Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Muslin, E.H.
Right arrow Articles by Henson, C.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Muslin, E.H.
Right arrow Articles by Henson, C.A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Protein Engineering, Vol. 15, No. 1, 29-33, January 2002
© 2002 Oxford University Press

The effect of proline insertions on the thermostability of a barley {alpha}-glucosidase

E.H. Muslin1, S.E. Clark1 and C.A. Henson1,2,3

1 Department of Agronomy, University of Wisconsin, 1575 Linden Drive, Madison, WI 53706 and 2 Cereal Crops Research Unit, Agricultural Research Service, U.S. Department of Agriculture, USA

E-mail: cahenson{at}facstaff.wisc.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
The thermal stability of {alpha}-glucosidase is important because the conversion of starch to fermentable sugars during industrial production of ethanol (e.g. brewing, fuel ethanol production) typically takes place at temperatures of 65–73°C. In this study we investigate the thermostability of {alpha}-glucosidases from four plant species, compare their deduced amino acid sequences, and test the effect of substituting a proline for the residue present in the wild-type enzyme on the thermostability of {alpha}-glucosidase. The {alpha}-glucosidase from barley (Hordeum vulgare) was significantly less thermostable than the other three {alpha}-glucosidases. A comparison of the published deduced amino acid sequences of these four {alpha}-glucosidases revealed conserved proline residues in the three most thermostable {alpha}-glucosidases that were not found in the barley enzyme. Site-directed mutagenesis was done on recombinant barley {alpha}-glucosidase to create proteins with prolines at these conserved positions. The thermostability (T50) of one of these mutant enzymes, T340P, was 10°C higher than the non-mutated enzyme.

Keywords: Hordeum vulgare/maltase/starch degradation


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Starch degradation during seed germination is critical to the viability of cereal seeds because starch is the primary source of carbon and energy for seedlings until they become autotrophic. Degradation of cereal starch results from the concerted action of {alpha}-amylase, ß-amylase, debranching enzyme and {alpha}-glucosidase. Sun and Henson concluded that during the early stages of raw starch hydrolysis in germinating seeds, {alpha}-amylase is the most important enzyme and {alpha}-glucosidase is the second most important enzyme (Sun and Henson, 1991Go). Cereal starch degradation by these same endogenous seed enzymes is also critical in some types of fermentation systems, e.g. those used in the production of beer.

The thermal stability of {alpha}-glucosidase is important because the conversion of starch to fermentable sugars during the industrial production of ethanol (e.g. brewing, fuel ethanol production) typically takes place at temperatures of 65–73°C. The thermolability of {alpha}-glucosidase results in either reduced efficiency of starch breakdown at the high temperatures used for starch gelatinization or requires that the starch be cooled to a more favorable temperature for enzymatic hydrolysis after the starch is gelatinized.

In order to increase the thermostability of barley {alpha}-glucosidase, site-directed mutagenesis of the recombinant enzyme was considered. There are no data in the literature on the thermostability of other plant {alpha}-glucosidases nor is there a report of the crystal structure of any {alpha}-glucosidase. However, there have been studies of other members of the glycosyl hydrolase family 31 in which thermostability was increased by site-directed mutagenesis. The thermostability of fungal glucoamylase (GA) has been well studied. The GA of Aspergillus awamori is maximally active at 50°C and begins to undergo thermal denaturation at 70°C (Chen et al., 1995Go). Chen et al. have succeeded in increasing the thermostability of GA by substituting alanines for asparagines (Chen et al., 1994Go). Suzuki, working with oligo-1,6-glucosidases from several Bacillus species, demonstrated that an increase in the frequency of proline in ß-turns and in the total number of hydrophobic residues can enhance protein thermostability (Suzuki, 1989Go).

In this study we investigate the thermostability of {alpha}-glucosidases from four plant species, compare their deduced amino acid sequences, and test the effect of substituting a proline for the residue present in the wild-type enzyme on the thermostability of {alpha}-glucosidase.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Chemicals and reagents

Chemicals were purchased from Sigma (St. Louis, MO) unless otherwise stated.

Plant sources

Seeds of a sugarbeet (Beta vulgaris) breeding line (ACS9400461, Wang and Goldman, 1999Go) were kindly provided by Professor I.Goldman (University of Wisconsin). Arabidopsis (A.thaliana, cv. Columbia) seedlings were grown under a 10 h photoperiod at a temperature of 25°C for 3 weeks before harvesting. Spinach seeds (Spinacia oleracea, cv. Bloomsdale Longstanding, Northrup King) were purchased locally. Barley seeds (Hordeum vulgare, cv. Morex) were imbibed, germinated and kilned as described by Henson and Stone (Henson and Stone, 1989Go).

Isolation of crude extracts from plants

Crude extracts from malted barley, seeds of sugarbeet and spinach, and leaves from Arabidopsis were isolated using published protocols (Chiba et al., 1978Go; Im and Henson, 1995Go; Sugimoto et al., 1995Go; Monroe et al., 1999Go). The extracts were dialyzed (16 h, 4°C) against 50 mM sodium-succinate (pH 4.5).

Enzyme assay

{alpha}-Glucosidase activities were measured by the release of glucose from maltose. Unless otherwise stated, the enzyme was incubated for 1 h at 30°C with 25 mM maltose in 50 mM sodium-succinate (pH 4.5) during which time substrate hydrolysis rates were linear. The glucose released was quantified by determining the reduction of NAD with the coupled reactions of hexokinase and glucose-6-dehydrogenase (Im and Henson, 1995Go).

Thermostability testing of plant extracts

Enzyme extracts were incubated for 10 min at temperatures ranging from 5 to 75°C. The residual rate of maltose hydrolysis was assayed for 1 h at 30°C.

Alignment of {alpha}-glucosidase sequences from four plant species

Alignment of the published {alpha}-glucosidase deduced amino acid sequences from barley (GenBank accession number U22450), spinach (D86624), sugarbeet (D89615) and Arabidopsis (AF014806) was done using the program Align Plus-Version 2.0 (Scientific and Educational Software).

Mutagenesis

Mutagenesis was done using the Muta-Gene kit (BIO-RAD, Hercules, CA). Barley {alpha}-glucosidase cDNA (Tibbot and Skadsen, 1996Go) was sub-cloned into the EcoRI site of the phagemid pTZ18U (BIO-RAD). Escherichia coli strain CJ236 was used to generate dU-substituted DNA, and single-stranded DNA was isolated using the helper phage M13K07 (BIO-RAD). Generation of the mutant R336P used the oligonucleotide CGGTGAAGTTGACAGGATCCAAGGTGAAG (5', reverse complement) to replace the codon for arginine (CGT) with a codon for proline (CCT) and to remove a Tth111I site. The mutant T340P was generated using the oligonucleotide GAGCTCGGCGGCGGGGAAGTTTACACGGTC to replace the codon for threonine (ACC) with a codon for proline (CCC) and to remove a Tth111I site. To generate the mutant A742P we used the oligonucleotide CCAGGAGGTGGAACGGGGTCCGGCGC to replace the codon for alanine (GCG) with a codon for proline (CCG) and to remove a RsrII site.

Sequencing

The mutated cDNA was sequenced using the Sanger method (Sanger et al., 1977Go) with an automatic sequencer by the Interdisciplinary Center for Biotechnology Research, University of Florida, Gainesville, FL.

Expression

The mutated cDNA was subcloned into the EcoRI site of the Pichia pastoris vector pPIC9K (Invitrogen, CA) and transformed into P.pastoris GS115 using the Pichia EasyComp kit (Invitrogen). Ten histidine autotrophs (His+) were induced with methanol following the instructions in the Pichia Expression kit (Invitrogen). Pichia colonies that secreted measurable {alpha}-glucosidase activity were used for thermostability studies.

Thermostability testing of wild-type and mutated {alpha}-glucosidases

Enzyme extracts from non-mutated, recombinant {alpha}-glucosidase (rAGL), T340P and A742P were incubated for 10 min at temperatures ranging from 0 to 60°C at a pH of either 6.0 or 4.0. The residual rate of maltose hydrolysis was assayed for 18 h at 30°C at pH 4.5.

Arrhenius plot

Enzyme extracts from rAGL and T340P (pH 6.0) and substrate (pH 4.5) were incubated separately (10 min) at temperatures ranging from 0 to 55°C and assayed for 3.5 h at the same temperatures. The results were plotted as log Vi versus 10-3/T (K).


    Results and discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
In order to increase the thermostability of {alpha}-glucosidase, site-directed mutagenesis of the recombinant protein was considered. However, since no crystal structure has been determined for any {alpha}-glucosidase of the glycosyl hydrolase family 31, selection of targets for mutagenesis was based on comparisons of the thermostabilities and deduced amino acid sequences of {alpha}-glucosidases from four plant species.

The thermostability profiles of barley, sugarbeet, spinach and Arabidopsis {alpha}-glucosidases are shown in Figure 1Go. Sugarbeet {alpha}-glucosidase was the most thermostable and still retained greater than 90% of its maximal activity following exposure to 75°C for 10 min. The spinach {alpha}-glucosidase was the second most thermostable, followed by those from Arabidopsis and barley. The barley enzyme had only 10% of its maximal activity after exposure to 55°C for 10 min.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. . Effect of temperature on the activity of {alpha}-glucosidases extracted from barley (closed circle), sugarbeet (open circle), spinach (closed triangle) and Arabidopsis (open triangle). Enzyme extracts were incubated for 10 min (pH 4.5) at temperatures ranging from 5 to 75°C. The residual rate of maltose hydrolysis was assayed for 1 h at 30°C (pH 4.5). Residual activity is based on percent of non-heated control.

 
A portion of the alignment of the {alpha}-glucosidase deduced amino acid sequences from barley, sugarbeet, spinach and Arabidopsis is shown in Figure 2Go. An analysis of sequence identity between the enzymes showed that, even though barley had a relatively high sequence identity with sugarbeet and spinach (50.8 and 53.6%, respectively), key differences between the sequences of the enzymes existed. The sugarbeet (with the highest thermostability), spinach and Arabidopsis sequences had four conserved proline residues that were not found in the barley enzyme (which had the lowest thermostability) including prolines at position 336, 340, 547 and 742 (based on the barley sequence).



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 2. . Portions of the sequence alignment of {alpha}-glucosidases from barley (GenBank accession No. U22450), spinach (D86624), sugarbeet (D89615) and Arabidopsis (AF014806). Alignment was done using the program Align Plus-Version 2.0 (Scientific and Educational Software). Gaps to optimize alignment are designated by (–). Altered residues are highlighted and underlined in the barley {alpha}-glucosidase sequence.

 
Because proline residues are important for thermostability (Matthews et al., 1987Go; Suzuki et al., 1989Go), mutations were made in recombinant barley {alpha}-glucosidase to insert proline residues in positions where they were present in the more thermostable {alpha}-glucosidases. Mutations were made to add prolines to positions 336, 340 and 742. While T340P and A742P had {alpha}-glucosidase activity, a mutation at position 336 (R336P) resulted in an inactive protein (data not shown).

No mutation was made at position 547 because secondary structure predictions made using the program Peptide Structure (Wisconsin GCG Package, Madison, WI), which is based on the theories of Garnier et al. (Garnier et al., 1978Go), placed this residue in the middle of a ß-sheet (Table IGo). According to Watanabe et al. the insertion of a proline residue in the middle of a ß-sheet would not enhance the thermostability of the enzyme (Watanabe et al., 1991Go).


View this table:
[in this window]
[in a new window]
 
Table I. . Secondary structure predictions for {alpha}-glucosidase from barley, sugarbeet, spinach and Arabidopsis made using the Peptide Structure program based on the theories of Garnier et al. (Garnier et al., 1978Go)
 
The thermostabilty profiles (pH 6) of wild-type recombinant barley {alpha}-glucosidase (rAGL), and the mutant enzymes T340P and A742P, are shown in Figure 3Go. The thermostability profile of rAGL shown in Figure 3Go, which is from a crude extract, was almost identical to the thermostability profile of the purified rAGL previously published by Muslin et al. (Muslin et al., 2000Go). In fact, the T50 was 47.8°C for the crude enzyme and 47.6°C for the purified enzyme. Therefore, we concluded that it was not necessary to purify any of the enzyme extracts used in this study. The A742P enzyme had a T50 of 20°C and was completely inactive after exposure to 40°C. In contrast, the T340P enzyme showed the highest thermostability and had no decrease in activity until it was heated to temperatures above 50°C. The T50 for the T340P enzyme was 58°C, which represents an increase in the T50 of 10°C from the wild-type enzyme. The activities of rAGL, T340P and A742P {alpha}-glucosidases prior to heating were 0.7, 0.9 and 1.65 nmol/min/ml, respectively.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3. . Effect of temperature on the activity of recombinant barley {alpha}-glucosidase (rAGL, square), the T340P mutant enzyme (triangle) and the A742P mutant enzyme (circle) at pH 6.0. rAGL, T340P and A742P were incubated for 10 min at temperatures ranging from 0 to 60°C at pH 6. The residual rate of maltose hydrolysis was assayed for 18 h at 30°C at pH 4.5. Residual activity is based on percent of non-heated control (rAGL = 0.7 nmol/min/ml, T340P enzyme = 0.9nmol/min/ml, A742P enzyme = 1.65nmol/min/ml).

 
In order to determine whether the thermostability is affected by pH, a thermostability profile was generated for the wild-type enzyme and the T340P enzyme at pH 4.0, the pH at which rAGL is the most thermolabile (Muslin et al., 2000Go). At this pH the wild-type enzyme had a T50 of 36°C and the T340P enzyme had a T50 of 43°C (Figure 4Go). It is apparent that while the thermostability of both enzymes was reduced by low pH, the T340P enzyme was still more thermostable than the wild-type enzyme. The original (non-heated) activity of rAGL and the T340P enzyme at pH 4 was 0.8 and 1.5 nmol/min/ml, respectively. At pH 4, the rAGL enzyme was 14% more active than at pH 6 and the T340P enzyme was 36% more active at pH 4 than at pH 6. This increase in activity at the lower pH was expected based on the pH profile of rAGL (Muslin et al., 2000Go). In this profile the pH optimum of the enzyme was ~4.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4. . Effect of temperature on the activity of rAGL (square) and the T340P mutant enzyme (triangle) at pH 4.0. rAGL and the T340P enzyme were incubated for 10 min at temperatures ranging from 0 to 60°C at pH 4.0. The residual rate of maltose hydrolysis was assayed for 18 h at 30°C at pH 4.5. Residual activity is based on percent of non-heated control (rAGL = 0.8 nmol/min/ml, T340P enzyme = 1.5nmol/min/ml).

 
An Arrhenius plot was generated for the wild-type enzyme and the T340P enzyme and the results are shown in Figure 5Go. The Arrhenius energy of activation (Ea) for rAGL was 17.5 while for the T340P enzyme it was 16.5.



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 5. . Arrhenius plot of rAGL (square) and the T340P mutant enzyme (triangle). rAGL and the T340P mutant enzyme, at pH 6.0 and substrate, at pH 4.5, were incubated separately (10 min) at temperatures ranging from 0 to 55°C and assayed for 3.5 h at the same temperatures at pH 4.5.

 
Taken together the results presented in this study indicate that the substitution of a proline for a threonine in position 340 enhances the thermostability of {alpha}-glucosidase from barley. Several studies with other enzymes show an increase in thermostability due to the addition of proline residues at key positions. Allen et al. made three proline substitution mutations in A.awamori GA (Allen et al., 1998Go). One of these mutations, S30P, stabilized the enzyme. The S30P mutant increased the T50 of the enzyme by 1.7°C. Similarly, Watanabe et al. introduced nine proline substitutions into the oligo-1,6-glucosidase gene from B.cereus ATCC 7064 (Watanabe et al., 1994Go). These mutations resulted in a 5.1°C increase in the protein's T50.

Although no three-dimensional structure has been reported for an {alpha}-glucosidase, the secondary structure of the barley protein was predicted using the program Peptide Structure. Table IGo shows the secondary structure predictions for the residues at positions 336, 340, 547 and 742 (numbers based on barley sequence) in {alpha}-glucosidases from barley, sugarbeet, spinach and Arabidopsis. According to Table IGo, the threonine at position 340 of barley {alpha}-glucosidase is in the first turn of an {alpha}-helix. Similarly, the prolines in the same position in the sugarbeet, spinach and Arabidopsis enzymes are also found in the first turn of an {alpha}-helix. According to Watanabe, the presence of prolines in the first turn of {alpha}-helices and at the second sites of ß-turns often results in protein stabilization (Watanabe et al., 1991Go). Therefore, it makes sense that the addition of a proline in the first turn of an {alpha}-helix in the barley {alpha}-glucosidase made the enzyme more thermostable.

Residue 742 in barley {alpha}-glucosidase was predicted to be in the second turn of an {alpha}-helix (Table IGo). According to Watanabe et al., the influence of proline on nearby residues is so strong that the imprudent substitution of proline for another amino acid might result in the destruction of both secondary and tertiary structures as well as the loss of protein function and/or stability (Watanabe et al., 1996Go). The substitution of a proline in the second turn of an {alpha}-helix (as was done with the mutation A742P) apparently had a destructive effect on the thermostability of the enzyme but not on the enzyme's activity (Figure 3Go).

According to the secondary structure program Peptide Structure, residue 336 in barley {alpha}-glucosidase is in the second site of a ß-turn (Table IGo). Thus, we predicted the insertion of a proline at this position would positively affect the enzyme's thermostability. However, the mutation R336P resulted in an inactive enzyme. It should be noted that the secondary structure predictions made using the method of Chou and Fassman (Chou and Fassman, 1978Go) indicate that residue 336 is in the last turn of an {alpha}-helix (data not shown). Therefore, according to these structural predictions, the addition of a proline at residue 336 could destabilize the enzyme. Such a destabilization occurred as evidenced by the R336P mutation resulting in an inactive {alpha}-glucosidase. The secondary structure predictions (Peptide Structure) for sugarbeet and Arabidopsis at position 336 indicate that these prolines are in undefined regions; therefore, the effect these prolines have on enzyme stability cannot be anticipated. According to the program Peptide Structure, the proline at position 336 in spinach is in a ß-sheet. According to Watanabe, this proline should not enhance the protein's thermostability, possibly indicating that it is not this residue that is the cause of this enzyme's thermostability.

The difference in T50 values between the mutant and wild-type enzymes was decreased from 10°C at pH 6 to 7°C at pH 4. These data could indicate that different mechanisms are responsible for thermostability at these two pHs. Such has been documented to be the case for lysozyme. Ahern and Klibanov found that the thermoinactivation of lysozyme can be attributed to one or more of the following mechanisms: deamidation of asparagine residues, hydrolysis of peptide bonds at aspartic acid residues, destruction of disulfide bonds and the formation of non-functional aggregates or other incorrect structures (Ahern and Klibanov, 1985Go). The relative contributions of these mechanisms to thermoinactivation are dependent upon the individual protein and its environment, e.g. pH. They determined that at pH 4.0 the dominant mechanism of thermoinactivation of lysozyme is deamidation of asparagine residues. At pH 8 destruction of cysteine residues and formation of incorrect structures become the dominant mechanisms of thermoinactivation.

According to an analysis of the deduced amino acid sequences of barley, sugarbeet, spinach and Arabidopsis {alpha}-glucosidases, the sugarbeet and spinach enzymes are the most related (Monroe et al., 1999Go). Perhaps the presence of the conserved prolines in these dicot species, specifically the proline at position 340, represents an evolutionary trend towards a more thermostable enzyme.


    Notes
 
3 To whom correspondence should be addressed at: Department of Agronomy, University of Wisconsin, 1575 Linden Drive, Madison, WI 53706, USA. Back

Mention of a proprietary product does not constitute a guarantee or warranty of the product by the U.S. Department of Agriculture and does not imply its approval to the exclusion of other suitable products.


    Acknowledgments
 
This work was supported by the U.S. Department of Agriculture–Agricultural Research Service, the University of Wisconsin–Madison and the American Malting Barley Association, Inc.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Ahern,T.J. and Klibanov,A.M. (1985) Science, 228, 1280–1284.[Abstract/Free Full Text]

Allen,M.J., Coutinho,P.M. and Ford,C.F. (1998) Protein Eng., 11, 783–788.[Abstract/Free Full Text]

Chen, H.-M., Ford,C. and Reilly,P.J. (1994) Protein Eng., 8, 575–582.[Abstract/Free Full Text]

Chen, H.-M., Li, Y, Panda,T., Buehler,F.U., Ford,C. and Reilly,P.J. (1995) Protein Eng., 9, 499–505.[Abstract/Free Full Text]

Chiba,S., Inomata,S., Matsui,H. and Shimomura,T. (1978) Agric. Biol. Chem., 42, 241–245.

Chou,P.Y. and Fasman,G.D. (1978) Adv. Enzymol., 47, 45–148.

Garnier,J., Osguthorpe,D.J. and Robson,B. (1978) J. Mol. Biol., 120, 97–120.[CrossRef][Web of Science][Medline]

Henson,C.A. and Stone,J.M. (1989) J. Chromatogr., 469, 361–367.[CrossRef]

Im,H. and Henson,C.A. (1995) Carbohydr. Res., 277, 145–159.[CrossRef]

Matthews,B.W., Nicholson,H. and Becktel,W.J. (1987) Proc. Natl Acad. Sci. USA, 84, 6663–6667.[Abstract/Free Full Text]

Monroe,J.D., Gough,C.M., Chandler,L.E., Loch,C.M., Ferrante,J.E. and Wright,P.W. (1999) Plant Physiol., 119, 385–397.[Abstract/Free Full Text]

Muslin,E.H., Kanikula,A.M., Clark,S.E. and Henson,C.A. (2000) Protein Expr. Purif., 18, 20–26.[CrossRef][Web of Science][Medline]

Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc. Natl Acad. Sci. USA, 74, 5463–5467.[Abstract/Free Full Text]

Sugimoto,M., Furui,S. and Suzuki,Y. (1995) Biosci. Biotech. Biochem., 59, 673–677.

Sun,Z. and Henson,C.A. (1991) Arch. Biochim. Biophys., 284, 298–305.[CrossRef][Web of Science][Medline]

Suzuki,Y. (1989) Proc. Jpn Acad. Ser. B Phys. Biol. Sci., 65, 146–148.

Tibbot,B.K. and Skadsen,R.W. (1996) Plant Mol. Biol., 30, 229–241.[CrossRef][Web of Science][Medline]

Wang,M. and Goldman,I.L. (1999) J. Am. Soc. Hort. Sci., 124, 630–635.[Abstract/Free Full Text]

Watanabe,K., Kitamura,K., Hata,Y., Katsube,Y. and Suzuki,Y. (1991) FEBS Lett., 290, 221–223.[CrossRef][Web of Science][Medline]

Watanabe,K., Masuda,T., Osashi,H., Mirahara,H. and Suzuki,Y. (1994) Eur. J. Biochem., 226, 277–283.[Web of Science][Medline]

Watanabe,K., Kitamura,K. and Suzuki,Y. (1996) Appl. Environ. Microbiol., 62, 2066–2073.[Abstract]

Received February 10, 2001; revised August 16, 2001; accepted September 25, 2001.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J BiochemHome page
J. Arnorsdottir, A. R. Sigtryggsdottir, S. H. Thorbjarnardottir, and M. M. Kristjansson
Effect of Proline Substitutions on Stability and Kinetic Properties of a Cold Adapted Subtilase
J. Biochem., March 1, 2009; 145(3): 325 - 329.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
K. Takano, R. Higashi, J. Okada, A. Mukaiyama, T. Tadokoro, Y. Koga, and S. Kanaya
Proline Effect on the Thermostability and Slow Unfolding of a Hyperthermophilic Protein
J. Biochem., January 1, 2009; 145(1): 79 - 85.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
M. Sakaguchi, M. Matsuzaki, K. Niimiya, J. Seino, Y. Sugahara, and M. Kawakita
Role of Proline Residues in Conferring Thermostability on Aqualysin I
J. Biochem., February 1, 2007; 141(2): 213 - 220.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
G. Cai, S. Zhu, S. Yang, G. Zhao, and W. Jiang
Cloning, Overexpression, and Characterization of a Novel Thermostable Penicillin G Acylase from Achromobacter xylosoxidans: Probing the Molecular Basis for Its High Thermostability
Appl. Envir. Microbiol., May 1, 2004; 70(5): 2764 - 2770.
[Abstract] [Full Text] [PDF]


Home page
Protein Eng Des SelHome page
S.E. Clark, E.H. Muslin, and C.A. Henson
Effect of adding and removing N-glycosylation recognition sites on the thermostability of barley {alpha}-glucosidase
Protein Eng. Des. Sel., March 1, 2004; 17(3): 245 - 249.
[Abstract] [Full Text] [PDF]


Home page
Protein Eng Des SelHome page
A. J. Bell Jr, H. Xin, S. Taudte, Z. Shi, and N. R. Kallenbach
Metal-dependent stabilization of an active HMG protein
Protein Eng. Des. Sel., October 1, 2002; 15(10): 817 - 825.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Muslin, E.H.
Right arrow Articles by Henson, C.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Muslin, E.H.
Right arrow Articles by Henson, C.A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?