Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wu, A. M.
Right arrow Articles by Raubitschek, A. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, A. M.
Right arrow Articles by Raubitschek, A. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Protein Engineering, Vol. 14, No. 12, 1025-1033, December 2001
© 2001 Oxford University Press

Multimerization of a chimeric anti-CD20 single-chain Fv-Fc fusion protein is mediated through variable domain exchange

Anna M. Wu1,2, Giselle J. Tan1, Mark A. Sherman3, Patrick Clarke4,5, Tove Olafsen1, Stephen J. Forman6 and Andrew A. Raubitschek4

1 Department of Molecular Biology, 3 Divison of Biology, Beckman Research Institute of the City of Hope, 1450 East Duarte Road, Duarte, CA 91010, 4 Department of Radioimmunotherapy and 6 Division of Hematology/Bone Marrow Transplantation, City of Hope National Medical Center, 1500 East Duarte Road, Duarte, CA 91010, USA


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
A series of single-chain anti-CD20 antibodies was produced by fusing single-chain Fv (scFv) with human IgG1 hinge and Fc regions, designated scFv-Fc. The initial scFv-Fc construct was assembled using an 18 amino acid (aa) linker between the antibody light- and heavy-chain variable regions, with the Cys residue in the upper hinge region (Kabat 233) mutagenized to Ser. Anti-CD20 scFv-Fc retained specific binding to CD20-positive cells and was active in mediating complement-dependent cytolysis. Size-exclusion HPLC analysis revealed that the purified scFv-Fc included multimeric as well as monomeric components. Variant scFv-Fcs were constructed incorporating four different hinges between the scFv and Fc regions, or three different linkers in the scFv domain. All formed multimers, with the highest level of multimerization found in the scFv-Fc with the shortest linker (8 aa). Elimination of an unusual salt bridge between residues L38 and H89 in the VL-VH domain interface failed to reduce the formation of higher order forms. Structural analysis of the scFv-Fc constructed with 18 or 8 aa linkers by pepsin or papain cleavage suggested the proteins contained a form in which scFv units had cross-paired to form a `diabody'. Thus, domain exchange or cross-pairing appears to be the basis of the observed multimerization.

Keywords: chimeric scFv-Fc/hinge/multimerization/scFv linker/variable domain interaction


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Immunotherapeutic approaches to the treatment of cancer and other diseases in humans have been greatly facilitated by the advent of genetically engineered antibodies. Recombinant technology has allowed investigators to combine antigen specificity with desired biological functions and to manipulate the biochemical and pharmacologic/pharmacokinetic characteristics of antibodies. For example, chimerization or humanization of murine monoclonal antibodies to reduce immunogenicity has been an essential step in permitting repeated administration of antibodies to patients. Manipulation of the size and domain structure of engineered antibody fragments can influence the rate and route of clearance of antibodies. Furthermore, fusion of light- and heavy-chain variable regions to create single-chain Fv (scFv) can be used to produce an antigen-combining unit in a single polypeptide, encoded by a single gene. This scFv format readily lends itself to assembly and production of larger constructs and fusion proteins and can streamline the process of attaining high level expression of recombinant antibodies, as only a single polypeptide must be expressed.

A single-chain immunoglobulin-like molecule consisting of the heavy- and light-chain variable regions of the CC49 anti-TAG-72 antibody, fused to the human {gamma}1 hinge and Fc effectively recreates an intact immunoglobulin (Shu et al., 1993Go). The protein assembled into a dimeric molecule which retained antigen binding and was active in cytotoxicity assays. Biodistribution studies of radioiodinated protein demonstrated that this engineered fragment (referred to as cCC49{Delta}CH1) retained excellent localization to LS174T xenografts in athymic mice and exhibited a serum persistence similar to that of intact antibody (Slavin-Chiorini et al., 1995Go).

CD20-positive B-cell malignancies are an attractive target for antibody therapy. The CD20 antigen is an integral transmembrane protein expressed by cells in the B-lineage from B-cell precursors through mature B cells, but not plasma cells (Stashenko et al., 1980Go; Loken et al., 1987Go). This 33–37 kDa phosphoprotein, thought to play a role in calcium conductance, is not internalized or down-modulated, making it an ideal target for exogenous antibody-based therapies (Tedder and Engel, 1994Go). Unmodified anti-CD20 murine or chimeric antibodies have been demonstrated to be effective in inducing regression of B-cell lymphomas(Press et al., 1987Go; Horton et al., 1989Go). The chimeric anti-CD20 antibody, C2B8 (rituximab; Rituxan), has been extensively evaluated in patients with recurrent B-cell lymphoma (Maloney et al., 1994Go, 1997aGo, bGo), leading to recent FDA licensure. The efficacy of anti-CD20 antibodies can be further enhanced by radiolabeling with therapeutic isotopes such as 131I or 90Y (Liu et al., 1998Go; Witzig et al., 1999Go; Vose et al., 2000Go).

In the present study, a single-chain chimeric anti-CD20 antibody has been produced for potential use in immunotherapy or radioimmunotherapy of lymphoma. The protein encompasses an scFv, assembled VL-linker-VH and the human IgG1 hinge and Fc regions (abbreviated scFv-Fc). When expressed in murine myeloma cells, this anti-CD20 scFv-Fc self-assembled into a 104 kDa unit dimer, as well as a series of discrete higher molecular weight forms, which retained high specificity and affinity for CD20. This study reports biological and biochemical analysis of several variant forms of this anti-CD20 antibody in order to evaluate the region(s) contributing to multimerization.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Cloning of anti-CD20 variable regions

Variable region genes were amplified from an anti-CD20 hybridoma (Leu-16; a gift of BD, Franklin Lakes, NJ) by RT-PCR using kappa light-chain upstream primer VKBi8 or heavy-chain upstream primer VHBi3d from Dübel et al. (Dübel et al., 1994Go). Downstream primers were: murine kappa constant region [5'-d(CGGAATTCGGATGGTGGGAAGATGGA)] or murine heavy-chain constant region [5'-d(CGGAATTCAGGGGCCAGTGGATAGAC)]. PCR products were purified, cloned into T-tailed Bluescript (Stratagene, La Jolla, CA) and isolates were confirmed by DNA sequence analysis.

Sequence analysis of parental anti-CD20 antibody

Protein sequence information from the anti-CD20 antibody was obtained by N-terminal sequence analysis of the intact heavy and light chains and their corresponding tryptic peptides. Following reduction and alkylation, the heavy and light chains were separated by SDS–PAGE. In situ tryptic digests were performed according to Hellman et al. (Hellman et al., 1995Go). Peptides were extracted, separated by microcapillary HPLC and collected manually. The collected fractions were analyzed by Edman degradation and liquid chromatography-tandem mass spectrometry (LC-MS/MS) as described by Davis and Lee (Davis and Lee, 1997Go).

Design and construction of anti-CD20 scFv-Fc

Single-chain Fv fusion proteins were constructed from the anti-CD20 antibody as shown in Figure 1Go. Constructs included a consensus ribosome-binding sequence and the signal peptide from a murine kappa light chain previously used for high level mammalian antibody secretion (Williams et al., 1995Go). The N-terminal sequences of the first 8 amino acids (aa) of VH and the first 10 aa residues of VL in the fusion protein were derived from the consensus primers used to amplify the variable region genes. In order to provide a long, flexible joint between VL and VH, the initial construct included the peptide sequence GSTSGGGSGGGSGGGGSS (designated GS18). The upper hinge Cys233 (Kabat numbering system) in the human IgG1 hinge-Fc cDNA (from J.Scholm, NCI Bethesda, MD) was mutated to serine to create the C233S/GS18 scFv-Fc; Cys233 is normally disulfide bonded to the C-terminus of C{kappa}.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 1. . (A) Schematic diagram of the scFv-Fc fusion protein. Three alternate linker sequences were used between VL and VH and four alternate hinge sequences were used between VH and the CH2 domain; the peptide sequences of the linkers are indicated. In this and the following Figures, VL is white, VH is light gray and the Fc region is represented by the dark gray oval. (B) Predicted protein sequence for anti-CD20 light- and heavy-chain variable regions and partial confirmation by protein sequence analysis. The CDRs are indicated in bold lettering. Overscored peptide sequences were determined by LC-MS/MS; underscored sequences were determined by Edman degradation.

 
Fusion of gene segments encoding the anti-CD20 scFv and human IgG1 Fc were produced by splice overlap extension as previously described (Wu et al., 1996Go). Hinge and linker variants of the scFv-Fc, listed in Figure 1Go, were produced by PCR mutagenesis. In an additional variant of GS18/C233S, a potential salt bridge (between residues L38 and H89, Kabat numbering system) was eliminated by mutagenizing light-chain residue 38 from Lys to Gln (K38Q) and heavy-chain residue 89 from Asp to Val (D89V), using the QuickChangeTM protocol (Stratagene).

Mammalian expression

Anti-CD20 single-chain-Fc DNA fragments were inserted into the pEE12 expression vector (glutamine synthetase+, Lonza Biologics, Slough, UK) (Bebbington, 1991Go; Bebbington et al., 1992Go) using flanking XbaI and EcoRI sites and linearized using a unique SalI site. In a 0.4 cm gap cuvette, 40 µg of linearized DNA in sterile water was electroporated into 1x107 NS0 cells (provided by Lonza Biologics) in PBS with a Bio-Rad Gene Pulser set to 1.5 kV and 3 µF capacitance. Cells were plated at 1.2x104 cells/well in 96-well plates in non-selective media. Twenty-four hours post-electroporation, glutamine-deficient media was added 4:1 (v/v) and cells were allowed to recover and grow undisturbed for 3 weeks.

Supernatants of transformed cells able to grow under glutamine-free conditions were screened for antibody secretion by sandwich ELISA. Briefly, EIA plates (Costar, Cambridge, MA) were coated with goat-anti-human Fc (Jackson ImmunoResearch, West Grove, PA). Sample supernatant, controls or serial dilutions of a standard purified chimeric antibody (Neumaier et al., 1990Go) were added and alkaline-phosphatase conjugated anti-human IgG (diluted 1:20 000, Jackson ImmunoResearch) was used for detection. High-producing clones were grown and expanded under selective conditions. In order to produce sufficient quantities of scFv-Fc, some clones were transferred and grown in a Cell-Max Bioreactor with a 10 kDa MW filter (Spectrum Cellco Division, Laguna, CA) as per the manufacturer's protocol.

Purification and characterization of engineered anti-CD20

Engineered scFv-Fc anti-CD20 antibodies were purified from cell culture supernatants by Protein A chromatography using a Thermal Separations Products HPLC with an in-line UV monitor, equipped with a preparative Poros 50 A column (Applied Biosystems, Foster City, CA). Supernatants were loaded onto a 10x50 mm column and eluted using a 0.1 M sodium citrate/citric acid gradient (pH 8.0–2.1). ScFv-Fcs were size-fractionated on tandem Superose 6 columns (Pharmacia, Piscataway, NJ) in 50 mM Na2SO4/20 mM NaH2PO4, pH 7.2. Protein peaks were concentrated and dialyzed using a Slidealyzer (10 kDa cutoff; Pierce, Rockford, IL) into PBS. Final protein concentrations were determined by measuring UV absorbance at 280 nm, using the parental murine antibody as the standard.

Small-scale preparative fractionation of the scFv-Fcs for complement-dependent cytolysis (CDC) assay was conducted using a 4.6x100 cm Poros 20 A/M Protein A column (Applied Biosystems), with the gradient elution described above. Fractions were collected and subjected to size analysis on tandem Superose 6 columns (Pharmacia) as above. Alternately, molecular weight variants for proteolytic digestion were separated by step elution at pH 2.1 from Protein A followed by hydrophobic interaction chromatography (HIC) on a 1 ml Resource ISO column (Pharmacia). Protein was eluted using a gradient from 1.5 M ammonium sulfate/50 mM sodium phosphate (pH 7.0) to 0.1 M sodium chloride/50 mM sodium phosphate (pH 7.0).

Competitive cell-binding assay

Daudi cells (ATCC CCL 213) were stained with FITC-conjugated Leu-16 (BD) and anti-CD20 scFv-Fc or unlabeled Leu-16 were added to compete for CD20 cell-surface binding. A total of 2x104 cells/tube were washed and suspended in HBSS/0.1% human serum albumin/0.01% NaN3. To each tube a mixture of 0.5 µg of FITC-Leu-16 and dilutions of either the anti-CD20 scFv-Fc as competitor or unlabeled Leu-16 as standard was added. Following a 30 min incubation on ice, cells were washed, resuspended in PBS and analyzed on a MoFlo cytometer (Cytomation, Fort Collins, CO).

CDC assay of engineered anti-CD20 antibodies

Target Daudi B-cells were labeled with 51Cr, washed and incubated in triplicate with serial dilutions of the scFv-Fc or control murine (Leu-16) or chimeric (rituximab; IDEC Phamaceuticals, San Diego, CA) anti-CD20 antibody. Rituximab represents a species- and isotype-matched control (human IgG1 constant regions). Rabbit complement (Pel-Freeze Biologicals, Roger, AR) diluted 1:20 in complete media was added and plates incubated for 1 h at 37°C. Following centrifugation at 500 r.p.m. (50 g) for 6 min, supernatants were removed and counted in a gamma counter. Controls and standards in triplicate included: background (cells only), maximum release (target cells plus 2% SDS), positive control (rituximab and complement) and complement cytotoxity (cells plus complement only). K-562 cells (ATCC CCL 243) were used as the negative control. The following formula was used to calculate % maximum release:


Papain digestion of scFv-Fc variants

Monomer and multimer protein fractions of scFv-Fcs with 8 or 18 aa linkers were separated by HIC as described above. Monomer and multimer fractions were collected and dialyzed against 20 mM sodium phosphate/10 mM EDTA (pH 7.0). Samples were concentrated with Centriprep YM-30 MW filters (Amicon, Beverly, MA) and cleaved using immobilized papain (Pierce, Rockford, IL) according to Pierce protocol #20341 for 13 h. Protein A chromatography, as described above, separated the proteolytic products into Fc-fragments (bound) and non-Fc-species (flow through). The flow through fraction was further analyzed by size-exclusion chromatography (SEC-HPLC) on Superdex 75 (Pharmacia) with PBS (pH 7.0) or by SDS–PAGE.

Pepsin digestion of GS18/C233S scFv-Fc

The monomer fraction of GS18/C233S was purified via Protein A and HIC as described and dialyzed against 20 mM sodium acetate (pH 4.5). The sample was concentrated as above and the scFv-Fc was cleaved using immobilized pepsin (Pierce) according to Pierce protocol #20343 for 3.25 h. Digested protein was passed over a Protein A column to remove Fc-containing fragments. Flow through material was analyzed on Superdex 75 under non-reducing or reducing (100 mM DTT) conditions and by SDS–PAGE.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Confirmation of cloning of anti-CD20 variable regions

Using universal antibody primers, clones encoding heavy- and light-chain variable regions were successfully amplified from total RNA extracted from an anti-CD20 hybridoma. Comparison of the predicted amino acid sequences to published sequences (Kabat et al., 1991Go) suggested that the VH belonged to murine heavy-chain subgroup IIA while the VL was a member of murine kappa subgroup VI. The identity of the isolated clones was confirmed by comparison of the predicted tryptic digestion products to protein sequence data obtained from the parental murine antibody (Figure 1BGo). Edman degradation and LC-MS/MS analysis demonstrated the presence of tryptic peptides corresponding to all three complementary determining regions (CDRs) of the kappa chain and two CDRs of the heavy-chain variable region (Figure 1BGo).

Production and characterization of GS18/C233S scFv-Fc

The initial anti-CD20 single-chain Fv-Fc protein was assembled using an 18 aa linker between the light- and heavy-chain variable regions and the C233S variant of the human IgG1 hinge-Fc (termed GS18/C233S scFv-Fc, Figure 1Go). Expression using the pEE12/NS0 system yielded antibody protein levels of 100–200 µg/ml in cell culture supernatants as determined by ELISA. Western blot analysis (non-reducing) of supernatants demonstrated production of a protein reactive with anti-human Fc antibody with a migration consistent with the predicted moleular weight of 104 kDa for the scFv-Fc (not shown). We refer to this form as the scFv-Fc monomer.

The GS18/C233S scFv-Fc was initially purified by Protein A chromatography. SDS–PAGE analysis showed that under non-reducing conditions (Figure 2AGo), the bulk of the protein was comprised of the expected 104 kDa disulfide-linked scFv-Fc monomer; while under reducing conditions, the 52 kDa polypeptide subunit was the predominant species (Figure 2BGo). However, analysis of the native protein by SEC-HPLC indicated that in addition to the expected 104 kDa scFv-Fc monomer, a discrete series of higher order multimers was present in the GS18/C233S variant (Figure 3AGo). By peak integration, the 104 kDa monomer was estimated to be 42% of the total purified protein suggesting that the engineered anti-CD20 scFv-Fc preferably formed larger protein aggregates. When analyzed by non-reducing SDS–PAGE, the multimer variants were of the same molecular weight as the 104 kDa monomer (Figure 4AGo), indicating that the interactions within the higher molecular weight species resulted from non-covalent interactions between the 104 kDa monomers.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 2. . SDS–PAGE of Protein A affinity-purified scFv-Fc proteins. (A) Purified proteins were analyzed on 10% acrylamide gels under non-reducing conditions and stained with Coomassie Blue. The mobility of these glycosylated proteins is reduced relevant to the marker proteins, as is typical for antibodies. The scFv-Fc proteins migrate faster (smaller) than intact Leu-16 (160 kDa) under these conditions (not shown). (B) scFv-Fc proteins analyzed under reducing conditions.

 


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. . Size analysis of Protein A affinity-purified scFv-Fc proteins. Samples were fractionated by HPLC on tandem Superose 6 columns as described in the Methods and UV absorbance was monitored. The monomeric scFv-Fc (104 kDa) elutes at a delayed retention time under these conditions (low salt) but exhibits the expected behavior on Superose 6 in PBS; see also Figure 8Go.

 


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 4. . SDS–PAGE of monomeric and multimeric forms of scFv-Fc. Samples of the GS18/C233S and GS8/nat anti-CD20 scFv-Fc proteins were analyzed under non-reducing (A) or reducing (B) conditions and stained with Coomassie Blue.

 
Binding and biological activity of purified anti-CD20 scFv-Fc

The engineered single-chain GS18/C233S as well as the GS8/nat anti-CD20 scFv-Fc, described in Figure 1Go and below, retained full antigen-binding activity and potent biological activity. Relative affinity was assessed by testing the ability of the anti-CD20 scFv-Fc monomeric fraction, to compete with FITC-Leu-16 for binding to Daudi cells. As shown in Figure 5Go, on a microgram to microgram basis, both GS18/C233S and GS8/nat anti-CD20 scFv-Fc were comparable to parental Leu-16 in their ability to compete with FITC-Leu-16, indicating retention of high affinity.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 5. . Competition cell-binding assay. Binding to CD20-positive Daudi cells was evaluated by competition of parental Leu-16 or scFv-Fc with FITC-Leu-16 by FACS. (A) GS18/C233S scFv-Fc. (B) GS8/nat scFv-Fc.

 
The biological activity of the chimeric single-chain GS18/C233S anti-CD20 was assessed in CDC with rituximab as a standard. This scFv-Fc was fractionated into 104 kDa monomer, 210 kDa dimer, oligomer and multimer components by Protein A gradient elution followed SEC-HPLC on tandem Superose 6 columns. Figure 6A and BGo indicate the size profile of the scFv-Fc material and the dimeric, oligomeric and multimeric fractions. The GS18/C233S scFv-Fc anti-CD20 antibody fractions were more potent in mediating lysis as compared to rituximab, over a range of concentrations (Figure 6CGo). Amongst the scFv-Fc components, a trend of increasing activity from monomer to dimer to oligomer was observed, although the highest molecular weight multimers showed a reduction in activity. Overall, these results demonstrated that the GS18/C233S anti-CD20 scFv-Fc retained potent biological activity.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 6. . CDC of multimeric forms of GS18/C233S scFv-Fc. (A) Protein A gradient elution of monomeric and higher molecular weight forms of scFv-Fc. (B) Size-exclusion HPLC on Superose 6 of fractions number 62, 70 and 75 (from A) demonstrating the presence of scFv-Fc dimers (208 kDa), oligomers and higher order multimers, respectively. (C) CDC assay of target Daudi cells by size-fractionated GS18/C233S scFv-Fc.

 
Evaluation of alternate hinge, linker and framework sequences

The original scFv-Fc fusion protein contained a flexible linker between VL and VH, as well as an extended and potentially exposed upper hinge due to the C233S mutation. We surmised that the observed multimerization might result from misassembly due to the presence of this extended hinge. To evaluate this hypothesis, additional scFv-Fc constructs were made, all retaining the GS18 linker in the scFv portion of the protein, but incorporating three alternative hinges (Figure 1Go). These included restoration of Cys233 to give the native sequence (nat); formation of a disulfide bridge between the Cys233 residues should result in a more condensed conformation of the upper hinge. In a second version, the upper hinge was truncated by deletion of 5 aa residues through Cys233 ({Delta}5), analogous to the scFv-Fc fusion used by Roberts et al. (Roberts et al., 1994Go). The final variant was constructed incorporating a Cys to Pro mutation at residue 233 (C233P), used previously by Kashmiri et al. in the original CC49 scFv-Fc construct (Shu et al., 1993Go). Protein was purified by Protein A chromatography using a step elution and the products analyzed by SDS–PAGE and SEC-HPLC. These protein variants show similar mobilities under both non-reducing or reducing conditions (Figure 2A and BGo) as compared to the original scFv-Fc fusion. Of interest, size analysis by tandem Superose 6 chromatography indicated that regardless of the hinge sequence incorporated in the protein, the scFv-Fc proteins formed a series of multimers (Figure 3Go). Quantitation of the series by integration of peak heights (Table IGo) suggested that the degree of multimerization could be reduced. However, assembly of higher order multimers of the anti-CD20 scFv-Fc was not significantly inhibited by changes in the upper hinge.


View this table:
[in this window]
[in a new window]
 
Table I. . Quantitation of multimerization
 
Alternatively, linker length or sequence between the variable regions may play a causative role in multimer formation. In addition to the expected self-association of the linked VL and VH domains within an scFv-Fc subunit, these variable regions could interact with the corresponding variable regions on the other scFv-Fc subunit. This would result in a cross-paired structure, or `diabody' (Holliger et al., 1993Go) joined to the hinge-Fc (Figure 7Go). Several groups have shown an association between scFv linker length and diabody formation and that this domain exchange can be forced by utilizing linkers of 12 aa or less (Holliger et al., 1993Go). Conversely, Whitlow et al. (Whitlow et al., 1993Go) described a 218 linker (of 18 aa) containing charged residues that greatly reduced multimerization of their original CC49 scFv. To investigate the influence of the flexible linker in multimer formation, the anti-CD20 scFv-Fc was reconstructed with a native hinge along with two alternate linkers: one designated 218S/nat contained the 218 Whitlow linker with a Gly to Ser change in residue 12 of the published sequence, while GS8/nat incorporated an 8 aa Gly–Ser linker, resulting in a diabody-Fc fusion protein (Figure 7Go). A comparison of both 218S/nat and GS8/nat scFv-Fc protein to the previous versions revealed no apparent differences by SDS–PAGE (Figure 2A and BGo), however, the monomer fraction in GS8/nat was reduced and higher order forms predominated (Figure 3BGo and Table IGo). While linker alteration to incorporate charged residues in 218S/nat did not significantly influence multimer formation, the GS8/nat scFv-Fc was fully capable of forming multimers, suggesting cross-pairing of variable regions as a viable mechanism for these events.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 7. . Predicted products of GS18/C233S and GS8/nat scFv-Fc following papain proteolysis. VL domains are indicated by the white ovals; VH domains are shaded light gray. (A) Proteolytic digestion of the GS18/C2333S scFv-Fc by papain and removal of Fc by Protein A chromatography, should yield scFv or diabody (non-covalent dimers) depending on initial protein conformation. (B) Digestion of GS8/nat diabody-Fc should liberate only diabody.

 
An additional mechanism that might have contributed to multimerization is the presence of two uncommon residues, Lys at position L38 and Asp at position H89 in the Leu-16 VL-VH interface. The most frequently observed residue at L38 is Gln (94%) and at H89 it is Val (59%) (Chothia et al., 1985Go). Residues L38 and H89 are Gln and Val, respectively, in four other anti-CD20 antibodies1F5, 2H7, 1H4 and rituximab, all of which share the same basic framework (Liu et al., 1987Go; Anderson et al., 1998Go; Haisma et al., 1998Go; Shan et al., 1999Go). In most Fv units Gln L38 forms two hydrogen bonds with Gln H39 (Novotny and Haber, 1985Go). Molecular modeling of Leu-16 suggested that given a slight shift in the angle of the VL-VH pairing, Lys L38 might be ion-pairing with negatively-charged Asp H89. It was reasoned that this shift might be better accommodated in a cross-paired format. We therefore chose to mutate our sequence to match the consensus and eliminate the putative salt bridge. The light-chain K38Q and heavy-chain D89V mutant version of scFv-Fc was produced and purified as above. However, this double mutant exhibited the same propensity to multimerize (data not shown).

Papain proteolytic probing of Fv conformation

The conformation of the Fv regions of two versions of the scFv-Fc (GS18/C233S and GS8/nat) were investigated by subjecting purified monomeric or multimeric protein fractions to proteolytic digestion with papain. Papain digestion, which normally cleaves above the hinge disulfides in intact Ig and releases Fab fragments, should either liberate scFv fragments or diabodies from the scFv-Fc proteins, depending on the initial arrangement of the variable regions (Figure 7Go). The GS18/C233S and GS8/nat were separated into monomeric and multimeric fractions by HIC. Following papain digestion, protein fragments were separated by Protein A chromatography yielding bound (Fc) and flow-through (containing the variable domains) fractions.

Analysis of the flow-through fraction by SEC-HPLC on Superdex 75 showed that papain digestion of GS18/C233S monomer and multimer (Figure 8AGo) yielded a predominant peak at 23.2 min consistent with a 27 kDa scFv as well as a smaller peak at 19.5 min indicative of the 54 kDa diabody form. Monomeric GS8/nat scFv-Fc liberated the cross-paired 52.8 kDa diabody form (Figure 8BGo) eluting at 20.7 min. The SDS–PAGE results revealed that GS8/nat papain digested material migrates around 25 kDa, consistent with the size expected for SDS-disassociated diabody (data not shown). However, SDS–PAGE analysis of papain digested GS18/C233S flow-through material yielded low molecular weight bands, suggesting that papain cleaves inside the scFv in a discrete fashion. This result may stem from a diabody conformation that exposes linker residues, thereby affording papain other cleavage sites (Figure 7Go).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 8. . Size analysis of papain digested products of monomeric and multimeric forms of (A) GS18/C233S and (B) GS8/nat fusion proteins. Following digestion, Fc fragments were removed by Protein A chromatography and the configuration of the Fv portions evaluated by size fractionation on Superdex 75. The identity of each sample is indicated. Arrows indicating size markers 104 kDa GS18/C233S scFv-Fc, 103 kDa GS8/nat diabody-Fc, 80 kDa anti-CEA minibody and 55 kDa anti-CEA-diabody are indicated by R1, R2, R3 and R4, respectively.

 
As expected, the GS8/nat diabody-Fc multimeric protein fraction also yielded a series of higher molecular weight species (Figure 8BGo). These most likely correspond to higher order multimers such as the triabodies and tetrabodies observed by others (Iliades et al., 1997Go; Le Gall et al., 1999Go) and could indicate the basis of multimerization.

Pepsin proteolytic digest of GS18/C233S

In order to examine the conformational structure of GS18/C233S, pepsin digests were performed on the monomer. Pepsin digestion of intact immunoglobulins normally cleaves below the hinge disulfides, yielding F(ab')2 fragments. Digestion of the scFv-Fc should either liberate two scFvs linked covalently via the hinge disulfides or a two-chain disulfide-linked diabody (Figure 9Go). As both fragments have equivalent mass, distinguishing between the two conformations would require size analysis under reducing conditions. Under reducing conditions, the two covalently-linked scFvs should resolve into a 28 kDa fragment while the diabody would remain at 55 kDa due to the non-covalent interactions between cross-paired variable regions (Figure 9Go).



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 9. . Predicted products of GS18/C233S scFv-Fc following pepsin proteolysis. VL domains are indicated by the white ovals; VH domains are shaded light gray. Following pepsin digestion, the single-chain Fv conformation should yield two scFvs linked covalently via the hinge disulfides while the presence of the diabody conformation should result in a two-chain disulfide-linked diabody. Both products are 55 kDa. Upon reduction, the two scFvs should resolve into 27.5 kDa fragments while the diabody would remain intact due to non-covalent interactions.

 
Pepsin digestion yielded information that the variable regions of GS18/C233S scFv-Fc exist in a scFv as well as a diabody conformation. Pepsin digested material passed through a Protein A column to remove Fc-containing products and size fractionated over a Superdex 75 column under standard (non-reducing) conditions gave a single peak corresponding to 55 kDa, consistent with the above predicted fragments (Figure 10Go, dashed line). Reanalysis of the same material on Superdex 75 under reducing conditions yielded two major peaks corresponding to 55 and 28 kDa (Figure 10Go, solid line), indicating the presence of both scFv and diabody conformations in the starting material.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 10. . Size analysis of pepsin-digested product of monomeric GS18/C233S protein. Proteolytic digestion was followed by Protein A chromatography to remove Fc fragments from the sample. The sample was then chromatographed on a Superdex 75 column under non-reducing or reducing (100 mM DTT) conditions.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Cloned variable regions of the anti-CD20 antibody were assembled to produce a recombinant antibody that would retain the antigen-binding properties of the parental murine monoclonal antibody, in a single polypeptide chain. The single-chain variable region (scFv) was engineered using the long, flexible GS18 linker peptide based on studies showing that longer linkers reduce multimerization by single-chain Fv proteins (Whitlow et al., 1993Go; Desplancq et al., 1994Go; Alfthan et al., 1995Go; Wu et al., 1996Go). The human IgG1 hinge and Fc regions were incorporated for several reasons: to produce a chimeric molecule with reduced immunogenicity; to maintain prolonged serum half-life; to gain effector functions through potential interaction with the human host immune system; and to provide a simple route for purification through Protein A affinity chromatography. Finally, production of the engineered anti-CD20 antibody was facilitated by use of a single-chain, single-gene approach, eliminating the need for separate high-level expression and assembly of heavy and light chains. The initial construct incorporated the C233S mutation to eliminate the heavy-chain cysteine residue normally involved in disulfide bonding with the kappa constant domain, which is absent from these scFv-Fc proteins.

The anti-CD20 GS18/C233S exhibited many of the desired properties. In particular, the GS18/C233S scFv-Fc was comparable to the parental Leu-16 antibody in its ability to compete with FITC-Leu-16 in a cell-surface binding assay. Furthermore, potent biological activity was demonstrated in CDC assays, particularly by oligomeric fractions of the scFv-Fc. Preliminary biodistribution studies of radioiodinated monomeric GS18/C233S and GS8/nat anti-CD20 scFv-Fc in scid mice xenografted with CD20-positive Daudi tumor cells show comparable tumor targeting and blood clearance properties as compared to radioiodinated Leu-16 (data not shown). This scFv-Fc is also active in vivo as the extracellular component of a chimeric T-cell receptor that has been shown to redirect cytolytic T cells toward CD20-positive targets (Jensen et al., 1998Go). The GS8/nat diabody-Fc monomeric fraction was also able to mediate apoptosis of CD20+ Ramos B-cells using a FITC-Annexin-V flow cytometry assay. However, optimal results of >75% apoptosis required cross-linking of the diabody-Fc with an anti-human secondary reagent (Daming Shan, Oliver Press, personal communication).

Size analysis of the purified scFv-Fc protein unexpectedly revealed that the majority of the protein had self-assembled into a discrete series of higher order multimers. SDS–PAGE analysis under non-reducing conditions demonstrated that all the higher molecular weight species were based on the disulfide-bonded 104 kDa scFv-Fc. A systematic approach was used to identify factors responsible for multimer formation in this scFv-Fc. Incorporation of three different hinges (nat, {Delta}5, or C233P) did not inhibit multimerization. An alternate hypothesis that the flexible linker contributed to the formation of higher molecular weight variants was investigated by altering the sequence to either a modified 218 linker or an 8 aa GS8 linker. However these mutations did not prevent multimer formation; instead GS8 exhibited increased multimerization.

Examination of a Leu-16 molecular model revealed an unusual potential salt bridge in the variable region interface. We postulated that formation of the buried salt bridge might be energetically favored in the context of a cross-paired dimer versus a monomeric scFv since L38 is known to affect the energetics and orientation of Ig-domain pairing (Raffen et al., 1998Go; Tan et al., 1998Go; Pokkuluri et al., 2000Go). However, replacement of L38 and H89 with consensus residues that restore the normal H-bonded pair between L38 and H39 did not reduce multimerization (data not shown).

Multimerization appears driven by the intermolecular pairing of variable regions of this scFv-Fc. Pei et al. purified and determined the crystal structure of a triabody, revealing a domain-swapped trimer (Pei et al., 1997Go), and an analogous model for a tetrabody has been proposed (Dolezal et al., 2000Go). Similarly, variable domain exchange between different scFv-Fc molecules could result in non-covalent multimeric structures such as that shown in Figure 11Go. SDS–PAGE analysis of the various scFv-Fcs shows that multimeric fractions are built up from the disulfide-linked monomer while papain and pepsin digestion of the GS18/C233S and GS8/nat scFv-Fcs show that the Fv domains are capable of forming both scFv as well as diabody structures. This cross-pairing hypothesis has been further investigated by assembling just the anti-CD20 scFv with an 8 aa linker to produce diabodies. Non-reducing SDS–PAGE of this protein yielded a band of 26 kDa consistent with a VL-VH subunit. As expected, SEC-HPLC on Superdex 75 revealed the presence of 55 kDa diabodies as well as a spectrum of higher molecular weight protein products analogous to the multimers observed in the scFv-Fc constructs (data not shown). In contrast, an identical construct (VL-8 aa-VH) generated from a different antibody (T84.66) existed exclusively as 55 kDa diabodies (Wu et al., 1999Go). This supports the hypothesis that cross-pairing of the Leu-16 variable regions is the basis of the multimerization of the scFv-Fc constructs. The strength of the cross-pairing interactions and the stability of the multimers remain open questions. Prolonged storage (>1 month at 4°C) of scFv-Fc-containing cell culture supernatants resulted in an apparent increase in monomeric forms of the scFv-Fc (unpublished). This observation is consistent with previous studies of an anti-CEA antibody showing a concentration dependence of scFv-diabody interconversion (Wu et al., 1996Go). ScFv and diabody fractions were purified and remained stable when stored at low concentration. By contrast, when the fractions were concentrated and stored, the forms interconverted, regenerating mixtures of scFv and diabodies.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 11. . Schematic diagram of a dimer (210 kDa) of scFv-Fc, held together by cross-pairing interactions between variable regions. Each individual polypeptide chain(VL-VH-CH2-CH3) is indicated in a different shade of gray.

 
Our results differ from those of Shan et al., who constructed scFv-Ig from the 1F5 anti-CD20 antibody and observed primarily 55 kDa monomeric subunits (Shan et al., 1999Go). However, their constructs differed in the lengths of the scFv linkers evaluated (0, 5, 10 or 15 aa) and all had hinge disulfides removed to promote expression of scFv-Ig monomers. Two additional scFv-Fcs assembled using the human IgG1 hinge-Fc have been described: CC49 (Shu et al., 1993Go) and 1H7, an anti-insulin-like growth factor I receptor antibody (Li et al., 2000Go). Multimerization was not reported in these cases. Thus it appears that the observed multimerization is an inherent property of the variable regions of this anti-CD20 antibody. In a final attempt to eliminate multimerization, a different anti-CD20 scFv-Fc was constructed from the variable regions of rituximab, using an 18 aa linker and the hinge-Fc regions from human IgG4 (unpublished results). VL-VH and VH-VL variants were expressed. The rituximab scFv-Fc proteins formed 104 kDa disulfide-bonded monomers and did not form higher order multimers, confirming that the unusual properties observed here may be unique to the variable regions of the Leu-16 antibody.

In summary, a chimeric single-chain form of an anti-CD20 antibody (scFv-Fc) has been produced with properties suited for further development as an immunotherapeutic for B-cell leukemias and lymphomas, including retention of antigen-binding and high complement-dependent cytolytic activity. However, this single-chain antibody demonstrated a strong propensity to multimerize. We postulate that during synthesis of an scFv-Fc subunit, the newly folded variable regions are somehow juxtaposed to the variable regions of a separate scFv-Fc subunit and exchange domains as the nascent polypeptides are extruded from the polysomes. Further investigation of the residues that interact at the VL-VH interface or framework residues that affect folding rates, may provide insight into the dynamic process of assembly of these multimers. Alternately, strategies such as lengthening the linker between VL and VH, or modifying hydrophobic residues that are exposed at the base of the Fvs, in this type of construct may favor formation of a stable monomeric form. Such studies should prove worthwhile in elucidating factors that influence domain assembly as well as provide direction for future antibody design and construction.


    Notes
 
5 Present address: Chicago Medical School, 3333 Green Bay Road, North Chicago, IL 60064, USA Back

2 To whom correspondence should be addressed. A.M.Wu and G.J.Tan contributed equally to this work. Back


    Acknowledgments
 
The authors are grateful for the expert technical assistance of Millie Martinez, Christine Wright and Lucy Brown. Support services were provided by the Molecular Modeling, DNA Synthesis, DNA Sequencing, Protein Microsequencing and Flow Cytometry Core Facilities of the City of Hope Cancer Center. This work was supported by grants from the National Institutes of Health (CA 30206, CA 43904 and Cancer Center Support Grant CA 33572).


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Alfthan,K., Takkinen,K., Sizmann,D., Soderlund,H. and Teeri,T.T. (1995) Protein Eng., 8, 725–731.[Abstract/Free Full Text]

Anderson,D.R., Hanna,N., Leonard,J.E., Newman,R.A., Reff,M.E. and Rastetter,W.H. (1998) Therapeutic application of chimeric and radiolabeled antibodies to human B lymphocytes restricted differentiation antigen for treatment of B cell lymphoma. U.S. Patent No. 5, 736, 137.

Bebbington,C.R. (1991) Methods: Methods Enzymol., 2, 136–145.

Bebbington,C.R., Renner,G., Thomson,S., King,D., Abrams,D. and Yarranton,G.T. (1992) Bio/Technology, 10, 169–175.[Medline]

Chothia,C., Novotny,J. and Bruccoleri,R. (1985) J. Mol. Biol., 186, 651–663.[Web of Science][Medline]

Davis,M.T. and Lee,T.D. (1997) J. Am. Soc. Mass Spectrometry, 8, 1059–1069.

Desplancq,D., King,D.J., Lawson,A.D.G. and Mountain,A. (1994) Protein Eng., 7, 1027–1033.[Abstract/Free Full Text]

Dolezal,O., Pearce,L.A., Lawrence,L.J., McCoy,A.J., Hudson,P.J. and Kortt,A.A. (2000) Protein Eng., 13, 565–574.[Abstract/Free Full Text]

Dübel,S., Breitling,F., Fuchs,P., Zewe,M., Gotter,S., Welschof,M., Moldenhauer,G. and Little,M. (1994) J. Immunol. Methods, 175, 89–95.[Web of Science][Medline]

Haisma,H.J., Sernee,M.F., Hooijberg,E., Brakenhoff,R.H., Van den Meulen-Mulleman,I.H., Pinedo,H.M. and Boven,E. (1998) Blood, 92, 184–190.[Abstract/Free Full Text]

Hellman,U., Wernstedt,C., Gonez,J. and Heldin,C.-H. (1995) Anal. Biochem., 224, 451–455.[Web of Science][Medline]

Holliger,P., Prospero,T. and Winter,G. (1993) Proc. Natl Acad. Sci. USA, 90, 6444–6448.[Abstract/Free Full Text]

Horton,R.M., Hunt,H.D., Ho,S.N., Pullen,J.K. and Pease,L.R. (1989) Gene, 77, 61–68.[Web of Science][Medline]

Iliades,P., Kortt,A.A. and Hudson,P.J. (1997) FEBS Lett., 409, 437–441.[Web of Science][Medline]

Jensen,M., Tan,G., Forman,S.J., Wu,A.M. and Raubitschek,A. (1998) Biol. Blood Marrow Transpl., 4, 75–83.[Medline]

Kabat,E.A., Wu,T.T., Perry,H.M., Gottesman,K.S. and Foeller,C. (1991). Sequences of Proteins of Immunological Interest. National Institutes of Health, Bethesda MD.

Le Gall,F., Kipriyanov,S.M., Moldenhauer,G. and Little,M. (1999) FEBS Lett., 453, 164–168.[Web of Science][Medline]

Li,S.-L., Liang,S.-J., Guo,N., Wu,A.M. and Fujita-Yamaguchi,Y. (2000) Cancer Immunol. Immunother., 49, 243–252.[Web of Science][Medline]

Liu,A.Y., Robinson,R.R., Murray,E.D.Jr, Ledbetter,J.A., Hellstrom,I. and Hellstrom,K.E. (1987) J. Immunol., 139, 3521–3526.[Abstract]

Liu,S.Y. et al. (1998) J. Clin. Oncol., 16, 3270–3278.[Abstract]

Loken,M.R., Shah,V.O., Datillio,K.L. and Civin,C.I. (1987) Blood, 70, 1316–1324.[Abstract/Free Full Text]

Maloney,D.G., Liles,T.M., Czerwinski,D.K., Waldichuk,C., Rosenberg,J., Grillo-Lopez,A. and Levy,R. (1994) Blood, 84, 2457–2466.[Abstract/Free Full Text]

Maloney,D.G., Grillo-Lopez,A.J., Bodkin,D.J., White,C.A., Liles,T.-M., Royston,I., Varns,C., Rosenberg,J. and Levy,R. (1997a) J. Clin. Oncol., 15, 3266–3274.[Abstract]

Maloney,D.G. et al.(1997b) Blood, 90, 2188–2195.[Abstract/Free Full Text]

Neumaier,M., Shively,L., Chen,F.S., Gaida,F.J., Ilgen,C., Paxton,R.J., Shively,J.E. and Riggs,A.D. (1990) Cancer Res., 50, 2128–2134.[Abstract/Free Full Text]

Novotny,J. and Haber,E. (1985) Proc. Natl Acad. Sci. USA, 82, 4592–4596.[Abstract/Free Full Text]

Pei,X.Y., Holliger,P., Murzin,A.G. and Williams,R.L. (1997) Proc. Natl Acad. Sci. USA, 94, 9637–9642.[Abstract/Free Full Text]

Pokkuluri,P.R., Cai,X., Johnson,G., Stevens,F.J. and Schiffer,M. (2000) Protein Sci., 9, 1852–1855.[Web of Science][Medline]

Press,O.W., Appelbaum,F., Ledbetter,J.A., Martin,P.J., Zarling,J., Kidd,P. and Thomas,E.D. (1987) Blood, 69, 584–591.[Abstract/Free Full Text]

Raffen,R., Stevens,P.W., Boogaard,C., Schiffer,M. and Stevens,F.J. (1998) Protein Eng., 11, 303–309.[Abstract/Free Full Text]

Roberts,M.R., Qin,L., Zhang,D., Smith,D.H., Tran,A.-C., Dull,T.J., Groopman,J.E., Capon,D.J., Byrn,R.A. and Finer,M.H. (1994) Blood, 84, 2878–2889.[Abstract/Free Full Text]

Shan,D., Press,O.W., Tsu,T.T., Hayden,M.S. and Ledbetter,J.A. (1999) J. Immunol., 162, 6589–6595.[Abstract/Free Full Text]

Shu,L., Qi,C.-F., Schlom,J. and Kashmiri,S.V.S. (1993) Proc. Natl Acad. Sci. USA, 90, 7995–7999.[Abstract/Free Full Text]

Slavin-Chiorini,D.C. et al. (1995) Cancer Res. (Suppl.), 55, 5957s–5967s.[Abstract/Free Full Text]

Stashenko,P., Nadler,L.M., Hardy,R. and Schlossman,S.F. (1980) J. Immunol., 125, 1678–1685.[Abstract]

Tan,P.H., Sandmaier,B.M. and Stayton,P.S. (1998) Biophys. J., 75, 1473–1482.[Web of Science][Medline]

Tedder,T.F. and Engel,P. (1994) Immunol. Today, 15, 450–454.[Web of Science][Medline]

Vose,J.M., Wahl,R.L., Saleh,M., Rohatiner,A.Z., Knox,S.J., Radford,J.A., Zelenetz,A.D., Tidmarsh,G.F., Stagg,R.J. and Kaminski,M.S. (2000) J. Clin. Oncol., 18, 1316–1323.[Abstract/Free Full Text]

Whitlow,M. et al. (1993) Protein Eng., 6, 989–995.[Abstract/Free Full Text]

Williams,L.E., Primus,F.J., Wong,J.Y.C., Wu,A.M., Odom-Maryon,T., Johnson,D.K., Hefta,L.J.F., Shively,J.E. and Raubitschek,A.A. (1995) Tumor Targeting, 2, 116–124.

Witzig,T.E. et al. (1999) J. Clin. Oncol., 17, 3793–3803.[Abstract/Free Full Text]

Wu,A.M., Chen,W., Raubitschek,A.A., Williams,L.E., Fischer,R., Hu,S., Odom-Maryon,T., Wong,J.Y.C. and Shively,J.E. (1996) Immunotechnology, 2, 21–36.[Web of Science][Medline]

Wu,A.M., Williams,L.E., Zieran,L., Padma,A., Sherman,M.A., Bebb,G.G., Odom-Maryon,T., Wong,J.Y.C., Shively,J.E. and Raubitschek,A.A. (1999) Tumor Targeting, 4, 47–58.

Received December 19, 2000; revised July 16, 2001; accepted August 6, 2001.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
S. N. Prince, E. J. Foulstone, O. J. Zaccheo, C. Williams, and A. B. Hassan
Functional evaluation of novel soluble insulin-like growth factor (IGF)-II-specific ligand traps based on modified domain 11 of the human IGF2 receptor
Mol. Cancer Ther., February 1, 2007; 6(2): 607 - 617.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E. A. Rossi, C.-H. Chang, M. J. Losman, R. M. Sharkey, H. Karacay, W. McBride, T. M. Cardillo, H. J. Hansen, Z. Qu, I. D. Horak, et al.
Pretargeting of Carcinoembryonic Antigen-Expressing Cancers with a Trivalent Bispecific Fusion Protein Produced in Myeloma Cells
Clin. Cancer Res., October 1, 2005; 11(19): 7122s - 7129s.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. D. Gillies, Y. Lan, S. Williams, F. Carr, S. Forman, A. Raubitschek, and K.-M. Lo
An anti-CD20-IL-2 immunocytokine is highly efficacious in a SCID mouse model of established human B lymphoma
Blood, May 15, 2005; 105(10): 3972 - 3978.
[Abstract] [Full Text] [PDF]


Home page
Protein Eng Des SelHome page
T. Olafsen, G. J. Tan, C.-w. Cheung, P. J. Yazaki, J. M. Park, J. E. Shively, L. E. Williams, A. A. Raubitschek, M. F. Press, and A. M. Wu
Characterization of engineered anti-p185HER-2 (scFv-CH3)2 antibody fragments (minibodies) for tumor targeting
Protein Eng. Des. Sel., April 1, 2004; 17(4): 315 - 323.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wu, A. M.
Right arrow Articles by Raubitschek, A. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, A. M.
Right arrow Articles by Raubitschek, A. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?