Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Becerra, M.
Right arrow Articles by Cerdán, M.E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Becerra, M.
Right arrow Articles by Cerdán, M.E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Protein Engineering, Vol. 14, No. 5, 379-386, May 2001
© 2001 Oxford University Press

New secretory strategies for Kluyveromyces lactis ß-galactosidase

M. Becerra, S.Díaz Prado, M.I.González Siso,1 and M.E. Cerdán

Departamento de Bioloxía Celular e Molecular, Facultade de Ciencias, Campus da Zapateira s/n, 15071-A Coruña, Spain


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
We examined several strategies for the secretion of Kluyveromyces lactis ß-galactosidase into the culture medium, in order to facilitate the downstream processing and purification of this intracellular enzyme of great industrial interest. We constructed plasmids by fusing the LAC4 gene or engineered variants to the secretion signal of the K.lactis killer toxin or to the secretion signal of the Saccharomyces cerevisiae {alpha}-factor. With these plasmids we transformed strains of the yeasts K.lactis and S.cerevisiae, respectively and tested ß-galactosidase extracellular activity in different culture media. We achieved partial secretion of ß-galactosidase in the culture medium since the high molecular weight and oligomeric nature of the enzyme, among other factors, preclude full secretion. The percentage of secretion was improved by directed mutagenesis of the N-terminus of the protein. We developed several deletion mutants which helped us to propose structure–function relationships by comparison with the available data on the homologous Escherichia coli ß-galactosidase. The influence of the culture conditions on heterologous ß-galactosidase secretion was also studied.

Keywords: ß-galactosidase/Kluyveromyces lactis/protein secretion


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
ß-Galactosidase or lactase, the enzyme which is responsible for the hydrolysis of lactose into glucose and galactose, has important applications in the fields of medicine (treatment of lactose intolerance), food technology (to prevent lactose crystallization and increase its sweetening power) and the environment (cheese whey utilization). The most outstanding ß-galactosidases in terms of technological interest come from yeasts of the Kluyveromyces genus. Much of the added cost to commercial yeast ß-galactosidase preparations stems from the low stability and intracellular nature of the enzyme, which greatly hamper extraction and purification processes (for a review, see González Siso, 1996)

The secretion of the intracellular protein into the culture medium, achieved by genetic modification, could facilitate its purification. The fusion of a secretion signal sequence 5' to the gene has proved to be useful in the case of small peptides, but it is especially problematic when high molecular weight or oligomeric proteins such as ß-galactosidase are involved. Over the last decade, several authors have tried to achieve the heterologous secretion of bacterial and fungal ß-galactosidases by Saccharomyces cerevisiae. In Table IGo we observe that the protein from Escherichia coli remained mainly periplasmic, as if the high molecular weight prevented ß-galactosidase, which is a tetramer of 116 kDa sub-unit (Jacobson et al, 1994Go), from passing through the cell wall. Rossini et al. obtained a maximum of 33% secretion in the best of several culture conditions tested: high temperature and rich media supplemented with reducing agents (Rossini et al., 1993Go). The 40% secretion obtained by Kumar et al. (Kumar et al., 1992Go) may be explained by the extracellular nature of the Aspergillus niger ß-galactosidase. Based on these data, we conclude that adding a signal sequence is not sufficient to lead ß-galactosidase out of the cell: culture conditions play an important role, the wall acts as a molecular sieve but, moreover, structural determinants of the protein, at present under study, may influence secretion efficiency (Boyd and Beckwith, 1990Go; Kowalski et al., 1998Go; Zhu et al., 1998Go; Katakura et al., 1999Go).


View this table:
[in this window]
[in a new window]
 
Table I. . Heterologous secretion of the ß-galactosidase from several sources by S.cerevisiae using different signal sequences
 
In this work, we examined several strategies for improving the secretion of Kluyveromyces lactis ß-galactosidase, since the production and downstream processing of this enzyme have greater industrial interest than the bacterial or fungal enzymes. The strategies start with the fusion of a signal sequence 5' to the LAC4 gene, following the expression in Kluyveromyces lactis or Saccharomyces cerevisiae and include the modification of the amino acid at the N-terminus, the shortening of the protein and optimization of the culture conditions.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Strains and culture conditions

The following strains were used: Kluyveromyces lactis MW 190-9B (MATa, lac4-8, uraA, Rag+), Kluyveromyces lactis NRRL-Y1140 (wild type), Saccharomyces cerevisiae BJ3505 (pep4::HIS3, prb-{Delta}1.6R HIS3, lys2-208, trp1-{Delta}101, ura3-52, gal2, can1).

The BJ3505 strain was purchased from Eastman Kodak.

Liquid cultures of transformed strains were performed (a) in Erlenmeyer flasks filled with a 2:5 volume of culture medium at 30°C and 250 r.p.m. As inocula, a suitable volume of a stationary phase pre-culture in a complete medium (CM) without the corresponding auxotrophic amino acid was added to obtain an initial absorbance at 600 nm of 0.2. Samples were taken at regular time intervals to measure growth (absorbance at 600 nm), intra- and extracellular ß-galactosidase activity and sugar consumption; (b) in a Biostat-MD (Braun-Biotech) 2 l vessel chemostat. The working volume of the culture was 2 l and the temperature was maintained at 30°C. The air flow was 2 l/min sparged through the culture with an agitation speed of 250 r.p.m. Dissolved oxygen was measured with a polarographic electrode and growth was monitored with a turbidity probe, previously calibrated to absorbance at 600 nm values. The pH was maintained at about 7 by the addition of sodium hydroxide. A 100 ml volume of a liquid preculture on CM-Ura was used as inocula. Samples and measurements were as described above.

YPD (1% yeast extract, 0.5% bactopeptone, 0.5% dextrose), YPL (1% yeast extract, 0.5% bactopeptone, 4% lactose), YPHSM (1% yeast extract, 8% bactopeptone, 1% dextrose, 3% glycerol, 20 mM CaCl2) and cheese-whey (ultrafiltration permeate supplemented with 1% yeast extract) were used as culture media. The ultrafiltration permeate of cheese-whey (about 5% lactose) was obtained from the local dairy plant Quegalsa (Ferrol, A Coruña, Spain). If a protein precipitate was observed after autoclave sterilization at 121°C for 15 min, then it was removed by centrifugation (15 min at 10 000 r.p.m.) under sterile conditions. A complete medium (CM) (Lowry et al., 1983Go) without the corresponding auxotrophic amino acid was used for the inocula.

Molecular biology procedures

E.coli DH5{alpha} strain (supE44, {Delta}lacU169, {phi}80lacZ{Delta}M15, hsdR17, recA1, endA1, gyrA96, thi-1, relA1) was used for the construction of the plasmids and propagation by means of the usual DNA recombinant techniques (Sambrook et al., 1989Go; Ausubel et al., 1995Go).

Yeast strains were transformed using the lithium acetate procedure of Ito et al. (Ito et al., 1983Go). Plasmid uptake and ß-galactosidase production by the transformed strains were identified in plates with the chromogenic substrate X-gal in the corresponding auxotrophic medium.

Plasmid stability was determined by taking samples at different culture times and spreading 100 µl of a suitable dilution on YPD plates. After growing at 30°C, they were replica plated on CM without the corresponding auxotrophic amino acid plus X-gal and the ratio of viable and ß-galactosidase-expressing cells (containing the plasmid) was estimated.

PCR conditions

A 20 ng amount of template DNA was incubated with 30 pmol of primer-1 and 30 pmol of primer-2 in the presence of 0.25 mM dNTPs, Taq or Pwo polymerase buffer 1X and 2 U of the corresponding polymerase. Initial denaturation was done at 94°C for 2 min, followed by 30 cycles of 1 min at 95°C, 2 min at 50–57°C and 1.5–2.5 min at 72°C. There was a final incubation at 72°C for 10 min to fill in ends.

Vectors and DNA constructions

The plasmids used as vectors, the constructed ß-galactosidase secretion cassettes and the corresponding transformed strains are shown in Figure 1Go.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1. . Diagram with the plasmids constructed and the corresponding transformed strains used in this work. LAC4, K.lactis ß-galactosidase gene; SS, K.lactis killer toxin signal sequence; {alpha}, yeast {alpha} factor secretion signal; FLAG, a 24 base pair DNA coding sequence for the eight amino acid FLAG epitope for immunological detection. For more details, see text.

 
The pSPGK1 plasmid (Fleer et al., 1991Go) allows the expression in K.lactis of the cloned gene in frame to the secretion signal of the K.lactis killer toxin {alpha}-subunit and under the control of the promoter and terminator of the phosphoglycerate kinase (PGK) gene from S.cerevisiae.

Plasmid pSPGK1-LAC4 was constructed by cloning the LAC4 gene, which codes for K.lactis ß-galactosidase, in the single cloning site of pSPGK1; this cloning site was previously modified by inserting an XbaI linker in the EcoRI site; the LAC4 gene was amplified from pLX8 plasmid (Das and Hollenberg, 1982Go) with the following oligonucleotides that create an XbaI site on the ends of the PCR product: GCTCTAGATTATTCAAAAGCGAGATC, GCTCTAGATGTCTTGCCTTATTCCT. The K.lactis strain MW190-9B was transformed with plasmid pSPGK1-LAC4.

Plasmid pSPGK1-Ser-LAC4 was constructed as follows: plasmid pSPGK1 was digested with EcoRI, treated with S1-nuclease and ligated to the following complementary oligonucleotides containing an XhoI site (ATCCCTCGAG, CTCGAGGGAT). The LAC4 gene was PCR-amplified using oligonucleotides A and B in Table IIGo and ligated in the XhoI site of the modified pSPGK1. The K.lactis strain MW190-9B was transformed with plasmid pSPGK1-Ser-LAC4.


View this table:
[in this window]
[in a new window]
 
Table II. . Oligonucleotides used in this study to amplify the LAC4 gene or engineered variants flanked by XhoI restriction sites (XhoI recognition sequence is indicated in bold)
 
The plasmid YEpFLAG1 (Eastman Kodak), allows the expression in S.cerevisiae of the cloned gene in frame to the yeast {alpha} factor secretion signal and expressed under the control of the yeast ADH2 promoter and CYC1 terminator. This plasmid also contains the sequence of the FLAG peptide for the immunological detection of the secreted protein. Ad hoc antibodies, M1, were also provided by Eastman Kodak.

Four constructs were performed, PCR-amplifying from pLX8 plasmid the complete LAC4 gene or deleted mutants, using different pairs of the oligonucleotides shown in Table IIGo as primers and cloning them in the XhoI site of the multiple cloning site of the YEpFLAG1 vector. Oligonucleotides A and B allowed us to obtain the entire LAC4 gene with XhoI sites at both ends (the resulting plasmid was called YEpFLAG1-LAC4). Oligonucleotides B and C allowed us to obtain the LAC4 gene but removing the 10 N-terminal amino acids (the resulting plasmid was called YEpFLAG1-BC). Oligonucleotides B and D allowed us to obtain the LAC4 gene but removing the 25 N-terminal amino acids (the resulting plasmid was called YEpFLAG1-BD). Oligonucleotides E and F allowed us to obtain the region of the LAC4 gene corresponding to the active site of the protein (the resulting plasmid was called YEpFLAG1-EF). The Saccharomyces cerevisiae BJ3505 strain was transformed with these four plasmids (YEpFLAG1-LAC4, YEpFLAG1-BC, YEpFLAG1-BD, YEpFLAG1-EF).

ß-Galactosidase activity assays

Intra- and extracellular ß-galactosidase activity was measured by the method of Guarente (Guarente, 1983Go). For extracellular activity, a suitable volume of the culture medium was used instead of the permeabilized cellular suspension. Liberated o-nitrophenol (ONP) was measured spectrophotometrically at 420 nm (extinction coefficient 4500 l/mol.cm). One enzyme unit (EU) is defined as the quantity of enzyme that catalyzes the liberation of 1 µmol of ONP from o-nitrophenyl-ß-D-galactopyranoside per minute under assay conditions. Unless stated otherwise, EU are expressed per milliliter of culture medium.

Polyacrylamide gel electrophoresis and Western blotting

These were performed as described (Becerra et al., 1997Go) but using anti-FLAG M1 monoclonal antibody (10 µg/ml).

Sugars

Total sugars in the culture medium were determined by the method of Dubois et al. (Dubois et al., 1956Go). Lactose was determined using a commercial test kit (Boehringer-Mannheim).

Cell fractionation

A modification of a published method (Jigami et al., 1986Go) was used. Cells grown in YPL were harvested by centrifugation at 5000 r.p.m. for 5 min. Pellet cells were suspended in 1.2 M sorbitol, 10 mM KH2PO4, pH 6.8 and 25 mM ß-mercaptoethanol, washed twice and resuspended in 1.2 M sorbitol, 10 mM KH2PO4, pH 6.8 and 0.6% lyticase (from Arthrobacter luteus; Sigma Chemical, St.Louis, MO, Ref. L-8012). The mixture was incubated at 30°C for 45–60 min and centrifuged at 2500 r.p.m. at 4°C for 5 min. The supernatant constituted the periplasmic fraction. The pellet was suspended in distilled water and after lysis the suspension was centrifuged at 2500 r.p.m. for 5 min. The supernatant contains the cytoplasmic fraction and the pellet contains the cell debris fraction. ß-Galactosidase activity was measured in the extracellular culture medium, periplasmic, cytoplasmic and cell debris fractions.

Experimental design and statistical data analysis

Factorial experimental designs were created and data were analyzed with the aid of version 1 of the Statgraphics software for Windows (Manugistics and Statistical Graphics).

The statistical significance of differences between means was determined by Student's t-test performed with the same software; p values <0.05 were considered significant.


    Results and discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
To the best of our knowledge, there have been no reports on the induction of K.lactis ß-galactosidase secretion by genetic or protein engineering or on the use of K.lactis as a host for the secretion of ß-galactosidases from a different origin. The sequence of the LAC4 gene, coding for K.lactis ß-galactosidase, has been published (Poch et al., 1992Go) but no information on the three-dimensional structure of the protein is available. In this work, we investigated two yeast systems for engineering the K.lactis ß-galactosidase in order to obtain and to improve upon its secretion as well as to make inferences, when possible, concerning the structure–function relationships. The former was an homologous system based on the plasmid pSPGK1 (Fleer et al., 1991Go) and the K.lactis ß-galactosidase mutant strain MW-190-9B. The second system was heterologous, based on the plasmid YEpFLAG-1 and the S.cerevisiae strain BJ3505. In K.lactis the secretion of ß-galactosidase was induced by fusing the LAC4 gene or an engineered variant to the homologous killer toxin {alpha} sub-unit signal sequence and expressing the fusion under the control of a constitutive promoter. In S.cerevisiae we fused the LAC4 gene or deletion mutants to the homologous signal sequence from the {alpha} factor, but the expression was controlled by a regulated promoter (glucose-repressed).

ß-Galactosidase secretion in K.lactis

Representative parameters of the chemostat batch culture of the ß-galactosidase-mutant K.lactis strain MW190-9B transformed with plasmid pSPGK1-LAC4 (Figure 1Go) on cheese-whey permeate supplemented with yeast extract, as described in Materials and methods, are shown in Figure 2Go. Plasmid stability was 56% after 45 h of culture, when lactose was exhausted. The percentage of ß-galactosidase secretion into the culture medium was higher in early culture phases, varying from 54% after 10–14 h of culture to <10% at incubation times of over 35 h. However, absolute values of extracellular activity increased with absorbance during the exponential growth phase, owing to the rise in intracellular enzyme levels.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2. . Extracellular and intracellular ß-galactosidase production by K.lactis strain MW190-9B transformed with plasmid pSPGK1-LAC4 growing in milk whey permeate supplemented with yeast extract.

 
The ß-galactosidase activity in different cell fractions was also measured in strain MW190-9B transformed with pSPGK1-LAC4. The cells, in the stationary growth phase, came from a chemostat continuous culture in YPL plus 0.1% glucose (µ = 0.02 h–1). The use of the semisynthetic medium YPL facilitates the generalization of the results obtained; small quantities of glucose were added to reduce the lag phase. Plasmid stability under these culture conditions was 75%. The percentage of ß-galactosidase secretion into the culture medium was 6.64 ± 0.97 (mean ± SE, n = 6). Surprisingly, no accumulation of the ß-galactosidase activity in the periplasm was observed, as would be expected from the low secretion percentages obtained. ß-Galactosidase activity was found to be distributed among extracellular, periplasmic and cytoplasmic fractions, with a considerable part remaining in the cell debris (150.25 ± 8.27, 89.25 ± 7.33, 173.75 ± 10.47, 188.25 ± 27.99 EU/ml, respectively; mean ± SE, n = 4). During enzyme treatment for cell fractionation, an important loss of activity was observed.

Does the N-terminal amino acid affect secretion?

The half-life of a mature protein is partially determined by its N-terminal amino acid (Varshavsky, 1996Go). Since the N-terminal amino acid of the wild-type K.lactis ß-galactosidase is destabilizing (Ile) and for the purpose of testing whether secretion was influenced by this fact, we constructed the plasmid pSPGK1-Ser-LAC4 (Figure 1Go) and transformed the K.lactis strain MW190-9B. The engineered ß-galactosidase coded by this plasmid is three amino acids longer and, after the secretion signal is processed and cut by the Kex1 K.lactis endopeptidase, a serine (a stabilizing amino acid) results in its N-terminus.

In Figure 3Go we compare the cultures in YPD of strain MW190-9B/pSPGK1-Ser-LAC4 versus the control strain MW190-9B/pSPGK1-LAC4. Growth (absorbance) was higher in the case of strain MW190-9B/pSPGK1-Ser-LAC4, but the intracellular ß-galactosidase/absorbance ratio was lower, reaching 12.3 for cells of strain MW190-9B/pSPGK1-LAC4 approaching the stationary phase, and did not surpass 7.5 for strain MW190-9B/pSPGK1-Ser-LAC4. The average percentage of extra- versus intracellular ß-galactosidase after 2 and 3 days of culture, was significantly higher for strain MW190-9B/pSPGK1-Ser-LAC4 than for strain MW190-9B/pSPGK1-LAC4 (p = 0.0003; mean ± SE was 4.99 ± 0.007 and 1.28 ± 0.018, respectively, n = 2). Regardless of the molecular mechanism responsible for this fact, these results indicate that the percentage of secretion increased when the N-terminal amino acid was changed to a more stabilizing one.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3. . Extra- and intracellular ß-galactosidase production by K.lactis strain MW190-9B transformed with plasmid pSPGK1-Ser-LAC4 (A) and pSPGK1-LAC4 (B) growing in YPD medium.

 
Shortening the protein

As mentioned in the Introduction, the large size (124 kDa/monomer) and oligomeric nature of K.lactis ß-galactosidase (Becerra et al., 1998Go) may be a handicap when attempting to obtain efficient secretion. Therefore, we tried to construct a reduced-size but fully active protein to facilitate its secretion into the culture medium. We used the YEpFLAG1 vector and the Saccharomyces cerevisiae strain BJ3505 as a host. Knowledge of the three-dimensional structure of the ß-galactosidase from E.coli (Jacobson et al., 1994Go) and existing studies on primary sequence homology between this protein and other ß-galactosidases including that of K.lactis (Poch et al., 1992Go) served as a theoretical basis on which we planned the corresponding deletions, for the additional purpose of finding out whether the high homology shown between both sequences (Figure 4Go) corresponded to a certain structural–functional analogy.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 4. . Alignment of the sequence of the K.lactis ß-galactosidase enzyme with the E.coli ß-galactosidase. Conserved residues are indicated by asterisks for the identical residues and points for similar residues. Residues important for catalysis in E.coli ß-galactosidase are shown in boxes, as are the identical residues in the K.lactis enzyme. E.coli ß-galactosidase catalytic domain is shown in bold. The PCR-amplified region for the construction of the plasmid YEpFLAG1-EF is also indicated in bold. The 10 N-terminal amino acids are in bold italics and the 25 N-terminal amino acids are underlined.

 
The ß-galactosidase from E.coli is tetrameric. Each sub-unit has been described as folding into five sequential domains with an extended segment at the amino terminus of about 50 residues. This segment participates in a sub-unit interface and is responsible for the {alpha}-complementation. A deletion of residues 11–40 gives rise to an inactive and dimeric protein (Jacobson et al., 1994Go). To ascertain if these features were also present in K.lactis ß-galactosidase and whether or not it would be possible to reduce the size of the protein by reducing the degree of oligomerization without significantly affecting activity [given that we demonstrated earlier that the protein may be active in both dimeric and tetrameric forms (Becerra et al., 1998Go)], deletion mutants were made from the N-terminal region lacking residues 1–10 (plasmid YEpFLAG1-BC) or 1–25 (plasmid YEpFLAG1-BD). We also tested whether the region corresponding to the highly conserved catalytic site was active isolated from the rest of the protein (plasmid YEpFLAG1-EF). This region was estimated by comparison with the sequence of the E.coli ß-galactosidase, since the amino acids which have been described as being important in catalysis (Jacobson et al., 1994Go) are conserved in the K.lactis ß-galactosidase (Poch et al., 1992Go).

The BJ3505 cells transformed with plasmids YEpFLAG1-LAC4, coding the entire ß-galactosidase and YEpFLAG1-BC (see Figure 1Go and Materials and methods for plasmids) showed ß-galactosidase activity when cultured in a YPHSM medium, but no activity (intra- or extracellular) was found in cells producing shorter proteins (from plasmids YEpFLAG1-BD and YEpFLAG1-EF). These results point to the existence of a functional analogy between the N-terminal segment of the K.lactis ß-galactosidase and the E.coli ß-galactosidase This region has been described as participating in the contact inter-domains and inter-monomers and, therefore, in the correct assembly of the tetramer and integrity of the active site which is made up of elements from two different sub-units (Jacobson et al., 1994Go). A similar structure–function relationship may account for the K.lactis ß-galactosidase, but three-dimensional structure data are necessary to corroborate this hypothesis.

Kinetics of growth and ß-galactosidase production for the two S.cerevisiae transformed strains producing active proteins are shown in Figure 5Go. Synthesis of the enzyme is accelerated after 24 h of culture, when glucose is exhausted, since the ADH2 promoter is glucose-repressed. Average percentages of secretion were within a similar range in both cases (p = 0.73; mean ± SE, 0.10 ± 0.03 for BJ3505/YEpFLAG1-LAC4, n = 6, 0.13 ± 0.04 for BJ3505/YEpFLAG1-BC, n = 4). Although such percentages were lower than those obtained with the K.lactis system developed here in glucose media (p = 0.034; mean ± SE, 0.12 ± 0.01, n = 10, 12.95 ± 1.91, n = 12) owing to the higher levels of intracellular ß-galactosidase, the extracellular ß-galactosidase absolute values shown by these cultures were equally important (p = 0.74; mean ± SE, 1.23 ± 0.08 EU/ml, n = 11, 1.41 ± 0.14 EU/ml, n = 12).



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 5. . Extra- and intracellular ß-galactosidase production by S.cerevisiae strain BJ3505 transformed with plasmid YEpFLAG1-LAC4 (A) or YEpFLAG1-BC (B) growing in YPHSM medium. Photograph in B shows Western-blot analysis of secreted ß-galactosidase at different times of culture. A total of 7 µg of protein were loaded in the lane corresponding to 72 h for electrophoresis and 6 µg in the lane corresponding to 96 h. Western blotting was performed using M1 antibody.

 
The analysis of the activity in different cell fractions of the strain BJ3505/YEpFLAG1-LAC4 showed an accumulation of the secreted enzyme in the periplasm (75% of the intracellular activity of stationary phase cells). A Western blot analysis of the protein secreted into the culture medium by strain BJ3505/YEpFLAG1-BC showed a band of a molecular weight corresponding to the non-glycosylated K.lactis ß-galactosidase. The absence of glycosilation of ß-galactosidase has also been observed in other heterologous systems. Thus, when a secretion signal was fused to the E.coli enzyme and secreted by S.cerevisiae, no glycosylation of the protein was detected (Das et al., 1989Go; Porro et al., 1992Go; Rossini et al., 1993Go; Pignatelli et al., 1998Go).The fact that the protein is recognized by the M1 antibody indicates that the secretion signal was correctly processed through the secretion pathway.

Thus, strains BJ3505/YEpFLAG1-LAC4 and BJ3505/YEpFLAG1-BC are good tools for achieving an efficient K.lactis ß-galactosidase secretion and yields may be improved after an optimization of culture conditions.

Influence of culture conditions on secretion

Previous authors have reported that by accurately choosing the growth conditions, secretion into the culture medium of heterologous proteins by yeast may be improved (Rossini et al., 1993Go). Therefore, we decided to study the influence of several culture conditions on K.lactis ß-galactosidase heterologous secretion.

We performed a full-factorial 24 experimental design focused on the study of the individual and combined influence of several culture parameters (temperature, aeration, NaCl concentration and incubation time) selected on a bibliographical basis (Rossini et al., 1993Go; Miksch et al., 1997Go) on ß-galactosidase secretion by the strain BJ3505/YEpFLAG1-LAC4 growing on YPHSM. The experimental domain defined by the range of factors whose influence was studied and the corresponding coded values are presented in Table IIIGo. The experiments performed and the results of the extracellular ß-galactosidase activity measured are shown in Table IVGo.


View this table:
[in this window]
[in a new window]
 
Table III. . Keys to the factors whose influence on ß-galactosidase secretion by the recombinant strain BJ3505/pSPGK1-LAC4 in YPHSM medium was studied in the 24 factorial design and experimental domain, showing the correspondence between the coded and the natural values
 

View this table:
[in this window]
[in a new window]
 
Table IV.. Experimental matrix of the 24 factorial design and results, obtained from each experiment and expected from the model, for variable Ra
 
The regression equation of the model fitted to the data obtained is as follows:


where the values of R (extracellular ß-galactosidase activity) are specified in their original units and are coded in the case of the factors, T is the temperature of the culture, A is the aeration rate, C is the NaCl concentration and t is the incubation time. The interactions AxC, Axt, Cxt, TxAxC, TxAxt, TxCxt, AxCxt and TxAxCxt failed to influence the response and were therefore excluded from the model.

Since the p-value for the lack of fit in the ANOVA is >0.05 (p = 0.069), the first-order model appears to be appropriate for the data observed. The R2 statistic indicates that the model as fitted explains 84.28% of the variability in R. The accuracy of the first-order model is also proven by the estimation of the curvature (5.85 ± 4.54, confidence interval) which is calculated as the difference between the mean ± SD of the results obtained in the four experiments at the central point (12.2 ± 1.61) and the mean ± SD of the results obtained in experiments 1–16 (6.35 ± 8.02). This parameter represents the sum of the coefficients of the four factors squared and, in the case at hand, is negligible, since there is no statistically significant difference between the means of the two samples (p = 0.17).

Based on the coefficients of the factors and the representation of the response surfaces (Figure 6Go) of the above equation, we conclude that, in the experimental domain studied, extracellular ß-galactosidase activity increases with a rise in aeration and incubation time and as temperature and NaCl concentration decrease. The temperature is the most influential factor. A 20-fold range of variation of the extracellular ß-galactosidase activity values predicted by the model was observed in the experimental plan used and there was an 8-fold increase with respect to previously obtained values (Figure 5AGo).



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 6. . Response surfaces obtained in the experimental design studied according to the experimental plan defined in Table IVGo. These surfaces are planes defined by pairs of variables with the third and fourth variable being fixed (values –1, –1). R = response (extracellular ß-galactosidase activity). Names and values of variables are given in Table IIIGo. Experimental data are represented by black points.

 
In order to find an optimum condition positioned outside the experimental domain, the path of the steepest ascent was applied. No increase in the response was obtained under the conditions derived from this path (first, T = 19.5°C, A = 300 r.p.m./47.7 ml, C = 0, t = 73.47 h; second, T = 21.25°C, A = 300 r.p.m./48.8 ml, C = 0, t = 72.79 h). Therefore, we conclude that the optimum conditions are, within the experimental domain, in the corner –1 (T), 1 (A), –1 (C), 1 (t).

Although it has been reported that the secretion levels of heterologous proteins may be modified by the addition of reducing agents (De Nobel et al., 1990aGo, bGo, De Nobel and Barnett, 1991Go, Rossini et al., 1993Go) or detergents (Becerra and González Siso, 1996Go) to the culture medium, in the case of strain BJ3505/YEpFLAG1-LAC4, growing on YPHSM under the best conditions as previously determined, the addition to the medium of the reducing agents 2-mercaptoethanol (10–20 mM) or dithiothreitol (12.5–25 mM) caused an inhibition of the growth of the recombinant yeast and a concomitant decrease in extracellular ß-galactosidase activity. The detergent Tween-80 (0.2–0.4%) did not affect growth but no increase in extracellular ß-galactosidase activity was observed (data not shown).

Conclusions

On fusing a signal sequence to the gene, although the secretion of the K.lactis ß-galactosidase is hindered by the high molecular weight and oligomeric nature of the enzyme, we were able to develop efficient molecular tools and to achieve appreciable levels of extra-cellular activity in the culture medium. Partial secretion of the enzyme was obtained in both K.lactis, by fusion to the killer toxin signal peptide, and in S.cerevisiae, by fusion to the {alpha}-factor signal peptide. Observed percentages of secretion but not absolute values of extracellular ß-galactosidase activity in glucose media were higher with the system developed for K.lactis. We have improved secretion percentages by engineering the N-terminus of the protein introducing a stabilizing amino acid (Ser) in the first position of the mature protein. We propose that there is a structural and functional analogy between the K.lactis and E.coli ß-galactosidases based on the activity of the deletion mutants constructed, but we have not found a large segment of the K.lactis ß-galactosidase that can be removed without affecting activity but increasing secretion. Moreover, we have developed a model which describes the influence of several culture conditions on heterologous K.lactis ß-galactosidase secretion. Under the optimum conditions determined from this model, absolute values of extracellular ß-galactosidase produced by the S.cerevisiae recombinant strain BJ3505/YEpFLAG1-LAC4 were the highest of this work in glucose media.


    Notes
 
1 To whom correspondence should be addressed. E-mail: migs{at}udc.es Back


    Acknowledgments
 
We are grateful to the following for kindly providing strains and vectors: Dr Wésolowski-Louvel (Université Claude Bernard, France) for the MW 190-9B strain, Dr Fukuhara (Institute Curie, France) for the pSPGK1 plasmid, and to the dairy industry Quegalsa (Ferrol, Spain) for cheese-whey. This research was supported by an XUGA10302A98 grant from the Xunta de Galicia (Spain) and by a grant from the Universidade da Coruña (Spain). M.B. was the recipient of a fellowship from the Instituto Danone (Spain) during 1998–99.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Ausubel,F.M., Brent,R., Kinston,R.E., Moore,D.D., Seidman,J.G., Smith,J.A. and Struhl,K. (1995) Current Protocols in Molecular Biology. Wiley, New York.

Becerra,M. and González Siso,M.I. (1996) Enzyme Microb. Technol., 19, 39–44.

Becerra,M., Cerdán,M.E. and González Siso,M.I. (1997) Biochim. Biophys. Acta, 1335, 235–241.[Medline]

Becerra,M., Cerdán,M.E. and González Siso,M.I. (1998) Biotechnol. Tech., 12, 253–256.

Boyd,D. and Beckwith,J. (1990) Cell, 62, 1031–1033.[Web of Science][Medline]

Das,S. and Hollenberg,C.P. (1982) Curr. Genet., 6, 123–128.

Das,R.C., Shultz,J.L. and Lehman,D.J. (1989) Mol. Gen. Genet., 218, 240–248.[Web of Science][Medline]

De Nobel,J.G. and Barnett,J.A. (1991) Yeast, 7, 313–323.[Web of Science][Medline]

De Nobel,J.G., Klis,F.M., Prien,J., Munnik,T. and van den Ende,H. (1990a) Yeast, 6, 483–490.[Web of Science][Medline]

De Nobel,J.G., Klis,F.M., Munnik,T., Prien,J. and van den Ende,H. (1990b) Yeast, 6, 491–499.[Web of Science][Medline]

Dubois,M., Giles,U.A., Hamilton,J.K., Rebers,P.A. and Smith,F. (1956) Anal. Chem., 28, 350–356.

Fleer,R. et al. (1991) Gene, 107, 285–295.[Web of Science][Medline]

González Siso,M.I. (1996) Biores. Technol., 57, 1–11.

Guarente,L. (1983) Methods Enzymol., 101, 181–191.[Web of Science][Medline]

Ito,H., Fukuda,Y., Murata,K. and Kimura,A. (1983) J. Bacteriol., 153, 163–168.[Abstract/Free Full Text]

Jacobson,R.H., Zhang, X-J, DuBose,R.F. and Mattews,B.W. (1994) Nature, 369, 761–766.[Medline]

Jigami,Y., Muraki,M., Harada,N. and Tanaka,H. (1986) Gene, 43, 273–279.[Web of Science][Medline]

Katakura,Y., Ametani,A., Totsuka,M., Nagafuchi,S. and Kaminogawa,S. (1999) Biochim. Biophys. Acta, 1432, 302–312.[Medline]

Kowalski,J.M., Parekh,R.N. and Wittrup,K.D. (1998) Biochemistry, 37, 1264–1273.[Medline]

Kumar,V., Ramakrishnan,S., Teeri,T.T., Knowles,J.K.C. and Hartley,B. (1992) Bio/Technology, 10, 82–85.[Medline]

Lowry,C.V., Weiss,J.L., Walthall,A. and Zitomer,R.S. (1983). Proc. Natl Acad. Sci. USA, 80, 151–155.[Abstract/Free Full Text]

Miksch,G., Neitzel,R., Fiedler,E., Friehs,K. and Flaschel,E. (1997) Appl. Microbiol. Biotechnol., 47, 120–126.[Web of Science][Medline]

Pignatelli,R., Vai,M., Alberghina,L. and Popolo,L. (1998) Biotechnol. Appl. Biochem., 27, 81–88.

Poch,O., L'Hote,H., Dallery,V., Debeaux,F., Fleer,R. and Sodoyer,R. (1992) Gene, 118, 55–63.[Web of Science][Medline]

Porro,D., Martegani,E., Ranzi,B.M. and Alberghina,L.M. (1992) Biotechnol. Lett., 14, 1085–1088.

Rossini,D., Porro, D, Brambilla,L., Venturini,M., Ranzi,B.M., Vanoni,M. and Alberghina,L. (1993) Yeast, 9, 77–84.[Web of Science][Medline]

Sambrook, J, Maniatis,T. and Fritsch,E.F. (1989) Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Vanoni,M., Porro,D., Martegani,E. and Alberghina,L. (1989) Biochem. Biophys. Res. Commun., 164, 1331–1338.[Web of Science][Medline]

Varshavsky,A. (1996) Proc. Natl Acad. Sci. USA, 93, 12142–12149.[Abstract/Free Full Text]

Zhu,A., Wang,Z.K. and Beavis,R. (1998) Arch. Biochem. Biophys., 352, 1–8.[Web of Science][Medline]

Received September 7, 2000; revised January 29, 2001; accepted February 15, 2001.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Becerra, M.
Right arrow Articles by Cerdán, M.E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Becerra, M.
Right arrow Articles by Cerdán, M.E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?