Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Coley, A. M.
Right arrow Articles by Foley, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Coley, A. M.
Right arrow Articles by Foley, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Protein Engineering, Vol. 14, No. 9, 691-698, September 2001
© 2001 Oxford University Press

Rapid and precise epitope mapping of monoclonal antibodies against Plasmodium falciparum AMA1 by combined phage display of fragments and random peptides

Andrew M. Coley1,2,4, Naomi V. Campanale1, Joanne L. Casey1,2, Anthony N. Hodder3,4, Pauline E. Crewther3,4, Robin F. Anders1,4, Leann M. Tilley1,2 and Michael Foley1,2,5

1 Department of Biochemistry, La Trobe University, Bundoora, 3083, Victoria, 2 Cooperative Research Centre for Diagnostics, 3 Walter and Eliza Hall Institute of Medical Research, Melbourne, Victoria and 4 Cooperative Research Centre for Vaccine Technology, Australia


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
We describe an approach for the rapid mapping of epitopes within a malaria antigen using a combination of phage display techniques. Phage display of antigen fragments identifies the location of the epitopes, then random peptide libraries displayed on phage are employed to identify accurately amino acids involved in the epitope. Finally, phage display of mutant fragments confirms the role of each residue in the epitope. This approach was applied to the apical membrane antigen-1 (AMA1), which is a leading candidate for inclusion in a vaccine directed against the asexual blood stages of Plasmodium falciparum. As part of the effort both to understand the function of AMA1 in the parasite life cycle and to define the specificity of protective immune responses, a panel of monoclonal antibodies (MAbs) was generated to obtain binding reagents to the various domains within the molecule. There is a pressing need to determine rapidly the regions recognized by these antibodies and the structural requirements required within AMA1 for high affinity binding of the MAbs. Using phage displaying random AMA1 fragments, it was shown that MAb5G8 recognizes a short linear epitope within the pro-domain of AMA1 whereas the epitope recognized by MAb 1F9 is reduction sensitive and resides within a disulphide-bonded 57 amino acid sub-domain of domain-1. Phage displaying random peptide libraries and mutant AMA1 fragments were employed for fine mapping of the MAb5G8 core epitope to a three-residue sequence in the AMA1 prodomain.

Keywords: combined phage display/epitope mapping/malaria antigen/Plasmodium falciparum


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The apical membrane antigen-1 (AMA1) is expressed by the erythrocytic form of the malarial parasite during schizogony and is initially localized to the neck of the rhoptries, flask-shaped organelles located at the apical end of the merozoite. Around the time of invasion AMA1 is redistributed to the surface of the merozoite (Peterson et al., 1989Go). The finding of AMA1 in these locations is consistent with a potential role in erythrocyte invasion. Although the precise nature of this role is the subject of speculation, it may play a role in apical reorientation of attached merozoites prior to invasion (Waters et al., 1990Go; Narum and Thomas, 1994Go; Holder, 1996Go). A recently described molecule, MABEL, which shares structural features with both AMA1 and EBA, is another protein that has been localized to the rhoptries with subsequent redistribution to the merozoite surface (Noe and Adams, 1998Go).

Furthermore, evidence was presented to show that the region of MABEL that shared homology with AMA1 was the region that bound to erythrocytes when expressed on COS cells, reinforcing the suggestion that AMA1 is involved in the invasion process (Noe and Adams, 1998Go). AMA1 is a type I integral membrane protein and has 16 cysteine residues in the ectodomain that are spatially conserved in all Plasmodium spp. studied (Peterson et al., 1990Go; Cheng and Saul, 1994Go; Dutta et al., 1995Go). The cysteine connectivities within AMA1 suggest that the ectodomain of the protein can be divided into four domains (pro-domain, domain-1, domain-2 and domain-3) restricted by intramolecular disulfide bonds (Hodder et al., 1996Go). The AMA1 protein of P.falciparum differs slightly from AMA1 of other species in that the prosequence contains a 55-residue insert absent from AMA1 molecules from other species (Peterson et al., 1990Go). A proteolytic event removes a small fragment from the N-terminus of AMA1, reducing the initial polypeptide from 80 to 62 kDa, at about the time the protein migrates onto the surface of the merozoite (Narum and Thomas, 1994Go). The functional consequences of this processing event, as well as the position of the precise cleavage sites within AMA1, are unknown and further studies with defined reagents are required to elucidate the mechanisms involved.

Antibodies that bind to AMA1 and inhibit the invasion of merozoites have been described (Deans et al., 1982Go; Kocken et al., 1998Go) and immunization of mice and monkeys with either native or recombinant AMA1 induces a protective immune response against their respective plasmodial infections (Deans et al., 1988Go; Collins et al., 1994Go; Crewther et al., 1996Go; Anders et al., 1997Go). These observations are further supported by adoptive transfer experiments (Anders et al., 1997Go). Additional immunization studies indicate that the correct disulfide conformation is required for protective antibody responses (Anders et al., 1997Go).

We are in the process of developing a panel of monoclonal antibodies in order to study the function of P.falciparum AMA1 and its potential role as a mediator of erythrocyte invasion. To this end we have generated two MAbs which recognize both recombinant refolded P.falciparum AMA1 and the native molecule expressed in parasites. Preliminary studies indicated that one of these Mabs only binds to non-reduced AMA1 whereas the other recognizes both reduced and non-reduced forms of the protein. Thus both MAbs recognize different surface features of AMA1. In order to characterize these MAbs and determine the precise nature of the epitope on AMA1, we used the approach of phage display. Since the first reports that foreign peptides can be displayed on the surface of filamentous phage (Smith, 1985Go), the display of proteins, protein domains and peptides on bacteriophage has proved to be a powerful approach to elucidate the molecular nature of many different protein–protein interactions (Wilson and Finlay, 1998Go). Phage displayed antibody fragments have been selected against a variety of antigens including AMA1 (Fu et al., 1997Go) and cancer antigens (Cai and Garen, 1996Go), growth factor mimotopes have been generated (Wrighton et al., 1996Go) and receptor–ligand interactions have been elucidated using this technology (Kiewitz and Wolfes, 1997Go). Phage display technology relies on the fusion of a DNA sequence encoding a protein or polypeptide with the gene encoding a structural protein present on bacteriophage. When the phage protein gpIII is expressed it is fused with the protein or peptide sequence of interest, which is then incorporated into a phage particle as part of the natural phage assembly process. The result is a phage displaying the fusion protein on its surface and containing within the phage particle the genetic material encoding for the displayed peptide or protein (Smith and Scott, 1993Go).

In this paper, we describe the display of defined domains and fragments of AMA1 in the context of bacteriophage M13 and show that a library comprising random fragments of the molecule is an efficient method of epitope mapping antibodies specific for linear and conformationally constrained epitopes of AMA1. We also demonstrate that the isolation of mimotopes from random peptide libraries displayed on phage, specific for one of the antibodies, can allow the fine mapping of a linear epitope to within a few residues. In addition to identifying epitopes, these fragment libraries will have great potential in delineating functional domains of AMA1 which may be involved in erythrocyte invasion.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Generation of monoclonal antibodies and phage-displayed defined fragments of P.falciparum AMA1

Monoclonal antibodies to P.falciparum AMA1 3D7 strain were generated by standard procedures (Harlow and Lane, 1988Go). Briefly, mice were immunized with recombinant, refolded P.falciparum AMA1, spleens excised and B cells isolated. Fusions were carried out and individual clones isolated. The ability of secreted antibodies to react with AMA1 was assayed in an ELISA format, immunoblotting of native AMA1 from cultured parasites and immunofluorescence assay of 3D7 schizonts and merozoites. Two antibodies were selected from the panel generated: 5G8, recognizing a reduction insensitive epitope, and 1F9, which reacted with AMA1 only in the non-reduced state.

Oligonucleotide primers were generated in order to amplify the entire ectodomain and individual subdomains as described by Hodder et al. (Hodder et al., 1996Go). PCR reactions were carried out as previously described (Deans et al., 1984Go) and the products restricted with appropriate enzymes and ligated into the correspondingly restricted phagemid vector pHENH6. This phagemid vector contains a copy of the M13 bacteriophage geneIII and a multicloning site between the periplasmic signal sequence and the functional geneIII protein (gpIII) (a kind gift from Peter Waterhouse, CSIRO Plant Industry, Canberra, Australia). Ligation of dsDNA into the multicloning site allows expression of the polypeptide of interest with the geneIII product and subsequent display of the fusion protein on M13 bacteriophage after phage rescue. The ligation product was transformed into Escherichia coli TG1 cells (Stratagene) by electroporation and the resulting clones were assayed for the presence of the AMA1 domains by PCR using autologous primers. Clones containing appropriate AMA1 fragments were cultured in 10 ml of 2TY broth containing 50 µg/ml ampicillin to an optical density (OD) of 0.6 at 600 nm and 1x1011 PFU M13 helper phage was added and incubated for 30 min at 37°C. This culture was then transferred to 200 ml of `Super Broth' containing 70 µg/ml kanamycin and incubated at 30°C, shaking at 200 r.p.m. for 16 h. Phage were isolated by PEG precipitation as previously described (Adda et al., 1999Go) and phage titres established.

Generation and affinity panning of phage displayed AMA1 gene library

The AMA1 ectodomain PCR product was digested with DNase I for various times and the digestion products were separated by agarose electrophoresis. The time point which showed the broadest size distribution was chosen, the DNA was purified and ragged ends blunted with the aid of Vent polymerase. pHENH6 phagemid vector was restricted with PstI and similarly blunted with Vent polymerase. The blunt products of the randomly fragmented AMA1 ectodomain were then ligated into the treated pHENH6 vector and the ligation products were transformed into E.coli TG-1 cells by electroporation. The diversity of the gene library was estimated to be in the order of 5x108 individual clones by limiting dilution of the transformed bacterial cells. The essential random distribution of fragments in the library was assayed by PCR and sequencing of 12 individual clones. Coverage appeared to be random and clones were isolated with fusions in both directions and in a random set of frames. The library was displayed on M13 bacteriophage and the phage isolated by PEG precipitation in the same manner as the defined fragments. Affinity panning of the phage library was carried out as previously described (Adda et al., 1999Go). Briefly, 1.0 µg of MAb in 100 µl of PBS was added to each of 10 wells in a 96-well ELISA plate. The plate was washed x2 in PBS–0.2% Tween 20 and 1x 1012 phage particles in 100 µl of PBS were added. The plate was incubated at 20°C for 1 h and the non-adherent phage particles were washed away by washing x2 in PBS–Tween 20. Adherent phage were eluted by the addition of 0.2 M glycine, pH 2.2. The eluate was immediately added to 10 ml of log phase (OD 0.6) E.coli TG-1 cells and incubated at 37°C for 1 h to allow the eluted phage to infect the E.coli. Ampicillin was added to 50 µg/ml and the culture was incubated for a further 1 h at 37°C, then 5x1011 M13 helper phage were added and the culture incubated for a further 1 h at 37°C. The culture was added to 200 ml of SB containing ampicillin (50 µg/ml) and kanamycin (70 µg/ml) and incubated at 30°C, shaking at 200 r.p.m. for 16 h. Phage were harvested as previously described and another round of panning was carried out with the freshly isolated phage. Four rounds of panning were carried out on each MAb. Phage titrations were carried out after each round of panning to ensure that equal numbers of phage particles were added to each round of panning. Individual clones were selected after every round of panning, their inserts amplified by PCR and sequenced in order to establish the identity of the fragments of AMA1 binding to each MAb.

Panning a random peptide library on MAb5G8

A random peptide library was also panned on the 5G8 MAb. This library was a kind gift from Professor George Smith (University of Missouri, Columbia, MO). This library is in fd-tet phage background and requires no phage rescue and produces phage constitutively. An E.coli K91 culture containing the 15mer peptide library was propagated overnight in 200 ml of 2xTY at 37°C and phage were harvested in the same manner as previously described. Phage panning was carried out as described above and by Adda et al. (Adda et al., 1999Go). Isolated clones were amplified by PCR and the products sequenced in order to establish the identity of the peptide fused to the gpIII protein. The specificity of the interaction between these peptides and MAb5G8 was further demonstrated by ELISA and immunoblotting of the phage preparations.

Construction of phage displaying defined mutations within the AYP motif

The following oligonucleotides were designed to introduce mutations in the amino acid sequence of the tripeptide motif:

AYP:AGTTTCGGCCCCAGCGGCCCCGTCTATTGGATATGCGTGTTG

AYA:AGTTTCGGCCCCAGCGGCCCCGTCTATTGCATATGCGTGTTG

AAA:AGTTTCGGCCCCAGCGGCCCCGTCTATTGCTGCTGCGTGTTG

AAP:AGTTTCGGCCCCAGCGGCCCCGTCTATTGGTGCTGCGTGTTG

The SfiI restriction sites are shown in bold. Oligonucleotides were synthesized and used as the 3' primers in a polymerase chain reaction with AMA1 DNA as a template. The common 5' primer corresponding to the YQQEDSG amino acid sequence of AMA1 was TCACTCGGCCGACGGGGCCTACCAACAAGAAGATTCAGGAG. Products of PCR were extracted from 15% polyacrylamide gels, purified using a Qiaex II kit (Qiagen) and cleaved with SfiI restriction endonuclease. The cleaved products were ligated at 16°C overnight at a 3:1 molar ratio of insert to fUSE5 phage vector (Smith and Scott, 1993Go). Following purification with Qiaex II the ligated products were transformed into MC1061 E.coli cells (Stratagene) using a Bio-Rad Gene Pulser. Clones from each ligation were sequenced using primers within the vector sequence flanking the insert site (CCTCATAGTTAGCGTAACG) and DNA with the correct sequences subsequently re-transformed into K91 E.coli cells (a kind gift from G.Smith, University of Missouri). Phage were produced and used as described above.

Immunoblotting of phage displayed AMA1 fragments

2x1012 phage particles were separated by SDS–PAGE and transferred on to an Immobilon PVDF membrane. The membrane was blocked in 10% skimmed milk and the primary antibody (either monoclonal or rabbit anti-AMA1 polyclonal serum) was added for 1 h. The membrane was washed for 1 h in PBS containing 0.2% Tween 20 with three changes. Secondary antibody was then added (either HRP-conjugated goat anti-rabbit or rabbit anti-mouse), incubated for 30 min and the washing procedure was repeated. The blots were visualized by enhanced chemiluminescence.

ELISA of phage displayed AMA1 fragments

Anti-AMA1 antibodies (50 µl) were added to wells of a Maxisorp (Nunc) ELISA plate at a concentration of 5 µg/ml for the MAbs or 1/1000 dilution for the antiserum and allowed to absorb for 1 h at 37°C. The plates were then blocked with 10% skimmed milk–PBS for 1 h at 37°C and subsequently washed in PBS–0.2%Tween 20 three times. 1x1012 phage particles (or dilutions thereof) were added to the wells and incubated at 20°C for 1 h, followed by washing and addition of HRP-conjugated anti-M13 MAb at the appropriate dilution and incubation at 20°C for 30 min. The plates were then washed four times and H2O2 substrate and OPD colour reagent (Sigma) were added according to the manufacturer's instructions. The reactions were stopped by the addition of 0.5 M H2SO4 and the plates were read spectrophotometrically. Results were displayed graphically. All reactions were carried out in duplicate. In some instances peptide competition assays were carried out. In this case dilutions of peptide were added to known amounts of phage prior to the addition of phage to the plate. The assays were then carried out in the same manner as described.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Generation of phage displaying defined fragments of P.falciparum AMA1

Determination of the cysteine connectivities allowed the assignment of four putative domains, pro-sequence, domain-1, domain-2 and domain-3, in the AMA1 ectodomain that is exposed on the exterior surface of the merozoite (Hodder et al., 1996Go). We designed specific oligonucleotides to amplify fragments corresponding to these domains with an additional two fragments, one comprising the whole ectodomain and the other containing the pro-sequence plus domain-1 (Figure 1AGo). These fragments were cloned into the phagemid expression vector pHENH6, transformed into E.coli and phage expressing the corresponding protein fragments were harvested.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 1. . Phage display of defined AMA1 fragments. (A) A schematic of AMA1 with solid bars indicating the constructs cloned into phagemid pHENH6. (B) Western blot of phage displaying various defined fragments were electrophoresed on SDS–PAGE, transferred to PVDF and probed with a polyclonal rabbit antiserum (R2323) raised against recombinant AMA1 ectodomain. Rec AMA1 is E.coli produced refolded AMA1 ectodomain. Arrowhead corresponds to the expected size of AMA1 fused to gpIII. (C) ELISA showing binding of phage displaying various AMA1 fragments to immobilized MAb5G8, 1F9 and polyclonal rabbit antiserum (R2323). M13 is wild-type Fd phage without a fusion protein.

 
Western immunoblotting of immobilized phage proteins after separation on SDS–PAGE, using a rabbit antiserum (R2323) generated against recombinant P.falciparum AMA1, revealed the presence of AMA1 reactive fusion proteins in phage expressing all five constructs (Figure 1BGo). The sizes of these bands corresponded to the expected sizes of protein fusions between the gpIII product and the defined fragments of AMA1. As expected, no reactivity was detected on M13 bacteriophage not expressing AMA1 fragments. These results indicate that the fragments are efficiently produced by the bacteria and effectively packaged into M13 bacteriophage particles in such a way as to be recognized by polyclonal antiserum raised against refolded recombinant AMA1. An Mr {approx} 118 kDa protein that reacted with AMA1 antisera corresponds to the gpIII phage protein (45 kDa) fused to the whole ectodomain (60 kDa), illustrating that even relatively large proteins can be efficiently expressed on M13 bacteriophage (Figure 1BGo, lane 2). There appears to be some proteolysis of this fusion protein, as evidenced by a faint band around 60 kDa in this lane. These proteolytic fragments are clearly seen when probed with MAb1F9 (see Figure 8BGo, second lane).



View larger version (58K):
[in this window]
[in a new window]
 
Figure 8. . Identification of MAb1F9 epitope. (A) Schematic of the structure of AMA1 with solid bars indicating the positions of the defined fragments (Pro+1, Dom-1) that bind to MAb1F9 and two fragments (1.2.1, 1.4.1) isolated from the AMA1 random fragment library by panning on the MAb. (B) Phage proteins from the various constructs were separated by non- reducing SDS–PAGE, transferred to a PVDF membrane and probed with MAb1F9. The lanes represent phage displaying different fragments. M13 phage that do not display a fragment (M13) did not react with the antibody.

 
To investigate further phage expressing defined fragments of AMA1, we performed ELISA analysis on phage with the polyclonal antisera described above and two MAbs generated against the AMA1 ectodomain (Figure 1CGo). Consistent with the Western blotting analysis, antisera (R2323) recognized phage displaying all defined fragments (Pro+1, Dom-1, Dom-2 and Dom-3), but did not recognize M13 lacking an inserted AMA1 fragment. MAb5G8 bound to phage displaying only the fragment representing the prosequence + domain-1 (Pro+1), but did not recognize domain-1 alone, suggesting that the epitope is located in the prosequence. Although it was possible that incorrect folding of domain-1 was responsible for the lack of MAb5G8 recognition, further experiments support the conclusion that the epitope is within the prodomain (Figure 3AGo). Unlike MAb 5G8, which binds to a linear epitope, MAb1F9 recognizes a conformational epitope since its binding to recombinant AMA1 was dramatically reduced when the antigen was reduced and alkylated (data not shown). When the same ELISA assay was carried out using the 1F9 MAb, only fragments consisting of the prosequence + domain-1 (Pro+1) and domain-1 (Dom-1) were recognized by the antibody. This indicates that the antibody most likely recognizes an epitope within domain-1. In each case, M13 phage lacking AMA1 fragments displayed on their surface were not recognized by the MAbs.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 3. . Panning the random AMA1 library displayed on phage on MAb5G8 to determine the epitope. (A) Schematic of the structure of AMA1 with solid bars indicating the positions of the defined fragments that react with MAb5G8 (AMA1, Pro+1) and the corresponding locations of fragments isolated after four rounds of panning the random fragment library on MAb5G8. (B) These fragments were found to react with MAb5G8 by Western blot. The lanes represent phage displaying different fragments and recombinant AMA1 (rec AMA1) which were used for comparison. M13 phage that do not display a fragment (M13) did not react with the antibody.

 
Identification of MAb5G8 epitope using a phage library expressing AMA1 random fragments

A gene fragment corresponding to the ectodomain of AMA1 was amplified and digested with DNase I for various times. Conditions that yielded fragments between 50 and 400 bp were used to produce a pool of AMA1 ectodomain gene fragments, (Figure 2AGo), which were then cloned into pHENH6 to give a library size of ~108 independent clones. Several clones picked at random and sequenced revealed an essentially random distribution in orientation and sequence (Figure 2BGo), thus confirming that our library was representative of AMA1 ectodomain sequence. It should be noted that, as expected, most of the clones were out of frame; however, the size of the library is such that there should be adequate coverage of the AMA1 for practical purposes.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 2. . Construction of a random AMA1 library displayed on phage. (A) An ethidium bromide-stained agarose gel of AMA1 ectodomain gene fragment incubated at various times (as shown) with DNase I. (B) Schematic representing the positions of 10 clones picked at random from the unpanned library and an ethidium bromide-stained agarose gel showing the corresponding PCR amplifications from these clones.

 
This phage displayed library was panned on immobilized MAb5G8 and clones obtained after three rounds of panning were sequenced. All clones were found to be in frame and clustered at the N-terminal region of AMA1 and most clones lay entirely within the pro-sequence (Figure 3BGo). The sizes of the isolated clones ranged from large fragments spanning the pro-sequence and domain-1 of AMA1 down to fragments of 19 and 20 amino acids in length. The smallest clone consisted of a 19 amino acid sequence, ...QQEDSGEDENDLQHAYPID..., that was common to all the MAb5G8 binding clones, thus enabling us to locate the MAb5G8 epitope to within an area of <5% of the AMA1 sequence and towards the end of the N-terminal pro-sequence. This 19 amino acid sequence was found to be present only in AMA1 from P.falciparum and was absent from other Plasmodium spp. (Figure 4AGo), consistent with this is the observation that MAb5G8 recognizes P.falciparum AMA1 in a dose-dependent fashion in an ELISA and does not bind to P.chabaudi AMA1 (Figure 4BGo).



View larger version (47K):
[in this window]
[in a new window]
 
Figure 4. . MAb5G8 reacts with a sequence within P.falciparum AMA1 but not P.chabaudi AMA1. (A) Alignment of the N-terminal sequences of AMA1 from a variety of parasite sources. The boxed region contains the 19-residue region that contains the MAb5G8 epitope. (B) Recombinant AMA1 from P.falciparum and P.chabaudi were immobilized on microtitre wells and probed with increasing concentrations of MAb5G8. Binding was observed only to the P.falciparum AMA1

 
Mimotopes enriched from a random peptide library displayed on phage aid in the fine mapping of the MAb5G8 epitope

In an effort to define more precisely the epitope of MAb5G8, we panned a library of phage displaying a 15-residue random peptide library. Four rounds of panning resulted in significant enrichment of phage that bound specifically to MAb5G8 as assessed by ELISA, whereas no binding was seen with pooled phage from any of the four rounds of panning when MAb5G8 was replaced with BSA (Figure 5AGo). When the proteins of selected phage clones were separated by SDS–PAGE and blotted on to nylon membranes, MAb5G8 recognized the peptide fused to gpIII (Figure 5BGo, clones 1, 2, 3); however, there was no binding of MAb5G8 to phage displaying a peptide that was isolated by panning on an irrelevant protein (Figure 5BGo, clone C). MAb5G8 also recognized bacterially expressed AMA1 under the same conditions (Figure 5BGo, lane A). Selected clones after four rounds of panning (Figure 5DGo, clones 1, 2, 3, 4) were shown to bind to MAb 5G8-coated ELISA plates, in a dose-dependent manner, whereas a clone containing a peptide isolated by panning the same library on an unrelated protein (Figure 5DGo, control) was unable to bind MAb5G8 even at 1011 CFU/ml. Evidence that these phage clones were binding specifically to the antigen binding site of MAb5G8 was obtained by competing the interaction between MAb5G8 and the phage displaying the binding peptide with recombinant AMA1. Incorporation of recombinant AMA1 in an ELISA assay consisting of phage displaying a binding peptide and MAb5G8 resulted in a 3-fold reduction of binding of two individual phage clones isolated from the fourth round of panning, to immobilized MAb5G8 (Figure 5CGo), although this inhibition of phage binding to MAb5G8 by AMA1 was not complete at the concentrations examined.



View larger version (29K):
[in this window]
[in a new window]
 
Figure 5. . Enrichment of phage displaying MAb5G8 binding peptides. (A) ELISA of pools of phage clones after each round of panning. Pooled phage were amplified and equivalent amounts added to each well of a microtitre plate precoated with MAb5G8 or BSA. Phage were detected with an anti-M13–HRP-conjugated antibody. (B) selected phage clones were separated by SDS–PAGE, transferred to a PVDF membrane and probed with MAb5G8. The position of the peptides–gpIII fusion is marked by an arrow. Clone C consists of phage containing a peptide obtained by panning on an irrelevant protein. Recombinant AMA1 (lane A) is shown for comparison. (C) Two phage clones that display AMA1 binding peptides (clone 2 dark columns, clone 3 light columns) were incubated with MAb5G8 immobilized on wells of a microtitre plate. Increasing concentrations of recombinant AMA1 were added and bound phage detected using an anti-M13-HRP conjugated antibody. (D) Increasing numbers of phage of representative clones after panning were applied to wells of a microtitre plate coated with MAb5G8. A clone displaying a peptide obtained after panning on an irrelevant antigen was also examined.

 
Phage clones that had a specific affinity for MAb5G8 were propagated and the region of DNA corresponding to the random peptide was sequenced. It was found that all clones contained the same translated insert sequence, DRHSRIVILMPLAYP. A comparison of this mimotope sequence with the 19-amino acid sequence identified from the fragment library reveals a common tripeptide motif, alanine–tyrosine–proline (AYP) (Figure 6AGo). Based on this information, it was expected that AYP would either correspond to the MAb5G8 epitope or form the core residues of the epitope. To confirm that the AYP motif was important for the binding MAb5G8, we obtained the mimotope DRHSRIVILMPLAYP (Figure 6AGo, M1) and two 12-residue peptides that span the 19-residue epitope (Figure 6AGo, E1 and E2) as synthetic peptides. Peptides E1 and E2 overlapped in the central seven residues and the latter contained the AYP motif whereas the former did not. These were assayed for their ability to compete with the binding of MAb5G8 to AMA1. As can be seen from Figure 6BGo, those peptides that contained the AYP motif within their sequence (M1, E2) inhibited MAb5G8 binding to AMA1, whereas the peptide that lacked this sequence (E1) had no effect on binding. This strongly suggests that the three-residue AYP motif is a critical feature of the epitope on AMA1 recognized by MAb5G8. Interestingly, under the conditions of this experiment the 12-mer peptide constituting the actual sequence of AMA1 (containing AYP) appeared to be almost 100-fold more efficient at inhibiting MAb5G8 binding to AMA1 than the 15-mer mimotope isolated from the random peptide library. This argues that while the AYP motif is critical for binding, adjacent residues also play a part in the overall affinity of the epitope for MAb5G8.



View larger version (27K):
[in this window]
[in a new window]
 
Figure 6. . Peptides containing AYP inhibit binding of MAb5G8 to AMA1. (A) Alignment of sequences of AMA1 containing the MAb5G8 epitope and the mimotope that binds to MAb5G8 (top). Positions of two overlapping synthetic peptides (E1, E2) spanning the region containing the MAb5G8 epitope (bottom). (B) MAb5G8 was incubated in wells precoated with AMA1 and containing increasing concentrations of various peptides. Binding of antibody was detected by HRP-conjugated anti-mouse IgG.

 
Mutation of AYP motif abolishes binding of MAb5G8

Confirmation that the AYP motif is critical for the binding of MAb5G8 to AMA1 was achieved by examining the binding of phage displaying the 19-residue AMA1 sequence with mutations introduced into the motif. As can be seen in Figure 7Go, the three mutants with mutations in either the tyrosine or the proline or both result in a dramatic reduction in binding compared with phage displaying the 19-residue peptide with the intact AYP motif. Hence these two residues contribute a significant amount of energy to the binding of this epitope to MAb5G8.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 7. . Binding of phage displaying peptides with mutations within the tripeptide AYP motif to MAb5G8. Four recombinant phage were constructed and their binding to immobilized MAb5G8 was assessed by ELISA. The binding of the phage with mutations introduced into the tripeptide motif within the 19-residue displayed peptide is represented by the bars and the sequence is shown below each bar.

 
A random fragment library on phage can identify the region of AMA1 containing the conformationally dependent epitope recognized by MAb1F9

MAb1F9 recognizes refolded recombinant AMA1 only in its non-reduced form, hence the epitope for this MAb on AMA1 is dependent on the correct folding of the molecule and its stabilization by disulphide bonds. Western blot analysis of the defined AMA1 fragments expressed on phage using the MAb1F9 showed that the MAb recognized the whole AMA1 ectodomain and also fragments containing pro-sequence plus domain-1 (Pro+1) and domain-1 (Dom-1) alone. MAb1F9 does not bind to domain-2 (Dom-2) or domain-3 (Dom-3) fragments (Figure 8AGo and B). When the AMA1 random fragment library was panned on MAb1F9 two in-frame clones were isolated that localized to domain-1 (Figure 8BGo). The larger of the fragments (1.2.1) spanned the two loops defined by cysteines 2 and 3 and cysteines 4 and 5. The smaller fragment (1.4.1) was contained within fragment 1.2.1 and consisted of 26 residues N-terminal to cysteine 2 and terminated immediately after cysteine 3. It has been shown that cysteines 2 and 3 are connected in AMA1 forming a loop within domain-1 which is itself delineated by the connectivity between cysteines 1 and 6 (Hodder et al., 1996Go). Interestingly, no fragments were observed to contain odd numbers of cysteine residues, presumably reflecting a combination of the dependence of this epitope on disulphide and the intolerance of the bacterial system for lone unpaired cysteines (Kay et al., 1993Go; Zhong et al., 1994Go). Confirmation that these fragments were recognized by MAb1F9 was obtained by Western blotting of phage containing these fragments with MAb1F9 (Figure 8BGo). Furthermore, this binding was significantly reduced when the phage were electrophoresed under reducing conditions (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
We have made use of both random peptide and random fragments of AMA1 expressed on phage to pan on MAbs raised against AMA1 as a valid approach for rapid epitope mapping. Fine mapping and verification of the role of certain residues in the identified motif were also rapidly performed by phage display of epitope mutants. This approach can quickly localize both linear and disulphide constrained epitopes on AMA1.

AMA1 represents a severe test of the limits of the phage display approach since the molecule has a complex folded structure stabilized by eight intramolecular disulphide bonds (Hodder et al., 1996Go). The spacing of 16 cysteine residues is absolutely conserved in all Plasmodium spp. so far examined (Peterson et al., 1989Go; Dutta et al., 1995Go; Marshall et al., 1995Go). The eight disulphide bonds partition the AMA1 ectodomain into three putative domains plus a prodomain and presumably stabilized the tertiary structure (Hodder et al., 1996Go). It was difficult to predict whether AMA1 fragments expressed on phage would be presented in a form resembling the native structure and whether the appropriate disulphide connections would be made. As a first step, we expressed defined AMA1 fragments corresponding to the putative domains on phage. Interestingly, the complete AMA1 ectodomain was found to be expressed on phage despite its relatively large size (Mr {approx} 60 kDa). The phagemid system used in this study probably facilitates the expression of large protein fragments on phage since there will be an average of less than one copy of the fusion protein per phage particle (Lasters et al., 1997Go). The additional four copies of wild-type gpIII protein promote attachment and entry of the phage into a host bacterial cell. Phage expressing the AMA1 ectodomain were recognized by monoclonal antibodies MAb5G8, MAb1F9 and rabbit antiserum raised against AMA1 by ELISA and by Western blotting. Furthermore, MAb1F9 recognizes a reduction sensitive epitope which is present on these phage. Hence we conclude that at least a proportion of phage are expressing AMA1 ectodomain in a correctly folded form resembling the native conformation AMA1 conformation with respect to the 1F9 antibody.

The presence of two faster migrating MAb1F9 reactive bands in these preparations (Figure 8BGo, lane Pro+1+2+3), suggests that there was some proteolytic cleavage of the ectodomain from the phage framework either during phage assembly or, more likely, after phage preparation. Although different in molecular weights, the pattern of cleavage products is similar to the proteolytic cleavage products of AMA1 in parasites as described by Crewther et al. (Crewther et al., 1990Go). It is tempting to speculate that the processing events that occur in AMA1 around the time of merozoite invasion of erythrocytes are reproduced in this in vitro phage expression system, presumably via a bacterial protease. The importance of this proteolysis in parasites is unknown and this phage system may aid in defining the molecular events involved.

In addition to the AMA1 ectodomain, smaller fragments of AMA1 have been expressed on phage with intact conformational epitopes. Thus the MAb1F9 epitope, which is reduction sensitive, is retained on domain-1 expressed on phage (Figures 1 and 8GoGo). On Western blots, however, the smear surrounding the band corresponding to domain-3, which contains closely spaced cysteine residues in a cysteine knot-like motif (Figure 1Go), suggests that there may be some misfolding of this domain, possibly leading to incorrect cysteine pairing. Thus the favourable oxidizing environment in the periplasm promotes disulphide bond formation and facilitates the expression of functional proteins (Skerra and Pluckthun, 1988Go; Bardwell, 1994Go).

Examination of clones from the random fragment library revealed that most were random in size, orientation and sequence. It was possible to enrich from this library several clones that had AMA1 sequences in frame with the gpIII protein of the phage, by panning on MAb5G8 and MAb1F9. The two antibodies enriched a different sub-set of clones originating from distinct domains of AMA1. Several rounds of panning were sufficient to locate the regions on AMA1 that contain the epitopes for these two MAbs.

The epitope of MAb 5G8 was mapped to a 19-residue linear sequence within the AMA1 pro-sequence. The MAb5G8 fragment lies within a 55 amino acid sequence that is found only in P.falciparum AMA1 and not AMA1 from other species of malaria (Peterson et al., 1989Go). Consistent with this, MAb5G8 did not bind to AMA1 from P.chabaudi. Thus, as has been demonstrated in other systems (Zhong et al., 1994Go; Wang and Yu, 1998), phage display of random fragments is a convenient approach for epitope mapping for malaria antigens.

Phage display libraries expressing random peptides have been used for defining binding sites for antibodies and other proteins in a wide variety of systems including malaria (Kay et al., 1993Go; Wrighton et al., 1996Go; Adda et al., 1999Go; Koivunen et al., 1999Go). Four rounds of panning of MAb5G8 on a 15-residue random peptide library produced a single binding peptide which contained within the sequence a three residue motif AYP which was found within the 19 residues common to all the enriched fragments from the random fragment library. Further experiments demonstrated that of the two overlapping peptides that span the 19-residue fragment only those containing AYP were able to interact with MAb5G8. AYP is critical for MAb5G8 binding, but does not appear to be sufficient in itself since the small peptide consisting of the 12 natural residues on AMA1 that include AYP binds to MAb5G8 with 100-fold greater apparent affinity than the mimotope. Thus amino acid sequences flanking clearly affect interaction with MAb5G8. A search of malaria proteins in the WHO malaria database identified 12 proteins with AYP in their primary sequence. However, MAb 5G8 is specific for AMA1 and this is consistent with the epitope consisting of AYP in the context of appropriate flanking residues and accessible on the surface of the folded protein. Although the flanking residues may affect the overall binding affinity of the epitope to MAb5G8, mutation of either the tyrosine or the proline residue or both to alanine results in almost complete abolition of binding (Figure 7Go). Hence these two residues must confer the bulk of the binding energy of this epitope to the antibody.

MAb1F9, which only recognizes AMA1 in the oxidized form, was used to pan the random fragment library. The epitope was contained within a 57-residue region that comprised cysteines 2 and 3 along with 26 residues N-terminal to cysteine 2. Cysteines 2 and 3 form one of the three intramolecular disulphide bonds in domain-1 of the AMA1 ectodomain as described by Hodder et al. (Hodder et al., 1996Go). No smaller fragments binding to MAb1F9 which contrasted with the fragments isolated by panning on MAb5G8. Hence the MAb1F9 epitope most likely comprises two or more clusters of amino acids brought into close contact and stabilized by the disulphide bond involving cysteines 2 and 3. Further fine mapping of the MAb1F9 epitope could use a strategy described by Jespers and colleagues (Jespers et al., 1997Go), where a library of mutants is created on phage and by negative selection the residues that contribute to binding can be identified.

The use of the phage display for the identification of the minimal epitopes may allow the synthesis of small peptides or fragments rather than large native proteins which can be difficult to produce in a recombinant form. Immunization with these peptides or fragments may focus the immune response to regions of antigens that are known to generate a protective antibody response. Such an approach could have important benefits if immunization with AMA1, like MSP-1, generates antibodies which bind close to the epitope of protective antibodies and block the protective action of serum antibodies (Guevara Patino et al., 1997Go).

AMA1 can be considered to be a prototype of other P.falciparum cysteine-rich proteins whose structure and function are governed by intramolecular disulphide bonds. The induction of protective immune responses by MSP119 and AMA1, the two leading P.falciparum asexual stage vaccine candidates, is dependent on conformational epitopes stabilized by disulphide bonds. Other malaria proteins with important functions in development of the malaria parasite, e.g. var, eba, also have cysteine-rich domains and clearly phage display is a potentially useful approach for analysing structure–function relationships in these proteins.


    Notes
 
5 To whom correspondence should be addressed, at La Trobe University. E-mail: m.foley{at}latrobe.edu.au Back


    Acknowledgments
 
This work was supported by the Australian Research Council and the National Health and Medical Research Council of Australia and La Trobe University Grants Scheme. We thank Sue Mullins for excellent technical support.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Adda,C.G., Tilley L.M., Anders,R.F. and Foley M. (1999) Inf. Immun., 67, 4679–4688.[Abstract/Free Full Text]

Anders,R.F., Crewther,P.E., Edwards,S., Margetts,M., Matthew,M.L.S.M., Pollock,B. and Pye,D. (1997) Vaccine, 16, 240–247.

Bardwell,JC. (1994) Mol. Microbiol., 14, 199–205.[Web of Science][Medline]

Cai,X. and Garen,A. (1996) Proc. Natl Acad. Sci. USA, 93, 6280–6285.[Abstract/Free Full Text]

Cheng,Q. and Saul,A. (1994) Mol. Biochem. Parasitol., 65, 183–187.[Web of Science][Medline]

Collins,W.E. et al (1994) Am. J. Trop. Med. Hyg., 51, 711–719.

Crewther,P.E., Culvenor. J.G., Silva,A., Cooper,J.A. and Anders,R.F. (1990) Exp. Parasitol., 70, 193–206.[Web of Science][Medline]

Crewther,P.E., Matthews,M.L.S.M., Flegg,R.H. and Anders,R.F. (1996) Inf. Immun., 64, 3310–3317.[Abstract]

Deans,J.A., Alderson,T., Thomas,A.W., Mitchell,G.H., Lennox,E.S. and Cohen,S. (1982) Clin. Exp. Immunol., 49, 297–309.[Web of Science][Medline]

Deans,J.A., Thomas,A.W., Alderson,T. and Cohen,S. (1984) Mol. Biochem. Parasitol., 11, 189–204.[Web of Science][Medline]

Deans,J.A., Knight,A.M., Jean,W.C., Waters,A.P., Cohen,S. and Mitchell,G.H. (1988) Parasit. Immunol., 10, 535–552.[Web of Science][Medline]

Dutta,S., Malhotra,P. and Chauhan,V.S. (1995) Mol. Biochem. Parasitol., 73, 267–270.[Web of Science][Medline]

Fu,Y., Shearing,L.N., Haynes,S., Crewther,P.E., Tilley,L.M., Anders,R.F. and Foley M. (1997) J. Biol. Chem., 272, 25678–25684.[Abstract/Free Full Text]

Guevara Patino,J.A., Holder,A.A., McBride,J.S. and Blackman,M.J. (1997) J. Exp. Med., 186, 1689–1699.[Abstract/Free Full Text]

Harlow,E. and Lane,D. (1988) Antibodies, a Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Hodder,A.N., Crewther., Reid,G.E., Leet,M., Moritz,R.L., Simpson,R.J. and Anders,R.F. (1996) J. Biol. Chem., 271, 29446–29452.[Abstract/Free Full Text]

Holder, A A. (1996) In Hoffman,S.L. (ed.), Malaria Vaccine Development: A Multi-immune Response Approach. ASM Press, Washington, DC, pp. 77–104.

Jespers,L., Jenne,S., Lasters,I. and Collen,D. (1997) J. Mol. Biol., 269, 704–718.[Web of Science][Medline]

Kay,B.K., Adey,N.B., He,Y.S., Manfredi,J.P., Mataragnon,A.H. and Fowlkes,D.M. (1993) Gene, 128, 59–65.[Web of Science][Medline]

Kiewitz,A.and Wolfes,H. (1997) FEBS Lett., 415, 258–262.[Web of Science][Medline]

Kocken,C.H. et al (1998) J. Biol. Chem., 273, 15119–15124.[Abstract/Free Full Text]

Koivunen,E. et al (1999) Nature Biotechnol., 17, 768–774.[Web of Science][Medline]

Lasters,I., Van Herzeele,N., Lijnen,H.R., Collen,D. and Jespers,L. (1997) Eur. J. Biochem., 244, 946–952.[Web of Science][Medline]

Marshall,V.M., Zhang,L., Anders,R.F.and Coppel,R.L. (1995) Mol. Biochem. Parasitol., 77, 109–113.

Narum, DL. and Thomas,A.W. (1994). Mol. Biochem. Parasitol., 67, 59–68.[Web of Science][Medline]

Noe,A.R. and Adams,J.H. (1998) Mol. Biochem. Parasitol., 96, 27–35.[Web of Science][Medline]

Peterson,M.G., Marshall,V.M., Smythe,J.A., Crewther,P.E., Lew,A., Silva,A., Anders,R.F. and Kemp,D. (1989) Mol. Cell. Biol., 9, 3151–3154.[Abstract/Free Full Text]

Peterson,M.G., Nguyen-Dinh,P., Marshall,V.M., Elliott,J.F., Collins,W.E., Anders,R.F. and Kemp,D.J. (1990) Mol. Biochem. Parasitol., 39, 279–283.[Web of Science][Medline]

Skerra,A. and Pluckthun,A. (1988) Science, 240, 1038–1041.[Abstract/Free Full Text]

Smith,G.P. (1985) Science, 228, 1315–1317.[Abstract/Free Full Text]

Smith,G.P. and Scott,J.K. (1993) Methods Enzymol., 217, 228–257.[Web of Science][Medline]

Wang,L.F. and Yu,M. (1996) Methods Mol. Biol., 66, 269–285.[Medline]

Waters,A.P., Thomas,A.W., Deans,J.A., Mitchell,G.H., Hudson,D.E., Miller,L.H., McCutchan,T.F. and Cohen,S. (1990) J. Biol. Chem., 265, 17974–17979.[Abstract/Free Full Text]

Wilson,D.R. and Finlay,B.B. (1998) Can. J. Microbiol., 44, 313–329.[Web of Science][Medline]

Wrighton,N.C. et al (1996) Science, 273, 458–464.[Abstract]

Zhong,G., Smith,G.P., Berry,J. and Brunham,R.C. (1994) J. Biol. Chem., 269, 24183–24188.[Abstract/Free Full Text]

Received January 1, 2001; revised June 8, 2001; accepted June 18, 2001.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Infect. Immun.Home page
A. M. Coley, K. Parisi, R. Masciantonio, J. Hoeck, J. L. Casey, V. J. Murphy, K. S. Harris, A. H. Batchelor, R. F. Anders, and M. Foley
The Most Polymorphic Residue on Plasmodium falciparum Apical Membrane Antigen 1 Determines Binding of an Invasion-Inhibitory Antibody.
Infect. Immun., May 1, 2006; 74(5): 2628 - 2636.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
U. Gasanov, C. Koina, K. W. Beagley, R. J. Aitken, and P. M. Hansbro
Identification of the Insulin-Like Growth Factor II Receptor as a Novel Receptor for Binding and Invasion by Listeria monocytogenes
Infect. Immun., January 1, 2006; 74(1): 566 - 577.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. S. Harris, J. L. Casey, A. M. Coley, R. Masciantonio, J. K. Sabo, D. W. Keizer, E. F. Lee, A. McMahon, R. S. Norton, R. F. Anders, et al.
Binding Hot Spot for Invasion Inhibitory Molecules on Plasmodium falciparum Apical Membrane Antigen 1
Infect. Immun., October 1, 2005; 73(10): 6981 - 6989.
[Abstract] [Full Text] [PDF]


Home page
Protein Eng Des SelHome page
W. W. Ja, B. N. Olsen, and R. W. Roberts
Epitope mapping using mRNA display and a unidirectional nested deletion library
Protein Eng. Des. Sel., July 1, 2005; 18(7): 309 - 319.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Silvie, J.-F. Franetich, S. Charrin, M. S. Mueller, A. Siau, M. Bodescot, E. Rubinstein, L. Hannoun, Y. Charoenvit, C. H. Kocken, et al.
A Role for Apical Membrane Antigen 1 during Invasion of Hepatocytes by Plasmodium falciparum Sporozoites
J. Biol. Chem., March 5, 2004; 279(10): 9490 - 9496.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. L. Casey, A. M. Coley, R. F. Anders, V. J. Murphy, K. S. Humberstone, A. W. Thomas, and M. Foley
Antibodies to Malaria Peptide Mimics Inhibit Plasmodium falciparum Invasion of Erythrocytes
Infect. Immun., February 1, 2004; 72(2): 1126 - 1134.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. S. Mueller, A. Renard, F. Boato, D. Vogel, M. Naegeli, R. Zurbriggen, J. A. Robinson, and G. Pluschke
Induction of Parasite Growth-Inhibitory Antibodies by a Virosomal Formulation of a Peptidomimetic of Loop I from Domain III of Plasmodium falciparum Apical Membrane Antigen 1
Infect. Immun., August 1, 2003; 71(8): 4749 - 4758.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. Healer, S. Crawford, S. Ralph, G. McFadden, and A. F. Cowman
Independent Translocation of Two Micronemal Proteins in Developing Plasmodium falciparum Merozoites
Infect. Immun., October 1, 2002; 70(10): 5751 - 5758.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (22)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Coley, A. M.
Right arrow Articles by Foley, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Coley, A. M.
Right arrow Articles by Foley, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?