q and D103N are presumably positioned in the same fashion as with the wild-type gmk (Figure 7D
). As the backbone of D103 forms hydrogen bonds with N3 and N11 of the guanine ring, this interaction is not dependent upon the specific side chain. When adenylate is placed in the context of the guanylate kinase active site containing the E72Q and D103N mutations, the interactions in Figure 7C
are postulated.
|
| Discussion |
|---|
|
|
|---|
Guanylate kinase plays a key role in generating GDP and dGDP, precursors for RNA and DNA metabolism, respectively. Furthermore, guanylate kinase participates in the recovery of cGMP and therefore is thought to regulate nucleotide supplies in signal transduction pathways (Woods and Byrant, 1991
Guanylate kinase is very similar to adenylate kinase at a catalytic and structure level, although there is very little primary amino acid sequence homology. Comparisons of the crystal structure of the yeast guanylate kinase and the E.coli adenylate kinase reveal some distinct differences in how the respective nucleoside monophosphate binds in each enzyme (Boehme, 1984
; Muller and Schulz, 1992
). One major distinction between these enzymes is that the guanine moiety is bound by two carboxyl groups whereas no such group binds to adenine (Stehle and Schulz, 1992
). Stehle and Schulz (1992) postulated that the polarity contributed by the carboxyl groups of E69 and D100 in the yeast gmk may be responsible for the substrate specificity differences displayed by guanylate kinase and adenylate kinase. In this paper, we describe the changes in substrate utilization that occur by changing the charge of E72 and D103 in the active site of mouse guanylate kinase.
Guanylate kinase activity
Using site-directed mutagenesis, we introduced substitutions to create the mutants E72Q and D103N and the double mutant E72Q/D103N in mouse guanylate kinase. To determine whether the mutations introduced resulted in loss of guanylate kinase activity, we established a complementation system in which the wild-type mouse gmk functionally complements a yeast temperature-sensitive gmk strain under non-permissive conditions. To our knowledge, this is the first report that a mammalian gmk has been shown to replace functionally yeast guanylate kinase activity. In complementation studies the rate of yeast growth in broth cultures under permissive temperatures (28°C) appears roughly to correlate with the amount of guanylate kinase activity displayed by the individual enzymes (Tables I and II![]()
). Cells harboring the vector alone grew very slowly and slightly slower than those with E72Q and E72Q/D103N whereas cells containing D103N and wild-type gmk grew substantially faster. However, in contrast to the plate complementation results, only the wild-type and D103N grew under restrictive conditions. One possibility is that the temperature range for permissive growth for this yeast strain is rather narrow and the technical inability to control the temperature closely may be responsible for the inconsistent results between the plate and culture experiments. More likely is that growth in broth cultures is more stringent than growth on plates in the complementation assays. The time allowed for complementation on plates is 2 days compared with the short duration (several hours) of the broth cultures. This time differential may be responsible for the lack of apparent growth in broth cultures at non-permissive temperatures.
When purified enzymes were assayed for guanylate kinase activity with 100 µM GMP and 11 µg of enzyme, wild-type gmk displayed high activity and D103N demonstrated moderate activity at around 29% of the wild-type activity (Figure 5
). E72Q, E72Q/D103N and adenylate kinase had background levels of gmk activity. Some gmk activity was observed with E72Q and E72Q/D103N, but not with adenylate kinase, when the amounts of substrate and enzyme were increased 100- and 10-fold, respectively (Figure 5B
and Table II
). From these results we can rank the gmk activity as follows: gmk > D103N > E72Q/D103N > E72Q. This correlates with what was observed in the plate complementation analysis (Table I
). The enzyme with the poorest gmk activity (E72Q) was also the weakest at complementing the gmkts yeast and displayed the lowest specific activity of the guanylate kinases.
Adenylate kinase activity
Of the gmks tested, only the E72Q/D103N was able to complement the adenylate kinase deficiency in CV2 (Figure 2
). In growth curves at permissive temperatures, all CV2 cultures grew similarly well (Figure 4
). However, at restrictive temperatures, pEAK90 (wild-type adk) and pBAD:E72Q/D103N were the only cultures that grew, which indicates that E72Q/D103N displays a novel adenylate kinase activity. This correlates well with the results from the plate complementation assays (Table I
).
Adenylate kinase enzyme assays were performed on all purified guanylate kinases and purchased adenylate kinase (Sigma). At 1 mM AMP and 11 µg enzyme, only adenylate kinase demonstrated detectable activity with a specific activity of 1.77 U/mg (Figure 6A
and Table II
). When the substrate concentration was increased to 10 mM (10-fold) and the amount of enzyme was increased to 110 µg (10-fold) in the assay, low activity was observed with E72Q/D103N (specific activity = 0.0057 U/mg) and even lower activity with D103N (specific activity = 0.0032 U/mg). The low level of adenylate kinase activity detected with purified D103N is probably too low to provide functional complementation in CV2. Although the graph in Figure 6B
appears to show a minor amount of activity for E72Q and wild-type gmk, this is probably a result of the prolonged assay time and/or minor contaminating enzymes (Agarwal et al., 1978
). Furthermore, the guanylate kinases were purified from an E.coli strain with an endogenous source of adenylate kinase such that a small amount of adenylate kinase may have been co-purifed with the gmks.
While the ability of E72Q/D103N to phosphorylate GMP is impaired relative to wild-type gmk activities, the double gmk mutant demonstrates a novel ability to phosphorylate AMP at a functionally relevant level. The adenylate kinase activity is much less than that demonstrated by the wild-type adenylate kinase. This suggests that other residues or structural motifs beyond E72 and D103 may be involved in differentiating between AMP from GMP.
In conclusion, we have constructed three site-directed mutants of mouse guanylate kinase and have shown that one of these, E72Q/D103N, has an expanded substrate specificity. In addition to maintenance of gmk activity, E72Q/D103N possesses a novel adenylate kinase activity as demonstrated by the ability of this mutant to complement functionally an adenylate kinase-deficient E.coli in plate assays and growth curve experiments and by the ability to exhibit adenylate kinase activity in direct enzyme assays. The ability to alter the substrate specificity of an essential metabolic enzyme extends our understanding of enzymesubstrate interactions and thereby may facilitate the design of novel drugs for the treatment of cancer and viral infections.
| Notes |
|---|
1 To whom correspondence should be addressed.E-mail: blackm{at}mail.wsu.edu
| Acknowledgments |
|---|
This work was supported by a Research Starter Grant from the Pharmaceutical Manufacturers of America Foundation (M.E.B.) and an American Cancer Society Institutional Research Grant (M.E.B.).
| References |
|---|
|
|
|---|
Agarwal,K.C., Miech,R.P. and Parks,R.E.,Jr. (1978) Methods Enzymol., 51, 483490.[Medline]
Boehme,R.E. (1984) J. Biol. Chem., 259, 1234612349.
Brady,W.A., Kokoris,M.S., Fitzgibbon,M. and Black,M.E. (1996) J. Biol. Chem., 271, 1673416749.
Elion,G.B. (1989) Science, 244, 4147.
Gaidarov,I.O., Suslov,O.N. and Abdulaev,N.G. (1993) FEBS Lett., 335, 8184.[Web of Science][Medline]
Kunkel,T.A. (1985) Proc. Natl Acad. Sci. USA, 82, 488492.
Miech,R.P., York,R. and Parks,R.E. (1969) Mol. Pharmacol., 5, 3037.
Miller,W.H. and Miller,R.L. (1980) J. Biol. Chem., 255, 72047207.
Muller,C.W. and Schulz,G.E. (1992) J. Mol. Biol., 224, 159177.[Web of Science][Medline]
Reinstein,J., Brune,M. and Wittinghofer,A. (1988) Biochemistry, 27, 47124720.[Medline]
Shimma,Y., Nishikawa,A., bin Kassim,B., Eto,A. and Jigami,Y. (1997) Mol. Gen. Genet., 256, 469480.[Web of Science][Medline]
Stehle,T. and Schulz,G.E. (1992) J. Mol. Biol., 224, 11271141.[Web of Science][Medline]
Studier,W.F., Rosenberg,A.H., Dunn,J.J. and Dubendorff,J.W. (1990) Methods Enzymol., 185, 6089.[Medline]
Woods,D.F. and Byrant,P.J. (1991) Cell, 66, 451464.[Web of Science][Medline]
Zschocke,P.D., Schiltz,E. and Schulz,G.E. (1993) Eur. J. Biochem., 213, 263269.[Web of Science][Medline]
Received February 6, 2001; revised May 7, 2001; accepted July 11, 2001.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
A. Ardiani, A. Goyke, and M. E. Black Mutations at serine 37 in mouse guanylate kinase confer resistance to 6-thioguanine Protein Eng. Des. Sel., April 1, 2009; 22(4): 225 - 232. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Janssen, A. Terzic, B. Wieringa, and P. P. Dzeja Impaired Intracellular Energetic Communication in Muscles from Creatine Kinase and Adenylate Kinase (M-CK/AK1) Double Knock-out Mice J. Biol. Chem., August 15, 2003; 278(33): 30441 - 30449. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sekulic, L. Shuvalova, O. Spangenberg, M. Konrad, and A. Lavie Structural Characterization of the Closed Conformation of Mouse Guanylate Kinase J. Biol. Chem., August 9, 2002; 277(33): 30236 - 30243. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




, pYX212:E72Q;
, pYX212:D103N;
, pYX212:E72Q/D103N.

, pEAK90 (wild-type adenylate kinase).

, no enzyme.



