Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Hrzenjak, A.
Right arrow Articles by Malle, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hrzenjak, A.
Right arrow Articles by Malle, E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Protein Engineering, Vol. 14, No. 12, 949-952, December 2001
© 2001 Oxford University Press


COMMUNICATION

Silent mutations in secondary Shine–Dalgarno sequences in the cDNA of human serum amyloid A4 promotes expression of recombinant protein in Escherichia coli

Andelko Hrzenjak, Andreas Artl, Gabriele Knipping, Gerhard Kostner, Wolfgang Sattler and Ernst Malle,1

Karl-Franzens University Graz, Institute of Medical Biochemistry and Molecular Biology, Harrachgasse 21, A-8010 Graz, Austria


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
The serum amyloid A (SAA) superfamily comprises a number of differentially expressed genes with a high degree of homology in mammalian species. SAA4, an apolipoprotein constitutively expressed only in humans and mice, is associated almost entirely with lipoproteins of the high-density range. The presence of SAA4 mRNA and protein in macrophage-derived foam cells of coronary and carotid arteries suggested a specific role of human SAA4 during inflammation including atherosclerosis. Here we underline the importance of ribosome binding site (rbs)-like sequences (also known as Shine–Dalgarno sequences) in the SAA4 cDNA for expression of recombinant SAA4 protein in Escherichia coli. In contrast to rbs sequences coded by the expression vectors, rbs-like sequences in the cDNA of target protein(s) are known to interfere with protein translation via binding to the small 16S ribosome subunit, yielding low or even no expression. Here we show that PCR mutations of two rbs-like sequences in the human SAA4 cDNA promote expression of considerable amounts of recombinant SAA4 in E.coli.

Keywords: amyloidosis/apolipoprotein/enterokinase/His-tag/rbs-like sequences/SAA4


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
The serum amyloid A (SAA) superfamily comprises a number of differentially expressed genes with a high degree of homology in mammalian species (Malle et al., 1993Go). In humans, four SAA genes are located on chromosome 11 (Sellar et al., 1994Go). The acute-phase SAA proteins (A-SAAs) are encoded by two genes, SAA1 and SAA2, and allelic variations at these two loci account for the corresponding A-SAA1 and A-SAA2 isoforms. A-SAAs (12 kDa, 104 amino acids) are major acute-phase reactants whose in vivo concentrations increase by as much as 1000-fold during inflammation, thus representing ideal markers for clinical practice (Malle and De Beer, 1996Go). Further, A-SAAs are precursor proteins of secondary reactive amyloidosis and are major apolipoproteins of high-density lipoproteins during inflammation (Benditt et al., 1979Go). While the locus designated SAA3 is a pseudogene, the SAA4 locus encodes for a premolecule of 130 amino acids from which a signal peptide containing 18 residues is cleaved to yield 112 amino acid mature SAA4 protein (Whitehead et al., 1992Go). The SAA4 proteins of human and mouse have been found to be structurally similar (De Beer et al., 1994Go) and based on expression characteristics, sequences and positions within the human and mouse gene cluster the constitutively expressed SAA4 (also named C-SAA) is considered to be evolutionary homologues but behave like an outgroup in the SAA superfamily.

Human SAA4 is a minor apolipoprotein component of lipoproteins of the high-density range constituting 1–2% of the total apolipoproteins. The distribution of SAA4 is restricted to two lipoprotein subclasses (De Beer et al., 1995Go) and therefore, SAA4 merits consideration as a factor involved in lipid transfer between lipoprotein classes. The serum concentration of SAA4 is 10-fold higher than that of A-SAA in the normal state but is not changed dramatically during the inflammatory state (Yamada et al., 1994aGo). Although lacking cytokine-responsive elements in the promoter region, cytokine- and glucocorticoid-mediated induction of human SAA4 mRNA in smooth muscle cells and monocytes/macrophages has been reported (Meek et al., 1994Go). Further credence for extrahepatic expression of SAA4 mRNA is derived from studies in human lesion material (Urieli-Shoval et al., 1994Go). This raises the possibility of similar proatherogenic properties of human SAA4 as reported for A-SAA (Badolato et al., 1994Go; Xu et al., 1995Go; Ray et al., 1999Go).

The low plasma SAA4 concentrations do not merit isolation to elucidate its physiological function and structural properties. Escherichia coli has turned out to be a suitable expression system for various apolipoproteins and therefore was adapted for expression of recombinant SAA4 (rSAA4). However, in the present study we were forced to insert silent mutations in two ribosome binding site (rbs)-like sequences (also named Shine–Dalgarno sequences) in the SAA4 cDNA to promote protein expression. These sequences are known to be able to compete for binding to the 16S rRNA with vector-coded rbs sequence, interfering thereby with protein translation (Rosenberg et al., 1993Go). On the mRNA level this purine-rich region is close to an initiation sequence and complementary to a sequence at or very near the 3' end of the 16S rRNA molecule (Shine and Delgarno, 1974Go). In most bacteria, the small ribosomal subunit identifies initiation sites through the interaction of short nucleotide sequences in the small 16S rRNA and the rbs on the mRNA, finally resulting in translation and expression of the target protein. Rbs sequences, when present in the cDNA, can interfere with protein translation via binding to 16S rRNA instead of true rbs sequences (in our case AAGGAG) present in the expression vector, yielding low or even no expression (Bruick and Mayfield, 1998Go). Moreover, rbs-like sequences can lead to the formation of secondary mRNA structures by masking a start codon (Stiegler et al., 1981Go; Looman et al., 1986Go; Lee et al., 1987Go).


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Cloning and mutagenesis

Restriction enzymes were obtained from New England Biolabs, except where indicated. SAA4 was PCR amplified using human SAA4 cDNA as a template. PCR amplifications of both SAA4 constructs (without or with mutation of rbs-like sequences) were performed with the following three synthetic oligonucleotides:

primer A [mut/–]:

5'GCTAGAATTCATCACCATCATCACCCATGACGACGACGACAAGGAAAGCTGGCGTTCGTTTTTCAAAGGAGGCTCTCCAAGGGGTTGGGGAC-3'

primer A [mut/+]:

5'GCTAGAATTCATCACCATCATCACCATGACGACGACGACAAGGAAAGCTGGCGTTCGTTTTTCAAAGAAGCTCTCCAGGGGGTTGGGGAC-3'

primer B:

5'-GTCAGGATCCTTATCAGTATTTCTTAGGCAGGCC-3'

To permit the cloning of SAA4 sequence into the expression vector, an EcoRI restriction site was included in the N-terminal primers, whereas BamHI and two stop-codons were included in the C-terminal primer. To enable further successful purification of rSAA4, a His6-tag sequence (underlined in primer A [mut/–] and [mut/+]) and an enterokinase (EK) cleavage site (double underlined in primer A [mut/–] and [mut/+]) were included. The final concentrations in the PCR reaction mix were as follows (50 µl reaction volume): 10 pM of each oligonucleotide, 250 ng each dNTP, 0.6 units Taq-polymerase (Finnzymes) and 50 ng of human SAA4 cDNA as a template. The reaction was prepared under following conditions: denature 94°C, 60 s; anneal 58°C, 60 s; extend 72°C, 90 s; 25 cycles. PCR conditions for the DNA construct without mismatches in the rbs-like sequences were the same, except that the annealing temperature was 65°C. PCR amplification of the 370 bp product was followed by gel purification, digestion with EcoRI and BamHI and ligation into EcoRI/BamHI cleaved pT7-7 vector (Figure 1Go). Recombinant vector (pT7-7/SAA4) was used to transform E.coli DH5-{alpha} competent cells in order to amplify recombinant plasmid. Positive clones were finally transformed into E.coli strain BL-21(DE3) (Novagen) to allow induction of the expression of tagged (His6-EK)-rSAA4 and they were confirmed by restriction analysis and DNA sequencing.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. . Cloning strategy and construction of the E.coli expression vector for tagged rSAA4. Cloning of SAA4 was performed by PCR. The PCR product and pT7-7 vector were restricted with EcoRI and BamHI and ligated as described in Materials and methods. The resultant expression vector pT7-7/SAA4 contains a T7 promoter, a His6-tag followed by a EK cleavage site, the 330 bp coding sequence for human SAA4 and two stop-codons.

 
Expression

The tagged protein was expressed in E.coli strain BL-21(DE3) under the following conditions: 1 liter of LB medium [10 g of tryptone (Difco), 5 g of yeast extract (Difco), 5 g of NaCl per liter of distilled water, pH 7.4] containing 50 µg/ml ampicillin (Sigma) was inoculated with 1/100 volume of overnight culture of BL-21(DE3) containing the pT7-7/SAA4 plasmid and growth at 37°C with agitation (250 r.p.m.) until the culture achieved A600 nm = 0.5. At this point the expression of tagged rSAA4 was induced by addition of 0.05 mM isopropyl-ß-D-thiogalactoside (at concentrations ranging in between 0.02 and 0.4 mM) and the culture was incubated for additional time periods (2–8 h). After induction, the cells were harvested by centrifugation (6000 g, 10 min, 4°C) and the cell pellets were frozen at –70°C until use. Approximately 1.8 g of cell pellet was obtained per liter of culture medium. Aliquots from non-induced and induced cells were subjected to SDS–PAGE. Proteins were either stained with Coomassie Brilliant Blue or subjected to immunoblot analysis.

Cell fractionation and purification

After thawing, the cell pellet from 1 liter of culture medium was resuspended in 50 ml of lysis buffer [20 mM Tris–HCl, 100 mM NaCl, 8 M urea (Sigma), 200 µl of 5 mg/ml DNase I (Sigma), final pH 8.0] and gently stirred (30 min) on the turn-wheel (60 r.p.m.) at 22°C. To reduce viscosity the suspension was passed several times through a 21-gauge needle and finally centrifuged (12 000 g, 15 min, 4°C). The supernatant was collected and purification of tagged rSAA4 was achieved by TALON metal affinity chromatography according to the manufacturer's suggestions (Clontech). For the highest recovery rate of tagged rSAA4 a batch/gravity flow column combination was found to be optimal. After washing the resin with 20 ml of buffer A [20 mM Tris–HCl, 100 mM NaCl, 8 M urea, 10 mM imidazole (final pH 8.0, 0.5 ml/min)], tagged rSAA4 was eluted with buffer B (20 mM Tris–HCl, 100 mM NaCl, 8 M urea, 50 mM imidazole, final pH 8.0). Fractions (0.5 ml) were collected and protein concentrations were monitored at 280 nm in order to determine the elution profile for tagged rSAA4. Fractions containing tagged rSAA4 were stored at –20°C until use.

Enterokinase cleavage

For proteolytic cleavage, 1 U of EK (Novagen) per 10 µg of tagged rSAA4 was used. Following TALON purification, tagged rSAA4 was diluted 3-fold with H2O, EK digestion buffer (20 mM Tris–HCl, pH 7.4; 50 mM NaCl, 2 mM CaCl2) was added and the mixture was incubated for 24 h at 22°C. Cleavage efficiency was monitored by SDS–PAGE and immunoblot analysis.

SDS–PAGE and immunoblot analysis

Protein fractions were separated by 15% SDS–PAGE and transfered to nitrocellulose (150 mA, 4°C, 90 min). After incubation with polyclonal sequence-specific rabbit antibodies (dilution 1:1000), immunoreactive bands were visualized with goat anti-rabbit IgG (dilution 1:2500) and subsequent ECL development (Amersham). The following primary antibodies (raised in our laboratory) were used: (i) anti-His6-tag antiserum and (ii) anti-human SAA4-peptide antisera. The immunogens were synthetic peptides coupled via the N- or C-terminal residue to N-maleimidobutyryl-N-hydroxysuccinimide ester-activated keyhole-limpet hemocyanin. The anti-His6-tag peptide antiserum was raised against an C-RGS-H6-DDD peptide and anti-human SAA4-peptide antisera were raised against residues 1–17 (ESWRSFFKEALQGVGDM-C) and 94–112 (GRSGKDPDRFRPDGLPKKY-C) of human SAA4.

RNA analysis

Total RNA was prepared from BL-21(DE3) E.coli cells using an RNeasy kit (Quiagen). For Northern blot analysis 15 µg of total RNA were loaded per lane, separated by 1% formaldehyde–agarose gel electrophoresis and blotted on to a nylon membrane. The blot was prehybridized for 6 h at 65°C and hybridized overnight at 65°C in a hybridization buffer (0.15 M sodium phosphate, pH 7.2, 1 mM EDTA, 7% SDS and 1% bovine serum albumin). The 350 bp PCR fragment from the 5'-end of the SAA4 cDNA was used as a probe.


    Results and discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Attempts to use the temperature-sensitive vector pCZ11 or the isopropyl-ß-D-thiogalactoside-inducible vector pKK223 for expression of A- and C-SAA in E.coli were not successful (Yamada et al., 1994bGo). However, it is also evident that expression of all SAA isoforms in the pET21-a(+) vector system appears to be complicated by the toxicity of recombinant proteins leading to depletion of antibiotics and subsequent cell lysis (Yamada et al., 1994bGo). Prolonged expression for more than 2 h resulted in an extremely poor recovery of cells; finally, achieving a suitable ratio of rSAA4 to total cell protein required extremely high concentrations of carbenicillin in culture medium to prevent overgrowth of E.coli lacking plasmids.

To simplify purification of rSAA4 we inserted a His6-tag and an EK-cleavage site into the 5' region of SAA4 cDNA using primer A [mut/–]. After induction of BL21(DE3) cells containing SAA4 cDNA we were able to detect specific mRNA for SAA4 (Figure 2AGo, lane 2) but no expression of tagged rSAA4 was observed using Commassie Brilliant Blue staining (Figure 2BGo, lanes 1–3) or immunoblotting (data not shown). We therefore suspected that rbs sequences present in the cDNA of target proteins do markedly affect expression in the corresponding vector system used in the present study (pT7-7). Indeed, two rbs-like sequences with a homology of 100 and 83% to the vector coding rbs sequence could be identified at bp 59–64 and 72–77 of SAA4 cDNA (Figure 3Go). Insertion of silent point mutations at base 61 (G -> A), 64 (G -> A) and 73 (A -> G) resulted in a decrease in homology to 66% (compared with vector rbs sequence) in the SAA4 cDNA without a single amino acid mutation on the protein level. In order to insert specific silent mutations into rbs-like sequences, the PCR conditions were modified (see Materials and methods) to allow annealing of primer A [mut/+] containing the rbs mismatches (Figure 3Go). The rbs-modified SAA4 cDNA contains two specific restriction sites (EcoRI and BamHI) and can therefore be inserted into a bacterial expression vector pT7-7 in order to permit recombinant vector amplification and protein expression in E.coli.



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 2. . Northern blot and SDS–PAGE analysis before and after mutation of rbs-like sequences in the SAA4 cDNA. (A) Identification of SAA4 mRNA (bottom) in non-induced (lanes 1 and 3) and induced (lanes 2 and 4) BL-21(DE3) cells. A 15 µg amount of total RNA was loaded per lane (top). After hybridization the membrane was exposed to Kodak CRONEX-4 film for 4 h at –70°C. (B) E.coli suspension was induced at A600 = 0.5 with 0.05 mM isopropyl-ß-D-thiogalactoside and cell lysates were prepared 4 h after induction. Proteins were subjected to SDS–PAGE (15%) and visualized with Coomassie Brilliant Blue. Lanes 1 and 4 = non-induced BL-21(DE3) cells; lanes 2 and 5 = induced BL-21(DE3) cells; lanes 3 and 6 = TALON purified tagged rSAA4; lane 7 = low molecular mass standards: 14, 20 and 30 kDa.

 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3. . Mutations of rbs-like sequences in SAA4 cDNA by PCR. To mutate sequences from SAA4 cDNA which are similar to rbs from pT7-7 vector, three silent point mutations (underlined) were introduced by PCR using a specific 5' primer (primer A [mut/+]).

 
The PCR product (Figure 4Go) was inserted into pT7-7 expression vector under the control of inducible T7 promoter and recombinant vector pT7-7/SAA4 was transformed into E.coli DH5-{alpha}. Plasmid DNA was amplified and clones were screened by restriction analysis. Finally, recombinant vector was transformed into BL-21(DE3) E.coli cells. Non-induced BL-21(DE3) cells showed no pronounced SAA4 mRNA (Figure 2AGo, lane 3) and no detectable expression of tagged rSAA4 in SDS–PAGE (Figure 2BGo, lane 4). However induction of BL-21(DE3) cells with 0.05 mM isopropyl-ß-D-thiogalactoside following an incubation period of up to 8 h resulted in pronounced expression of SAA4 mRNA (Figure 2AGo, lane 4) and the tagged rSAA4 (Figure 2BGo, lane 5). Therefore, in scale-up experiments cells were harvested 4 h after induction.



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 4. . Characterization of the PCR product for SAA4. After 25 cycles under the conditions described in Materials and methods the PCR product was analyzed on the agarose gel (1.5%), showing a specific 370 bp SAA4 DNA band (lane 2). Lane 1 = 100 bp DNA ladder. PCR product identity was confirmed by sequencing.

 
A common phenomenon during expression of recombinant (apolipo)proteins in E.coli is the occurence of insoluble protein fractions as inclusion bodies. To obtain purified tagged rSAA4, inclusion bodies were solubilized with lysis buffer containing 8 M urea and tagged rSAA4 was isolated using TALON metal affinity chromatography, yielding up to 15 mg of protein per liter of culture medium under normal antibiotic concentrations (Figure 2BGo, lane 6). Although the His6-tag has no effect on the structure and function of recombinant proteins, we attempted cleavage via the EK site. However, proteolytic cleavage of tagged rSAA4 encountered unexpected complications. The yield of rSAA4 after proteolytic digestion according to the manufacturer's recommendations (20 U EK/mg target protein, 16 h) was low (~3%) yielding the expected 14 kDa rSAA4. Therefore, various time course experiments using different EK concentrations were performed and cleavage was checked by SDS–PAGE following Commassie Brilliant Blue staining. Both a 24 h incubation period and an EK concentration of 40 U EK/mg tagged rSAA4 were found to be optimal and the cleavage efficiency increased up to 30%. Despite these modifications, a substantial portion of tagged rSAA4 remained undigested. As already observed previously with kringle IV-type 6, this phenomenon is probably caused by masking of the EK cleavage site due to formation of accidental secondary structures during protein storage (Hrzenjak et al., 2000Go). The cleavage efficiency was further checked by immunoblot analysis. While antiHis6-tag antibodies reacted with tagged rSAA4 only (Figure 5Go, lanes 1 and 2), antibodies raised against peptides homologous with the N-terminal portion of SAA4 reacted both with tagged rSAA4 and rSAA4, respectively (Figure 5Go, lanes 3 and 4). The same results were obtained when antibodies raised against peptides homologous with the C-terminal portion of human SAA4 were used. A striking observation is the presence of immunoreactive bands with molecular masses of 34 and 52 kDa irrespective of whether conditions are non-denaturing or denaturing. This indicates the formation of stable dimers and trimers similarly as shown for A-SAA (Malle et al., 1998Go).



View larger version (114K):
[in this window]
[in a new window]
 
Fig. 5. . Characterization of rSAA4 by immunoblot analysis prior to and after proteolytic cleavage. Purified tagged rSAA4 was incubated in the absence (lanes 1, 3 and 5) or presence (lanes 2 and 4) of EK. After 24 h, the incubation mixture was subjected to SDS–PAGE (15%) and proteins were transferred electrophoretically to nitrocellulose. Sequence-specific anti-His6-tag antibodies (A), anti-SAA4 (N-terminal portion) antibodies (B) and anti-SAA4 (C-terminal portion) antibodies (C) were used as primary antibodies. Arrows indicate the tagged rSAA4 (*) and the 14 kDa rSAA4 (**) following EK cleavage.

 
In conclusion, we have shown that mutations of rbs-like sequences, which are able to interfere with the vector-coded rbs sequence, allow expression of tagged rSAA4 in E.coli using BL-21(DE3) competent cells and the T7 promoter reaching concentrations up to 15 mg of recombinant protein per liter of culture medium. Although the rbs sequence and its function are common knowledge, we have provided evidence that the rbs sequence has a decisive effect on expression of apolipoproteins, e.g. SAA4. We have shown that silent modifications of rbs sequences in the cDNA of SAA4 may result in feasable expression of the recombinant protein in the pT7-7 vector system.


    Notes
 
1 To whom correspondence should be addressed. E-mail: ernst.malle{at}kfunigraz.ac.at Back


    Acknowledgments
 
The authors are grateful to Dr A.S.Whitehead (Philadelphia, PA, USA) for providing cDNA for human SAA4. The expert technical assistance of B.Hirschmugl (Graz, Austria) is appreciated. This work was supported by grants from the Austrian National Bank to G.Knipping (OENB 8234) and the Austrian Science Foundation (FWF) to W.S. (P14109-GEN) and E.M. (P14186-MED).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Badolato,R., Wang,J.M., Murphy,W.J., Lloyd,A.R., Michiel,D.F., Bausserman,L.L., Kelvin,D.J. and Oppenheim,J.J. (1994) J. Exp. Med., 180, 203–290.[Abstract/Free Full Text]

Benditt,E.P., Eriksen,N. and Hanson,R.H. (1979) Proc. Natl Acad. Sci. USA, 76, 4092–4096.[Abstract/Free Full Text]

Bruick,R.K. and Mayfield,S.P. (1998) J. Cell Biol., 143, 1145–1153.[Abstract/Free Full Text]

De Beer,M.C., Kindy,M.S., Lane,W.S. and de Beer,F.C. (1994) J. Biol. Chem., 269, 4661–4667.[Abstract/Free Full Text]

De Beer,M.C., Yuan,T., Kindy,M.S., Asztalos,B.F., Roheim,P.S. and de Beer,F.C. (1995) J. Lipid Res., 36, 526–534.[Abstract]

Hrzenjak,A., Frank,S., Maderegger,B., Sterk,H. and Kostner,G.M. (2000) Protein Eng., 13, 661–666.[Abstract/Free Full Text]

Lee,N., Zhang,S.Q., Conitorto,J., Yang,J.S. and Testa,D. (1987) Gene, 58, 77–86.[Web of Science][Medline]

Looman,AC., Bodlaender,J., de Gruyter,M., Vogelaar,A. and Knippenberg,P.H. (1986) Nucleic Acids Res., 14, 5481–5497.[Abstract/Free Full Text]

Malle,E. and De Beer,F.C. (1996) Eur. J. Clin. Invest., 26, 427–435.[Web of Science][Medline]

Malle,E., Steinmetz,A. and Raynes,J.G. (1993) Atherosclerosis, 102, 131–146.[Web of Science][Medline]

Malle,E., Herz,R., Artl,A., Ibovnik,A., Andreae,F. and Sattler,W. (1998) Scand. J. Immunol., 48, 557–561.[Web of Science][Medline]

Meek,R.L., Urieli-Shoval,S. and Benditt,E.P. (1994) Proc. Natl Acad. Sci. USA, 91, 3186–3190.[Abstract/Free Full Text]

Ray,A., Chatterjee,S. and Ray,B.M. (1999) DNA Cell. Biol., 18, 65–73.[Web of Science][Medline]

Rosenberg,A.H., Goldman,E., Dunn,J.J., Studier,F.W. and Zubay,G. (1993) J. Bacteriol., 175, 716–722.[Abstract/Free Full Text]

Sellar,G.C., Jordan,S.A., Bickmore,W.A., Fantes,J.A., van Heyningen,V. and Whitehead,A.S. (1994) Genomics, 19, 221–227.[Web of Science][Medline]

Shine,J. and Dalgarno,L. (1974) Proc. Natl Acad. Sci. USA, 71, 1342–1346.[Abstract/Free Full Text]

Stiegler,P., Carbon,P., Zuker,M., Ebel,J.P. and Ehresmann,C. (1981) Nucleic Acids Res., 9, 133–148.[Abstract/Free Full Text]

Urieli-Shoval,S., Meek,R.L., Hanson,R.H., Eriksen,N. and Benditt, E.P. (1994) Am. J. Pathol., 145, 650–660.[Abstract]

Whitehead,A.S., de Beer,M.C., Steel,D.M., Rits,M., Lelias,J.M., Lane,W.S. and de Beer,F.C. (1992) J. Biol. Chem., 267, 3862–3867.[Abstract/Free Full Text]

Xu,L., Badolato,R., Murphy,W.J., Longo,D.L., Anver,M., Hale,S., Oppenheim,J.J. and Wang,J.W. (1995) J. Immunol., 155; 1184–1190.[Abstract]

Yamada,T., Kluve-Beckerman,B., Kuster,W.M., Liepnieks,J.J. and Benson,M.D. (1994a) Amyloid, 1, 114–118.

Yamada,T., Kluve-Beckerman,B., Liepnieks,J.J. and Benson,M.D. (1994b) Biochim. Biophys. Acta, 1226, 323–329.[Medline]

Received April 8, 2001; revised August 2, 2001; accepted October 5, 2001.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
N. Bandmann and P.-A. Nygren
Combinatorial expression vector engineering for tuning of recombinant protein production in Escherichia coli
Nucleic Acids Res., March 12, 2007; 35(5): e32 - e32.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
S. Kimura and T. Iyanagi
High-Level Expression of Porcine Liver Cytochrome P-450 Reductase Catalytic Domain in Escherichia coli by Modulating the Predicted Local Secondary Structure of mRNA
J. Biochem., September 1, 2003; 134(3): 403 - 413.
[Abstract] [Full Text] [PDF]


Home page
Protein Eng Des SelHome page
S. Lutz, W. Fast, and S. J. Benkovic
A universal, vector-based system for nucleic acid reading-frame selection
Protein Eng. Des. Sel., December 1, 2002; 15(12): 1025 - 1030.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Hrzenjak, A.
Right arrow Articles by Malle, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hrzenjak, A.
Right arrow Articles by Malle, E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?