Protein Engineering, Vol. 14, No. 12, 949-952,
December 2001
© 2001 Oxford University Press
COMMUNICATION |
Silent mutations in secondary ShineDalgarno sequences in the cDNA of human serum amyloid A4 promotes expression of recombinant protein in Escherichia coli
Karl-Franzens University Graz, Institute of Medical Biochemistry and Molecular Biology, Harrachgasse 21, A-8010 Graz, Austria
| Abstract |
|---|
|
|
|---|
The serum amyloid A (SAA) superfamily comprises a number of differentially expressed genes with a high degree of homology in mammalian species. SAA4, an apolipoprotein constitutively expressed only in humans and mice, is associated almost entirely with lipoproteins of the high-density range. The presence of SAA4 mRNA and protein in macrophage-derived foam cells of coronary and carotid arteries suggested a specific role of human SAA4 during inflammation including atherosclerosis. Here we underline the importance of ribosome binding site (rbs)-like sequences (also known as ShineDalgarno sequences) in the SAA4 cDNA for expression of recombinant SAA4 protein in Escherichia coli. In contrast to rbs sequences coded by the expression vectors, rbs-like sequences in the cDNA of target protein(s) are known to interfere with protein translation via binding to the small 16S ribosome subunit, yielding low or even no expression. Here we show that PCR mutations of two rbs-like sequences in the human SAA4 cDNA promote expression of considerable amounts of recombinant SAA4 in E.coli.
Keywords: amyloidosis/apolipoprotein/enterokinase/His-tag/rbs-like sequences/SAA4
| Introduction |
|---|
|
|
|---|
The serum amyloid A (SAA) superfamily comprises a number of differentially expressed genes with a high degree of homology in mammalian species (Malle et al., 1993
Human SAA4 is a minor apolipoprotein component of lipoproteins of the high-density range constituting 12% of the total apolipoproteins. The distribution of SAA4 is restricted to two lipoprotein subclasses (De Beer et al., 1995
) and therefore, SAA4 merits consideration as a factor involved in lipid transfer between lipoprotein classes. The serum concentration of SAA4 is 10-fold higher than that of A-SAA in the normal state but is not changed dramatically during the inflammatory state (Yamada et al., 1994a
). Although lacking cytokine-responsive elements in the promoter region, cytokine- and glucocorticoid-mediated induction of human SAA4 mRNA in smooth muscle cells and monocytes/macrophages has been reported (Meek et al., 1994
). Further credence for extrahepatic expression of SAA4 mRNA is derived from studies in human lesion material (Urieli-Shoval et al., 1994
). This raises the possibility of similar proatherogenic properties of human SAA4 as reported for A-SAA (Badolato et al., 1994
; Xu et al., 1995
; Ray et al., 1999
).
The low plasma SAA4 concentrations do not merit isolation to elucidate its physiological function and structural properties. Escherichia coli has turned out to be a suitable expression system for various apolipoproteins and therefore was adapted for expression of recombinant SAA4 (rSAA4). However, in the present study we were forced to insert silent mutations in two ribosome binding site (rbs)-like sequences (also named ShineDalgarno sequences) in the SAA4 cDNA to promote protein expression. These sequences are known to be able to compete for binding to the 16S rRNA with vector-coded rbs sequence, interfering thereby with protein translation (Rosenberg et al., 1993
). On the mRNA level this purine-rich region is close to an initiation sequence and complementary to a sequence at or very near the 3' end of the 16S rRNA molecule (Shine and Delgarno, 1974
). In most bacteria, the small ribosomal subunit identifies initiation sites through the interaction of short nucleotide sequences in the small 16S rRNA and the rbs on the mRNA, finally resulting in translation and expression of the target protein. Rbs sequences, when present in the cDNA, can interfere with protein translation via binding to 16S rRNA instead of true rbs sequences (in our case AAGGAG) present in the expression vector, yielding low or even no expression (Bruick and Mayfield, 1998
). Moreover, rbs-like sequences can lead to the formation of secondary mRNA structures by masking a start codon (Stiegler et al., 1981
; Looman et al., 1986
; Lee et al., 1987
).
| Materials and methods |
|---|
|
|
|---|
Cloning and mutagenesis
Restriction enzymes were obtained from New England Biolabs, except where indicated. SAA4 was PCR amplified using human SAA4 cDNA as a template. PCR amplifications of both SAA4 constructs (without or with mutation of rbs-like sequences) were performed with the following three synthetic oligonucleotides:
primer A [mut/]:
5'GCTAGAATTCATCACCATCATCACCCATGACGACGACGACAAGGAAAGCTGGCGTTCGTTTTTCAAAGGAGGCTCTCCAAGGGGTTGGGGAC-3'
primer A [mut/+]:
5'GCTAGAATTCATCACCATCATCACCATGACGACGACGACAAGGAAAGCTGGCGTTCGTTTTTCAAAGAAGCTCTCCAGGGGGTTGGGGAC-3'
primer B:
5'-GTCAGGATCCTTATCAGTATTTCTTAGGCAGGCC-3'
To permit the cloning of SAA4 sequence into the expression vector, an EcoRI restriction site was included in the N-terminal primers, whereas BamHI and two stop-codons were included in the C-terminal primer. To enable further successful purification of rSAA4, a His6-tag sequence (underlined in primer A [mut/] and [mut/+]) and an enterokinase (EK) cleavage site (double underlined in primer A [mut/] and [mut/+]) were included. The final concentrations in the PCR reaction mix were as follows (50 µl reaction volume): 10 pM of each oligonucleotide, 250 ng each dNTP, 0.6 units Taq-polymerase (Finnzymes) and 50 ng of human SAA4 cDNA as a template. The reaction was prepared under following conditions: denature 94°C, 60 s; anneal 58°C, 60 s; extend 72°C, 90 s; 25 cycles. PCR conditions for the DNA construct without mismatches in the rbs-like sequences were the same, except that the annealing temperature was 65°C. PCR amplification of the 370 bp product was followed by gel purification, digestion with EcoRI and BamHI and ligation into EcoRI/BamHI cleaved pT7-7 vector (Figure 1
). Recombinant vector (pT7-7/SAA4) was used to transform E.coli DH5-
competent cells in order to amplify recombinant plasmid. Positive clones were finally transformed into E.coli strain BL-21(DE3) (Novagen) to allow induction of the expression of tagged (His6-EK)-rSAA4 and they were confirmed by restriction analysis and DNA sequencing.
|
Expression
The tagged protein was expressed in E.coli strain BL-21(DE3) under the following conditions: 1 liter of LB medium [10 g of tryptone (Difco), 5 g of yeast extract (Difco), 5 g of NaCl per liter of distilled water, pH 7.4] containing 50 µg/ml ampicillin (Sigma) was inoculated with 1/100 volume of overnight culture of BL-21(DE3) containing the pT7-7/SAA4 plasmid and growth at 37°C with agitation (250 r.p.m.) until the culture achieved A600 nm = 0.5. At this point the expression of tagged rSAA4 was induced by addition of 0.05 mM isopropyl-ß-D-thiogalactoside (at concentrations ranging in between 0.02 and 0.4 mM) and the culture was incubated for additional time periods (28 h). After induction, the cells were harvested by centrifugation (6000 g, 10 min, 4°C) and the cell pellets were frozen at 70°C until use. Approximately 1.8 g of cell pellet was obtained per liter of culture medium. Aliquots from non-induced and induced cells were subjected to SDSPAGE. Proteins were either stained with Coomassie Brilliant Blue or subjected to immunoblot analysis.
Cell fractionation and purification
After thawing, the cell pellet from 1 liter of culture medium was resuspended in 50 ml of lysis buffer [20 mM TrisHCl, 100 mM NaCl, 8 M urea (Sigma), 200 µl of 5 mg/ml DNase I (Sigma), final pH 8.0] and gently stirred (30 min) on the turn-wheel (60 r.p.m.) at 22°C. To reduce viscosity the suspension was passed several times through a 21-gauge needle and finally centrifuged (12 000 g, 15 min, 4°C). The supernatant was collected and purification of tagged rSAA4 was achieved by TALON metal affinity chromatography according to the manufacturer's suggestions (Clontech). For the highest recovery rate of tagged rSAA4 a batch/gravity flow column combination was found to be optimal. After washing the resin with 20 ml of buffer A [20 mM TrisHCl, 100 mM NaCl, 8 M urea, 10 mM imidazole (final pH 8.0, 0.5 ml/min)], tagged rSAA4 was eluted with buffer B (20 mM TrisHCl, 100 mM NaCl, 8 M urea, 50 mM imidazole, final pH 8.0). Fractions (0.5 ml) were collected and protein concentrations were monitored at 280 nm in order to determine the elution profile for tagged rSAA4. Fractions containing tagged rSAA4 were stored at 20°C until use.
Enterokinase cleavage
For proteolytic cleavage, 1 U of EK (Novagen) per 10 µg of tagged rSAA4 was used. Following TALON purification, tagged rSAA4 was diluted 3-fold with H2O, EK digestion buffer (20 mM TrisHCl, pH 7.4; 50 mM NaCl, 2 mM CaCl2) was added and the mixture was incubated for 24 h at 22°C. Cleavage efficiency was monitored by SDSPAGE and immunoblot analysis.
SDSPAGE and immunoblot analysis
Protein fractions were separated by 15% SDSPAGE and transfered to nitrocellulose (150 mA, 4°C, 90 min). After incubation with polyclonal sequence-specific rabbit antibodies (dilution 1:1000), immunoreactive bands were visualized with goat anti-rabbit IgG (dilution 1:2500) and subsequent ECL development (Amersham). The following primary antibodies (raised in our laboratory) were used: (i) anti-His6-tag antiserum and (ii) anti-human SAA4-peptide antisera. The immunogens were synthetic peptides coupled via the N- or C-terminal residue to N-maleimidobutyryl-N-hydroxysuccinimide ester-activated keyhole-limpet hemocyanin. The anti-His6-tag peptide antiserum was raised against an C-RGS-H6-DDD peptide and anti-human SAA4-peptide antisera were raised against residues 117 (ESWRSFFKEALQGVGDM-C) and 94112 (GRSGKDPDRFRPDGLPKKY-C) of human SAA4.
RNA analysis
Total RNA was prepared from BL-21(DE3) E.coli cells using an RNeasy kit (Quiagen). For Northern blot analysis 15 µg of total RNA were loaded per lane, separated by 1% formaldehydeagarose gel electrophoresis and blotted on to a nylon membrane. The blot was prehybridized for 6 h at 65°C and hybridized overnight at 65°C in a hybridization buffer (0.15 M sodium phosphate, pH 7.2, 1 mM EDTA, 7% SDS and 1% bovine serum albumin). The 350 bp PCR fragment from the 5'-end of the SAA4 cDNA was used as a probe.
| Results and discussion |
|---|
|
|
|---|
Attempts to use the temperature-sensitive vector pCZ11 or the isopropyl-ß-D-thiogalactoside-inducible vector pKK223 for expression of A- and C-SAA in E.coli were not successful (Yamada et al., 1994b
To simplify purification of rSAA4 we inserted a His6-tag and an EK-cleavage site into the 5' region of SAA4 cDNA using primer A [mut/]. After induction of BL21(DE3) cells containing SAA4 cDNA we were able to detect specific mRNA for SAA4 (Figure 2A
, lane 2) but no expression of tagged rSAA4 was observed using Commassie Brilliant Blue staining (Figure 2B
, lanes 13) or immunoblotting (data not shown). We therefore suspected that rbs sequences present in the cDNA of target proteins do markedly affect expression in the corresponding vector system used in the present study (pT7-7). Indeed, two rbs-like sequences with a homology of 100 and 83% to the vector coding rbs sequence could be identified at bp 5964 and 7277 of SAA4 cDNA (Figure 3
). Insertion of silent point mutations at base 61 (G
A), 64 (G
A) and 73 (A
G) resulted in a decrease in homology to 66% (compared with vector rbs sequence) in the SAA4 cDNA without a single amino acid mutation on the protein level. In order to insert specific silent mutations into rbs-like sequences, the PCR conditions were modified (see Materials and methods) to allow annealing of primer A [mut/+] containing the rbs mismatches (Figure 3
). The rbs-modified SAA4 cDNA contains two specific restriction sites (EcoRI and BamHI) and can therefore be inserted into a bacterial expression vector pT7-7 in order to permit recombinant vector amplification and protein expression in E.coli.
|
|
The PCR product (Figure 4
. Plasmid DNA was amplified and clones were screened by restriction analysis. Finally, recombinant vector was transformed into BL-21(DE3) E.coli cells. Non-induced BL-21(DE3) cells showed no pronounced SAA4 mRNA (Figure 2A
|
A common phenomenon during expression of recombinant (apolipo)proteins in E.coli is the occurence of insoluble protein fractions as inclusion bodies. To obtain purified tagged rSAA4, inclusion bodies were solubilized with lysis buffer containing 8 M urea and tagged rSAA4 was isolated using TALON metal affinity chromatography, yielding up to 15 mg of protein per liter of culture medium under normal antibiotic concentrations (Figure 2B
|
In conclusion, we have shown that mutations of rbs-like sequences, which are able to interfere with the vector-coded rbs sequence, allow expression of tagged rSAA4 in E.coli using BL-21(DE3) competent cells and the T7 promoter reaching concentrations up to 15 mg of recombinant protein per liter of culture medium. Although the rbs sequence and its function are common knowledge, we have provided evidence that the rbs sequence has a decisive effect on expression of apolipoproteins, e.g. SAA4. We have shown that silent modifications of rbs sequences in the cDNA of SAA4 may result in feasable expression of the recombinant protein in the pT7-7 vector system.
| Notes |
|---|
1 To whom correspondence should be addressed. E-mail: ernst.malle{at}kfunigraz.ac.at
| Acknowledgments |
|---|
The authors are grateful to Dr A.S.Whitehead (Philadelphia, PA, USA) for providing cDNA for human SAA4. The expert technical assistance of B.Hirschmugl (Graz, Austria) is appreciated. This work was supported by grants from the Austrian National Bank to G.Knipping (OENB 8234) and the Austrian Science Foundation (FWF) to W.S. (P14109-GEN) and E.M. (P14186-MED).
| References |
|---|
|
|
|---|
Badolato,R., Wang,J.M., Murphy,W.J., Lloyd,A.R., Michiel,D.F., Bausserman,L.L., Kelvin,D.J. and Oppenheim,J.J. (1994) J. Exp. Med., 180, 203290.
Benditt,E.P., Eriksen,N. and Hanson,R.H. (1979) Proc. Natl Acad. Sci. USA, 76, 40924096.
Bruick,R.K. and Mayfield,S.P. (1998) J. Cell Biol., 143, 11451153.
De Beer,M.C., Kindy,M.S., Lane,W.S. and de Beer,F.C. (1994) J. Biol. Chem., 269, 46614667.
De Beer,M.C., Yuan,T., Kindy,M.S., Asztalos,B.F., Roheim,P.S. and de Beer,F.C. (1995) J. Lipid Res., 36, 526534.[Abstract]
Hrzenjak,A., Frank,S., Maderegger,B., Sterk,H. and Kostner,G.M. (2000) Protein Eng., 13, 661666.
Lee,N., Zhang,S.Q., Conitorto,J., Yang,J.S. and Testa,D. (1987) Gene, 58, 7786.[ISI][Medline]
Looman,AC., Bodlaender,J., de Gruyter,M., Vogelaar,A. and Knippenberg,P.H. (1986) Nucleic Acids Res., 14, 54815497.
Malle,E. and De Beer,F.C. (1996) Eur. J. Clin. Invest., 26, 427435.[ISI][Medline]
Malle,E., Steinmetz,A. and Raynes,J.G. (1993) Atherosclerosis, 102, 131146.[ISI][Medline]
Malle,E., Herz,R., Artl,A., Ibovnik,A., Andreae,F. and Sattler,W. (1998) Scand. J. Immunol., 48, 557561.[ISI][Medline]
Meek,R.L., Urieli-Shoval,S. and Benditt,E.P. (1994) Proc. Natl Acad. Sci. USA, 91, 31863190.
Ray,A., Chatterjee,S. and Ray,B.M. (1999) DNA Cell. Biol., 18, 6573.[ISI][Medline]
Rosenberg,A.H., Goldman,E., Dunn,J.J., Studier,F.W. and Zubay,G. (1993) J. Bacteriol., 175, 716722.
Sellar,G.C., Jordan,S.A., Bickmore,W.A., Fantes,J.A., van Heyningen,V. and Whitehead,A.S. (1994) Genomics, 19, 221227.[ISI][Medline]
Shine,J. and Dalgarno,L. (1974) Proc. Natl Acad. Sci. USA, 71, 13421346.
Stiegler,P., Carbon,P., Zuker,M., Ebel,J.P. and Ehresmann,C. (1981) Nucleic Acids Res., 9, 133148.
Urieli-Shoval,S., Meek,R.L., Hanson,R.H., Eriksen,N. and Benditt, E.P. (1994) Am. J. Pathol., 145, 650660.[Abstract]
Whitehead,A.S., de Beer,M.C., Steel,D.M., Rits,M., Lelias,J.M., Lane,W.S. and de Beer,F.C. (1992) J. Biol. Chem., 267, 38623867.
Xu,L., Badolato,R., Murphy,W.J., Longo,D.L., Anver,M., Hale,S., Oppenheim,J.J. and Wang,J.W. (1995) J. Immunol., 155; 11841190.[Abstract]
Yamada,T., Kluve-Beckerman,B., Kuster,W.M., Liepnieks,J.J. and Benson,M.D. (1994a) Amyloid, 1, 114118.
Yamada,T., Kluve-Beckerman,B., Liepnieks,J.J. and Benson,M.D. (1994b) Biochim. Biophys. Acta, 1226, 323329.[Medline]
Received April 8, 2001; revised August 2, 2001; accepted October 5, 2001.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
N. Bandmann and P.-A. Nygren Combinatorial expression vector engineering for tuning of recombinant protein production in Escherichia coli Nucleic Acids Res., March 12, 2007; 35(5): e32 - e32. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kimura and T. Iyanagi High-Level Expression of Porcine Liver Cytochrome P-450 Reductase Catalytic Domain in Escherichia coli by Modulating the Predicted Local Secondary Structure of mRNA J. Biochem., September 1, 2003; 134(3): 403 - 413. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lutz, W. Fast, and S. J. Benkovic A universal, vector-based system for nucleic acid reading-frame selection Protein Eng. Des. Sel., December 1, 2002; 15(12): 1025 - 1030. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







