Protein Engineering, Vol. 14, No. 12, 1025-1033,
December 2001
© 2001 Oxford University Press
Multimerization of a chimeric anti-CD20 single-chain Fv-Fc fusion protein is mediated through variable domain exchange
1 Department of Molecular Biology, 3 Divison of Biology, Beckman Research Institute of the City of Hope, 1450 East Duarte Road, Duarte, CA 91010, 4 Department of Radioimmunotherapy and 6 Division of Hematology/Bone Marrow Transplantation, City of Hope National Medical Center, 1500 East Duarte Road, Duarte, CA 91010, USA
| Abstract |
|---|
|
|
|---|
A series of single-chain anti-CD20 antibodies was produced by fusing single-chain Fv (scFv) with human IgG1 hinge and Fc regions, designated scFv-Fc. The initial scFv-Fc construct was assembled using an 18 amino acid (aa) linker between the antibody light- and heavy-chain variable regions, with the Cys residue in the upper hinge region (Kabat 233) mutagenized to Ser. Anti-CD20 scFv-Fc retained specific binding to CD20-positive cells and was active in mediating complement-dependent cytolysis. Size-exclusion HPLC analysis revealed that the purified scFv-Fc included multimeric as well as monomeric components. Variant scFv-Fcs were constructed incorporating four different hinges between the scFv and Fc regions, or three different linkers in the scFv domain. All formed multimers, with the highest level of multimerization found in the scFv-Fc with the shortest linker (8 aa). Elimination of an unusual salt bridge between residues L38 and H89 in the VL-VH domain interface failed to reduce the formation of higher order forms. Structural analysis of the scFv-Fc constructed with 18 or 8 aa linkers by pepsin or papain cleavage suggested the proteins contained a form in which scFv units had cross-paired to form a `diabody'. Thus, domain exchange or cross-pairing appears to be the basis of the observed multimerization.
Keywords: chimeric scFv-Fc/hinge/multimerization/scFv linker/variable domain interaction
| Introduction |
|---|
|
|
|---|
Immunotherapeutic approaches to the treatment of cancer and other diseases in humans have been greatly facilitated by the advent of genetically engineered antibodies. Recombinant technology has allowed investigators to combine antigen specificity with desired biological functions and to manipulate the biochemical and pharmacologic/pharmacokinetic characteristics of antibodies. For example, chimerization or humanization of murine monoclonal antibodies to reduce immunogenicity has been an essential step in permitting repeated administration of antibodies to patients. Manipulation of the size and domain structure of engineered antibody fragments can influence the rate and route of clearance of antibodies. Furthermore, fusion of light- and heavy-chain variable regions to create single-chain Fv (scFv) can be used to produce an antigen-combining unit in a single polypeptide, encoded by a single gene. This scFv format readily lends itself to assembly and production of larger constructs and fusion proteins and can streamline the process of attaining high level expression of recombinant antibodies, as only a single polypeptide must be expressed.
A single-chain immunoglobulin-like molecule consisting of the heavy- and light-chain variable regions of the CC49 anti-TAG-72 antibody, fused to the human
1 hinge and Fc effectively recreates an intact immunoglobulin (Shu et al., 1993
). The protein assembled into a dimeric molecule which retained antigen binding and was active in cytotoxicity assays. Biodistribution studies of radioiodinated protein demonstrated that this engineered fragment (referred to as cCC49
CH1) retained excellent localization to LS174T xenografts in athymic mice and exhibited a serum persistence similar to that of intact antibody (Slavin-Chiorini et al., 1995
).
CD20-positive B-cell malignancies are an attractive target for antibody therapy. The CD20 antigen is an integral transmembrane protein expressed by cells in the B-lineage from B-cell precursors through mature B cells, but not plasma cells (Stashenko et al., 1980
; Loken et al., 1987
). This 3337 kDa phosphoprotein, thought to play a role in calcium conductance, is not internalized or down-modulated, making it an ideal target for exogenous antibody-based therapies (Tedder and Engel, 1994
). Unmodified anti-CD20 murine or chimeric antibodies have been demonstrated to be effective in inducing regression of B-cell lymphomas(Press et al., 1987
; Horton et al., 1989
). The chimeric anti-CD20 antibody, C2B8 (rituximab; Rituxan), has been extensively evaluated in patients with recurrent B-cell lymphoma (Maloney et al., 1994
, 1997a
, b
), leading to recent FDA licensure. The efficacy of anti-CD20 antibodies can be further enhanced by radiolabeling with therapeutic isotopes such as 131I or 90Y (Liu et al., 1998
; Witzig et al., 1999
; Vose et al., 2000
).
In the present study, a single-chain chimeric anti-CD20 antibody has been produced for potential use in immunotherapy or radioimmunotherapy of lymphoma. The protein encompasses an scFv, assembled VL-linker-VH and the human IgG1 hinge and Fc regions (abbreviated scFv-Fc). When expressed in murine myeloma cells, this anti-CD20 scFv-Fc self-assembled into a 104 kDa unit dimer, as well as a series of discrete higher molecular weight forms, which retained high specificity and affinity for CD20. This study reports biological and biochemical analysis of several variant forms of this anti-CD20 antibody in order to evaluate the region(s) contributing to multimerization.
| Methods |
|---|
|
|
|---|
Cloning of anti-CD20 variable regions
Variable region genes were amplified from an anti-CD20 hybridoma (Leu-16; a gift of BD, Franklin Lakes, NJ) by RT-PCR using kappa light-chain upstream primer VKBi8 or heavy-chain upstream primer VHBi3d from Dübel et al. (Dübel et al., 1994
). Downstream primers were: murine kappa constant region [5'-d(CGGAATTCGGATGGTGGGAAGATGGA)] or murine heavy-chain constant region [5'-d(CGGAATTCAGGGGCCAGTGGATAGAC)]. PCR products were purified, cloned into T-tailed Bluescript (Stratagene, La Jolla, CA) and isolates were confirmed by DNA sequence analysis.
Sequence analysis of parental anti-CD20 antibody
Protein sequence information from the anti-CD20 antibody was obtained by N-terminal sequence analysis of the intact heavy and light chains and their corresponding tryptic peptides. Following reduction and alkylation, the heavy and light chains were separated by SDSPAGE. In situ tryptic digests were performed according to Hellman et al. (Hellman et al., 1995
). Peptides were extracted, separated by microcapillary HPLC and collected manually. The collected fractions were analyzed by Edman degradation and liquid chromatography-tandem mass spectrometry (LC-MS/MS) as described by Davis and Lee (Davis and Lee, 1997
).
Design and construction of anti-CD20 scFv-Fc
Single-chain Fv fusion proteins were constructed from the anti-CD20 antibody as shown in Figure 1
. Constructs included a consensus ribosome-binding sequence and the signal peptide from a murine kappa light chain previously used for high level mammalian antibody secretion (Williams et al., 1995
). The N-terminal sequences of the first 8 amino acids (aa) of VH and the first 10 aa residues of VL in the fusion protein were derived from the consensus primers used to amplify the variable region genes. In order to provide a long, flexible joint between VL and VH, the initial construct included the peptide sequence GSTSGGGSGGGSGGGGSS (designated GS18). The upper hinge Cys233 (Kabat numbering system) in the human IgG1 hinge-Fc cDNA (from J.Scholm, NCI Bethesda, MD) was mutated to serine to create the C233S/GS18 scFv-Fc; Cys233 is normally disulfide bonded to the C-terminus of C
.
|
Fusion of gene segments encoding the anti-CD20 scFv and human IgG1 Fc were produced by splice overlap extension as previously described (Wu et al., 1996
Mammalian expression
Anti-CD20 single-chain-Fc DNA fragments were inserted into the pEE12 expression vector (glutamine synthetase+, Lonza Biologics, Slough, UK) (Bebbington, 1991
; Bebbington et al., 1992
) using flanking XbaI and EcoRI sites and linearized using a unique SalI site. In a 0.4 cm gap cuvette, 40 µg of linearized DNA in sterile water was electroporated into 1x107 NS0 cells (provided by Lonza Biologics) in PBS with a Bio-Rad Gene Pulser set to 1.5 kV and 3 µF capacitance. Cells were plated at 1.2x104 cells/well in 96-well plates in non-selective media. Twenty-four hours post-electroporation, glutamine-deficient media was added 4:1 (v/v) and cells were allowed to recover and grow undisturbed for 3 weeks.
Supernatants of transformed cells able to grow under glutamine-free conditions were screened for antibody secretion by sandwich ELISA. Briefly, EIA plates (Costar, Cambridge, MA) were coated with goat-anti-human Fc (Jackson ImmunoResearch, West Grove, PA). Sample supernatant, controls or serial dilutions of a standard purified chimeric antibody (Neumaier et al., 1990
) were added and alkaline-phosphatase conjugated anti-human IgG (diluted 1:20 000, Jackson ImmunoResearch) was used for detection. High-producing clones were grown and expanded under selective conditions. In order to produce sufficient quantities of scFv-Fc, some clones were transferred and grown in a Cell-Max Bioreactor with a 10 kDa MW filter (Spectrum Cellco Division, Laguna, CA) as per the manufacturer's protocol.
Purification and characterization of engineered anti-CD20
Engineered scFv-Fc anti-CD20 antibodies were purified from cell culture supernatants by Protein A chromatography using a Thermal Separations Products HPLC with an in-line UV monitor, equipped with a preparative Poros 50 A column (Applied Biosystems, Foster City, CA). Supernatants were loaded onto a 10x50 mm column and eluted using a 0.1 M sodium citrate/citric acid gradient (pH 8.02.1). ScFv-Fcs were size-fractionated on tandem Superose 6 columns (Pharmacia, Piscataway, NJ) in 50 mM Na2SO4/20 mM NaH2PO4, pH 7.2. Protein peaks were concentrated and dialyzed using a Slidealyzer (10 kDa cutoff; Pierce, Rockford, IL) into PBS. Final protein concentrations were determined by measuring UV absorbance at 280 nm, using the parental murine antibody as the standard.
Small-scale preparative fractionation of the scFv-Fcs for complement-dependent cytolysis (CDC) assay was conducted using a 4.6x100 cm Poros 20 A/M Protein A column (Applied Biosystems), with the gradient elution described above. Fractions were collected and subjected to size analysis on tandem Superose 6 columns (Pharmacia) as above. Alternately, molecular weight variants for proteolytic digestion were separated by step elution at pH 2.1 from Protein A followed by hydrophobic interaction chromatography (HIC) on a 1 ml Resource ISO column (Pharmacia). Protein was eluted using a gradient from 1.5 M ammonium sulfate/50 mM sodium phosphate (pH 7.0) to 0.1 M sodium chloride/50 mM sodium phosphate (pH 7.0).
Competitive cell-binding assay
Daudi cells (ATCC CCL 213) were stained with FITC-conjugated Leu-16 (BD) and anti-CD20 scFv-Fc or unlabeled Leu-16 were added to compete for CD20 cell-surface binding. A total of 2x104 cells/tube were washed and suspended in HBSS/0.1% human serum albumin/0.01% NaN3. To each tube a mixture of 0.5 µg of FITC-Leu-16 and dilutions of either the anti-CD20 scFv-Fc as competitor or unlabeled Leu-16 as standard was added. Following a 30 min incubation on ice, cells were washed, resuspended in PBS and analyzed on a MoFlo cytometer (Cytomation, Fort Collins, CO).
CDC assay of engineered anti-CD20 antibodies
Target Daudi B-cells were labeled with 51Cr, washed and incubated in triplicate with serial dilutions of the scFv-Fc or control murine (Leu-16) or chimeric (rituximab; IDEC Phamaceuticals, San Diego, CA) anti-CD20 antibody. Rituximab represents a species- and isotype-matched control (human IgG1 constant regions). Rabbit complement (Pel-Freeze Biologicals, Roger, AR) diluted 1:20 in complete media was added and plates incubated for 1 h at 37°C. Following centrifugation at 500 r.p.m. (50 g) for 6 min, supernatants were removed and counted in a gamma counter. Controls and standards in triplicate included: background (cells only), maximum release (target cells plus 2% SDS), positive control (rituximab and complement) and complement cytotoxity (cells plus complement only). K-562 cells (ATCC CCL 243) were used as the negative control. The following formula was used to calculate % maximum release:
![]() |
Papain digestion of scFv-Fc variants
Monomer and multimer protein fractions of scFv-Fcs with 8 or 18 aa linkers were separated by HIC as described above. Monomer and multimer fractions were collected and dialyzed against 20 mM sodium phosphate/10 mM EDTA (pH 7.0). Samples were concentrated with Centriprep YM-30 MW filters (Amicon, Beverly, MA) and cleaved using immobilized papain (Pierce, Rockford, IL) according to Pierce protocol #20341 for 13 h. Protein A chromatography, as described above, separated the proteolytic products into Fc-fragments (bound) and non-Fc-species (flow through). The flow through fraction was further analyzed by size-exclusion chromatography (SEC-HPLC) on Superdex 75 (Pharmacia) with PBS (pH 7.0) or by SDSPAGE.
Pepsin digestion of GS18/C233S scFv-Fc
The monomer fraction of GS18/C233S was purified via Protein A and HIC as described and dialyzed against 20 mM sodium acetate (pH 4.5). The sample was concentrated as above and the scFv-Fc was cleaved using immobilized pepsin (Pierce) according to Pierce protocol #20343 for 3.25 h. Digested protein was passed over a Protein A column to remove Fc-containing fragments. Flow through material was analyzed on Superdex 75 under non-reducing or reducing (100 mM DTT) conditions and by SDSPAGE.
| Results |
|---|
|
|
|---|
Confirmation of cloning of anti-CD20 variable regions
Using universal antibody primers, clones encoding heavy- and light-chain variable regions were successfully amplified from total RNA extracted from an anti-CD20 hybridoma. Comparison of the predicted amino acid sequences to published sequences (Kabat et al., 1991
) suggested that the VH belonged to murine heavy-chain subgroup IIA while the VL was a member of murine kappa subgroup VI. The identity of the isolated clones was confirmed by comparison of the predicted tryptic digestion products to protein sequence data obtained from the parental murine antibody (Figure 1B
). Edman degradation and LC-MS/MS analysis demonstrated the presence of tryptic peptides corresponding to all three complementary determining regions (CDRs) of the kappa chain and two CDRs of the heavy-chain variable region (Figure 1B
).
Production and characterization of GS18/C233S scFv-Fc
The initial anti-CD20 single-chain Fv-Fc protein was assembled using an 18 aa linker between the light- and heavy-chain variable regions and the C233S variant of the human IgG1 hinge-Fc (termed GS18/C233S scFv-Fc, Figure 1
). Expression using the pEE12/NS0 system yielded antibody protein levels of 100200 µg/ml in cell culture supernatants as determined by ELISA. Western blot analysis (non-reducing) of supernatants demonstrated production of a protein reactive with anti-human Fc antibody with a migration consistent with the predicted moleular weight of 104 kDa for the scFv-Fc (not shown). We refer to this form as the scFv-Fc monomer.
The GS18/C233S scFv-Fc was initially purified by Protein A chromatography. SDSPAGE analysis showed that under non-reducing conditions (Figure 2A
), the bulk of the protein was comprised of the expected 104 kDa disulfide-linked scFv-Fc monomer; while under reducing conditions, the 52 kDa polypeptide subunit was the predominant species (Figure 2B
). However, analysis of the native protein by SEC-HPLC indicated that in addition to the expected 104 kDa scFv-Fc monomer, a discrete series of higher order multimers was present in the GS18/C233S variant (Figure 3A
). By peak integration, the 104 kDa monomer was estimated to be 42% of the total purified protein suggesting that the engineered anti-CD20 scFv-Fc preferably formed larger protein aggregates. When analyzed by non-reducing SDSPAGE, the multimer variants were of the same molecular weight as the 104 kDa monomer (Figure 4A
), indicating that the interactions within the higher molecular weight species resulted from non-covalent interactions between the 104 kDa monomers.
|
|
|
Binding and biological activity of purified anti-CD20 scFv-Fc
The engineered single-chain GS18/C233S as well as the GS8/nat anti-CD20 scFv-Fc, described in Figure 1
and below, retained full antigen-binding activity and potent biological activity. Relative affinity was assessed by testing the ability of the anti-CD20 scFv-Fc monomeric fraction, to compete with FITC-Leu-16 for binding to Daudi cells. As shown in Figure 5
, on a microgram to microgram basis, both GS18/C233S and GS8/nat anti-CD20 scFv-Fc were comparable to parental Leu-16 in their ability to compete with FITC-Leu-16, indicating retention of high affinity.
|
The biological activity of the chimeric single-chain GS18/C233S anti-CD20 was assessed in CDC with rituximab as a standard. This scFv-Fc was fractionated into 104 kDa monomer, 210 kDa dimer, oligomer and multimer components by Protein A gradient elution followed SEC-HPLC on tandem Superose 6 columns. Figure 6A and B
|
Evaluation of alternate hinge, linker and framework sequences
The original scFv-Fc fusion protein contained a flexible linker between VL and VH, as well as an extended and potentially exposed upper hinge due to the C233S mutation. We surmised that the observed multimerization might result from misassembly due to the presence of this extended hinge. To evaluate this hypothesis, additional scFv-Fc constructs were made, all retaining the GS18 linker in the scFv portion of the protein, but incorporating three alternative hinges (Figure 1
). These included restoration of Cys233 to give the native sequence (nat); formation of a disulfide bridge between the Cys233 residues should result in a more condensed conformation of the upper hinge. In a second version, the upper hinge was truncated by deletion of 5 aa residues through Cys233 (
5), analogous to the scFv-Fc fusion used by Roberts et al. (Roberts et al., 1994
). The final variant was constructed incorporating a Cys to Pro mutation at residue 233 (C233P), used previously by Kashmiri et al. in the original CC49 scFv-Fc construct (Shu et al., 1993
). Protein was purified by Protein A chromatography using a step elution and the products analyzed by SDSPAGE and SEC-HPLC. These protein variants show similar mobilities under both non-reducing or reducing conditions (Figure 2A and B
) as compared to the original scFv-Fc fusion. Of interest, size analysis by tandem Superose 6 chromatography indicated that regardless of the hinge sequence incorporated in the protein, the scFv-Fc proteins formed a series of multimers (Figure 3
). Quantitation of the series by integration of peak heights (Table I
) suggested that the degree of multimerization could be reduced. However, assembly of higher order multimers of the anti-CD20 scFv-Fc was not significantly inhibited by changes in the upper hinge.
|
Alternatively, linker length or sequence between the variable regions may play a causative role in multimer formation. In addition to the expected self-association of the linked VL and VH domains within an scFv-Fc subunit, these variable regions could interact with the corresponding variable regions on the other scFv-Fc subunit. This would result in a cross-paired structure, or `diabody' (Holliger et al., 1993
|
An additional mechanism that might have contributed to multimerization is the presence of two uncommon residues, Lys at position L38 and Asp at position H89 in the Leu-16 VL-VH interface. The most frequently observed residue at L38 is Gln (94%) and at H89 it is Val (59%) (Chothia et al., 1985
Papain proteolytic probing of Fv conformation
The conformation of the Fv regions of two versions of the scFv-Fc (GS18/C233S and GS8/nat) were investigated by subjecting purified monomeric or multimeric protein fractions to proteolytic digestion with papain. Papain digestion, which normally cleaves above the hinge disulfides in intact Ig and releases Fab fragments, should either liberate scFv fragments or diabodies from the scFv-Fc proteins, depending on the initial arrangement of the variable regions (Figure 7
). The GS18/C233S and GS8/nat were separated into monomeric and multimeric fractions by HIC. Following papain digestion, protein fragments were separated by Protein A chromatography yielding bound (Fc) and flow-through (containing the variable domains) fractions.
Analysis of the flow-through fraction by SEC-HPLC on Superdex 75 showed that papain digestion of GS18/C233S monomer and multimer (Figure 8A
) yielded a predominant peak at 23.2 min consistent with a 27 kDa scFv as well as a smaller peak at 19.5 min indicative of the 54 kDa diabody form. Monomeric GS8/nat scFv-Fc liberated the cross-paired 52.8 kDa diabody form (Figure 8B
) eluting at 20.7 min. The SDSPAGE results revealed that GS8/nat papain digested material migrates around 25 kDa, consistent with the size expected for SDS-disassociated diabody (data not shown). However, SDSPAGE analysis of papain digested GS18/C233S flow-through material yielded low molecular weight bands, suggesting that papain cleaves inside the scFv in a discrete fashion. This result may stem from a diabody conformation that exposes linker residues, thereby affording papain other cleavage sites (Figure 7
).
|
As expected, the GS8/nat diabody-Fc multimeric protein fraction also yielded a series of higher molecular weight species (Figure 8B
Pepsin proteolytic digest of GS18/C233S
In order to examine the conformational structure of GS18/C233S, pepsin digests were performed on the monomer. Pepsin digestion of intact immunoglobulins normally cleaves below the hinge disulfides, yielding F(ab')2 fragments. Digestion of the scFv-Fc should either liberate two scFvs linked covalently via the hinge disulfides or a two-chain disulfide-linked diabody (Figure 9
). As both fragments have equivalent mass, distinguishing between the two conformations would require size analysis under reducing conditions. Under reducing conditions, the two covalently-linked scFvs should resolve into a 28 kDa fragment while the diabody would remain at 55 kDa due to the non-covalent interactions between cross-paired variable regions (Figure 9
).
|
Pepsin digestion yielded information that the variable regions of GS18/C233S scFv-Fc exist in a scFv as well as a diabody conformation. Pepsin digested material passed through a Protein A column to remove Fc-containing products and size fractionated over a Superdex 75 column under standard (non-reducing) conditions gave a single peak corresponding to 55 kDa, consistent with the above predicted fragments (Figure 10
|
| Discussion |
|---|
|
|
|---|
Cloned variable regions of the anti-CD20 antibody were assembled to produce a recombinant antibody that would retain the antigen-binding properties of the parental murine monoclonal antibody, in a single polypeptide chain. The single-chain variable region (scFv) was engineered using the long, flexible GS18 linker peptide based on studies showing that longer linkers reduce multimerization by single-chain Fv proteins (Whitlow et al., 1993
The anti-CD20 GS18/C233S exhibited many of the desired properties. In particular, the GS18/C233S scFv-Fc was comparable to the parental Leu-16 antibody in its ability to compete with FITC-Leu-16 in a cell-surface binding assay. Furthermore, potent biological activity was demonstrated in CDC assays, particularly by oligomeric fractions of the scFv-Fc. Preliminary biodistribution studies of radioiodinated monomeric GS18/C233S and GS8/nat anti-CD20 scFv-Fc in scid mice xenografted with CD20-positive Daudi tumor cells show comparable tumor targeting and blood clearance properties as compared to radioiodinated Leu-16 (data not shown). This scFv-Fc is also active in vivo as the extracellular component of a chimeric T-cell receptor that has been shown to redirect cytolytic T cells toward CD20-positive targets (Jensen et al., 1998
). The GS8/nat diabody-Fc monomeric fraction was also able to mediate apoptosis of CD20+ Ramos B-cells using a FITC-Annexin-V flow cytometry assay. However, optimal results of >75% apoptosis required cross-linking of the diabody-Fc with an anti-human secondary reagent (Daming Shan, Oliver Press, personal communication).
Size analysis of the purified scFv-Fc protein unexpectedly revealed that the majority of the protein had self-assembled into a discrete series of higher order multimers. SDSPAGE analysis under non-reducing conditions demonstrated that all the higher molecular weight species were based on the disulfide-bonded 104 kDa scFv-Fc. A systematic approach was used to identify factors responsible for multimer formation in this scFv-Fc. Incorporation of three different hinges (nat,
5, or C233P) did not inhibit multimerization. An alternate hypothesis that the flexible linker contributed to the formation of higher molecular weight variants was investigated by altering the sequence to either a modified 218 linker or an 8 aa GS8 linker. However these mutations did not prevent multimer formation; instead GS8 exhibited increased multimerization.
Examination of a Leu-16 molecular model revealed an unusual potential salt bridge in the variable region interface. We postulated that formation of the buried salt bridge might be energetically favored in the context of a cross-paired dimer versus a monomeric scFv since L38 is known to affect the energetics and orientation of Ig-domain pairing (Raffen et al., 1998
; Tan et al., 1998
; Pokkuluri et al., 2000
). However, replacement of L38 and H89 with consensus residues that restore the normal H-bonded pair between L38 and H39 did not reduce multimerization (data not shown).
Multimerization appears driven by the intermolecular pairing of variable regions of this scFv-Fc. Pei et al. purified and determined the crystal structure of a triabody, revealing a domain-swapped trimer (Pei et al., 1997
), and an analogous model for a tetrabody has been proposed (Dolezal et al., 2000
). Similarly, variable domain exchange between different scFv-Fc molecules could result in non-covalent multimeric structures such as that shown in Figure 11
. SDSPAGE analysis of the various scFv-Fcs shows that multimeric fractions are built up from the disulfide-linked monomer while papain and pepsin digestion of the GS18/C233S and GS8/nat scFv-Fcs show that the Fv domains are capable of forming both scFv as well as diabody structures. This cross-pairing hypothesis has been further investigated by assembling just the anti-CD20 scFv with an 8 aa linker to produce diabodies. Non-reducing SDSPAGE of this protein yielded a band of 26 kDa consistent with a VL-VH subunit. As expected, SEC-HPLC on Superdex 75 revealed the presence of 55 kDa diabodies as well as a spectrum of higher molecular weight protein products analogous to the multimers observed in the scFv-Fc constructs (data not shown). In contrast, an identical construct (VL-8 aa-VH) generated from a different antibody (T84.66) existed exclusively as 55 kDa diabodies (Wu et al., 1999
). This supports the hypothesis that cross-pairing of the Leu-16 variable regions is the basis of the multimerization of the scFv-Fc constructs. The strength of the cross-pairing interactions and the stability of the multimers remain open questions. Prolonged storage (>1 month at 4°C) of scFv-Fc-containing cell culture supernatants resulted in an apparent increase in monomeric forms of the scFv-Fc (unpublished). This observation is consistent with previous studies of an anti-CEA antibody showing a concentration dependence of scFv-diabody interconversion (Wu et al., 1996
). ScFv and diabody fractions were purified and remained stable when stored at low concentration. By contrast, when the fractions were concentrated and stored, the forms interconverted, regenerating mixtures of scFv and diabodies.
|
Our results differ from those of Shan et al., who constructed scFv-Ig from the 1F5 anti-CD20 antibody and observed primarily 55 kDa monomeric subunits (Shan et al., 1999
In summary, a chimeric single-chain form of an anti-CD20 antibody (scFv-Fc) has been produced with properties suited for further development as an immunotherapeutic for B-cell leukemias and lymphomas, including retention of antigen-binding and high complement-dependent cytolytic activity. However, this single-chain antibody demonstrated a strong propensity to multimerize. We postulate that during synthesis of an scFv-Fc subunit, the newly folded variable regions are somehow juxtaposed to the variable regions of a separate scFv-Fc subunit and exchange domains as the nascent polypeptides are extruded from the polysomes. Further investigation of the residues that interact at the VL-VH interface or framework residues that affect folding rates, may provide insight into the dynamic process of assembly of these multimers. Alternately, strategies such as lengthening the linker between VL and VH, or modifying hydrophobic residues that are exposed at the base of the Fvs, in this type of construct may favor formation of a stable monomeric form. Such studies should prove worthwhile in elucidating factors that influence domain assembly as well as provide direction for future antibody design and construction.
| Notes |
|---|
5 Present address: Chicago Medical School, 3333 Green Bay Road, North Chicago, IL 60064, USA
2 To whom correspondence should be addressed. A.M.Wu and G.J.Tan contributed equally to this work. ![]()
| Acknowledgments |
|---|
The authors are grateful for the expert technical assistance of Millie Martinez, Christine Wright and Lucy Brown. Support services were provided by the Molecular Modeling, DNA Synthesis, DNA Sequencing, Protein Microsequencing and Flow Cytometry Core Facilities of the City of Hope Cancer Center. This work was supported by grants from the National Institutes of Health (CA 30206, CA 43904 and Cancer Center Support Grant CA 33572).
| References |
|---|
|
|
|---|
Alfthan,K., Takkinen,K., Sizmann,D., Soderlund,H. and Teeri,T.T. (1995) Protein Eng., 8, 725731.
Anderson,D.R., Hanna,N., Leonard,J.E., Newman,R.A., Reff,M.E. and Rastetter,W.H. (1998) Therapeutic application of chimeric and radiolabeled antibodies to human B lymphocytes restricted differentiation antigen for treatment of B cell lymphoma. U.S. Patent No. 5, 736, 137.
Bebbington,C.R. (1991) Methods: Methods Enzymol., 2, 136145.
Bebbington,C.R., Renner,G., Thomson,S., King,D., Abrams,D. and Yarranton,G.T. (1992) Bio/Technology, 10, 169175.[Medline]
Chothia,C., Novotny,J. and Bruccoleri,R. (1985) J. Mol. Biol., 186, 651663.[Web of Science][Medline]
Davis,M.T. and Lee,T.D. (1997) J. Am. Soc. Mass Spectrometry, 8, 10591069.
Desplancq,D., King,D.J., Lawson,A.D.G. and Mountain,A. (1994) Protein Eng., 7, 10271033.
Dolezal,O., Pearce,L.A., Lawrence,L.J., McCoy,A.J., Hudson,P.J. and Kortt,A.A. (2000) Protein Eng., 13, 565574.
Dübel,S., Breitling,F., Fuchs,P., Zewe,M., Gotter,S., Welschof,M., Moldenhauer,G. and Little,M. (1994) J. Immunol. Methods, 175, 8995.[Web of Science][Medline]
Haisma,H.J., Sernee,M.F., Hooijberg,E., Brakenhoff,R.H., Van den Meulen-Mulleman,I.H., Pinedo,H.M. and Boven,E. (1998) Blood, 92, 184190.
Hellman,U., Wernstedt,C., Gonez,J. and Heldin,C.-H. (1995) Anal. Biochem., 224, 451455.[Web of Science][Medline]
Holliger,P., Prospero,T. and Winter,G. (1993) Proc. Natl Acad. Sci. USA, 90, 64446448.
Horton,R.M., Hunt,H.D., Ho,S.N., Pullen,J.K. and Pease,L.R. (1989) Gene, 77, 6168.[Web of Science][Medline]
Iliades,P., Kortt,A.A. and Hudson,P.J. (1997) FEBS Lett., 409, 437441.[Web of Science][Medline]
Jensen,M., Tan,G., Forman,S.J., Wu,A.M. and Raubitschek,A. (1998) Biol. Blood Marrow Transpl., 4, 7583.[Medline]
Kabat,E.A., Wu,T.T., Perry,H.M., Gottesman,K.S. and Foeller,C. (1991). Sequences of Proteins of Immunological Interest. National Institutes of Health, Bethesda MD.
Le Gall,F., Kipriyanov,S.M., Moldenhauer,G. and Little,M. (1999) FEBS Lett., 453, 164168.[Web of Science][Medline]
Li,S.-L., Liang,S.-J., Guo,N., Wu,A.M. and Fujita-Yamaguchi,Y. (2000) Cancer Immunol. Immunother., 49, 243252.[Web of Science][Medline]
Liu,A.Y., Robinson,R.R., Murray,E.D.Jr, Ledbetter,J.A., Hellstrom,I. and Hellstrom,K.E. (1987) J. Immunol., 139, 35213526.[Abstract]
Liu,S.Y. et al. (1998) J. Clin. Oncol., 16, 32703278.[Abstract]
Loken,M.R., Shah,V.O., Datillio,K.L. and Civin,C.I. (1987) Blood, 70, 13161324.
Maloney,D.G., Liles,T.M., Czerwinski,D.K., Waldichuk,C., Rosenberg,J., Grillo-Lopez,A. and Levy,R. (1994) Blood, 84, 24572466.
Maloney,D.G., Grillo-Lopez,A.J., Bodkin,D.J., White,C.A., Liles,T.-M., Royston,I., Varns,C., Rosenberg,J. and Levy,R. (1997a) J. Clin. Oncol., 15, 32663274.[Abstract]
Maloney,D.G. et al.(1997b) Blood, 90, 21882195.
Neumaier,M., Shively,L., Chen,F.S., Gaida,F.J., Ilgen,C., Paxton,R.J., Shively,J.E. and Riggs,A.D. (1990) Cancer Res., 50, 21282134.
Novotny,J. and Haber,E. (1985) Proc. Natl Acad. Sci. USA, 82, 45924596.
Pei,X.Y., Holliger,P., Murzin,A.G. and Williams,R.L. (1997) Proc. Natl Acad. Sci. USA, 94, 96379642.
Pokkuluri,P.R., Cai,X., Johnson,G., Stevens,F.J. and Schiffer,M. (2000) Protein Sci., 9, 18521855.[Web of Science][Medline]
Press,O.W., Appelbaum,F., Ledbetter,J.A., Martin,P.J., Zarling,J., Kidd,P. and Thomas,E.D. (1987) Blood, 69, 584591.
Raffen,R., Stevens,P.W., Boogaard,C., Schiffer,M. and Stevens,F.J. (1998) Protein Eng., 11, 303309.
Roberts,M.R., Qin,L., Zhang,D., Smith,D.H., Tran,A.-C., Dull,T.J., Groopman,J.E., Capon,D.J., Byrn,R.A. and Finer,M.H. (1994) Blood, 84, 28782889.
Shan,D., Press,O.W., Tsu,T.T., Hayden,M.S. and Ledbetter,J.A. (1999) J. Immunol., 162, 65896595.
Shu,L., Qi,C.-F., Schlom,J. and Kashmiri,S.V.S. (1993) Proc. Natl Acad. Sci. USA, 90, 79957999.
Slavin-Chiorini,D.C. et al. (1995) Cancer Res. (Suppl.), 55, 5957s5967s.
Stashenko,P., Nadler,L.M., Hardy,R. and Schlossman,S.F. (1980) J. Immunol., 125, 16781685.[Abstract]
Tan,P.H., Sandmaier,B.M. and Stayton,P.S. (1998) Biophys. J., 75, 14731482.[Web of Science][Medline]
Tedder,T.F. and Engel,P. (1994) Immunol. Today, 15, 450454.[Web of Science][Medline]
Vose,J.M., Wahl,R.L., Saleh,M., Rohatiner,A.Z., Knox,S.J., Radford,J.A., Zelenetz,A.D., Tidmarsh,G.F., Stagg,R.J. and Kaminski,M.S. (2000) J. Clin. Oncol., 18, 13161323.
Whitlow,M. et al. (1993) Protein Eng., 6, 989995.
Williams,L.E., Primus,F.J., Wong,J.Y.C., Wu,A.M., Odom-Maryon,T., Johnson,D.K., Hefta,L.J.F., Shively,J.E. and Raubitschek,A.A. (1995) Tumor Targeting, 2, 116124.
Witzig,T.E. et al. (1999) J. Clin. Oncol., 17, 37933803.
Wu,A.M., Chen,W., Raubitschek,A.A., Williams,L.E., Fischer,R., Hu,S., Odom-Maryon,T., Wong,J.Y.C. and Shively,J.E. (1996) Immunotechnology, 2, 2136.[Web of Science][Medline]
Wu,A.M., Williams,L.E., Zieran,L., Padma,A., Sherman,M.A., Bebb,G.G., Odom-Maryon,T., Wong,J.Y.C., Shively,J.E. and Raubitschek,A.A. (1999) Tumor Targeting, 4, 4758.
Received December 19, 2000; revised July 16, 2001; accepted August 6, 2001.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
S. N. Prince, E. J. Foulstone, O. J. Zaccheo, C. Williams, and A. B. Hassan Functional evaluation of novel soluble insulin-like growth factor (IGF)-II-specific ligand traps based on modified domain 11 of the human IGF2 receptor Mol. Cancer Ther., February 1, 2007; 6(2): 607 - 617. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Rossi, C.-H. Chang, M. J. Losman, R. M. Sharkey, H. Karacay, W. McBride, T. M. Cardillo, H. J. Hansen, Z. Qu, I. D. Horak, et al. Pretargeting of Carcinoembryonic Antigen-Expressing Cancers with a Trivalent Bispecific Fusion Protein Produced in Myeloma Cells Clin. Cancer Res., October 1, 2005; 11(19): 7122s - 7129s. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Gillies, Y. Lan, S. Williams, F. Carr, S. Forman, A. Raubitschek, and K.-M. Lo An anti-CD20-IL-2 immunocytokine is highly efficacious in a SCID mouse model of established human B lymphoma Blood, May 15, 2005; 105(10): 3972 - 3978. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Olafsen, G. J. Tan, C.-w. Cheung, P. J. Yazaki, J. M. Park, J. E. Shively, L. E. Williams, A. A. Raubitschek, M. F. Press, and A. M. Wu Characterization of engineered anti-p185HER-2 (scFv-CH3)2 antibody fragments (minibodies) for tumor targeting Protein Eng. Des. Sel., April 1, 2004; 17(4): 315 - 323. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||















