Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tsuji, A.
Right arrow Articles by Matsuda, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsuji, A.
Right arrow Articles by Matsuda, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Protein Engineering, Vol. 15, No. 2, 123-130, February 2002
© 2002 Oxford University Press

Development of selectivity of {alpha}1-antitrypsin variant by mutagenesis in its reactive site loop against proprotein convertase. A crucial role of the P4 arginine in PACE4 inhibition

Akihiko Tsuji, Takayuki Ikoma, Emi Hashimoto,1 and Yoshiko Matsuda,2

Department of Biological Science and Technology, Faculty of Engineering, The University of Tokushima, 2-1 Minamijosanjima, Tokushima 770-8506, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
PACE4, furin and PC6 are Ca2+-dependent serine endoproteases that belong to the subtilisin-like proprotein convertase (SPC) family. Recent reports have supported the involvement of these enzymes in processing of growth/differentiation factors, viral replication, activation of bacterial toxins and tumorigenesis, indicating that these enzymes are a fascinating target for therapeutic agents. In this work, we evaluated the sensitivity and selectivity of three rat {alpha}1-antitrypsin variants which contained RVPR352, AVRR352 and RVRR352, respectively, within their reactive site loop using both inhibition of enzyme activity toward a fluorogenic substrate in vitro and formation of a SDS-stable protease/inhibitor complex ex vivo. The RVPR variant showed relatively broad selectivity, whereas the AVRR and RVRR variants were more selective than the RVPR variant. The AVRR variant inhibited furin and PC6 but not PACE4. This selectivity was further confirmed by complex formation and inhibition of pro-complement C3 processing. On the other hand, although the RVRR variant inhibited both PACE4 and furin effectively, it needed a 600-fold higher concentration than the RVPR variant to inhibit PC6 in vitro. These inhibitors will be useful tools in helping us to understand the roles of PACE4, furin and PC6.

Keywords: {alpha}1-antitrypsin/furin/PACE4/PC6/proprotein convertase


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Endoproteolytic cleavage, usually at arginine residues, is a common post-translational activation process of membrane and secretory proteins (Halban and Irminger, 1994Go; Zhou et al., 1999Go). Such proteins include precursors of peptide hormones, neuropeptides, differentiation factors, plasma proteins, receptors and adhesion molecules. The majority of these precursor proteins contain the consensus sequence (RXR/KR, RXXR) which is cleaved by subtilisin-like proprotein convertase (SPC) at the C-terminal arginine residue (Halban and Irminger, 1994Go; Nakayama, 1997Go; Zhou et al., 1999Go). The same type of processing has also been observed with viral membrane proteins and bacterial toxins (Sakaguchi et al., 1991Go; Gordon et al., 1997Go; Nakayama, 1997Go). So far, seven kinds of mammalian SPC have been identified and they are named furin (Fuller et al., 1989Go), PC1/3 (Smeekens et al., 1991Go), PC2 (Smeekens and Steiner, 1990Go), PACE4 (Kiefer et al.,1991Go; Tsuji et al., 1994Go; Mori et al., 1997Go), PC4 (Nakayama et al., 1992Go), PC6/5 (Nakagawa et al., 1993Go) and PC8/LPC/PC7 (Bruzzaniti et al., 1996Go; Meerabux et al., 1996Go; Seidah et al., 1996Go). All these SPCs are Ca2+-dependent serine proteases and their structural organization appears to be highly homologous. Common structural features include a signal peptide, propeptide, subtilisin-like catalytic domain (SCD) and homoB domain; however, the C-terminal regions vary greatly in length and sequence among these SPC family proteases. Although SPCs have a SCD (~25–30% identity), the cleavage preference of SPCs is highly specific unlike subtilisin. Their crystal structures are still unknown.

Furin, the best characterized SPC, has been believed to function as the major SPC in many proprotein processing events of the constitutive secretory pathway; however, recent studies have helped us to understand the significance of other SPCs, especially PACE4. Furin exhibits ubiquitous distribution like PC8, whereas PACE4 is expressed in restricted tissues. We and others showed that the expression of PACE4 was highly regulated during embryogenesis (Constam et al., 1996Go; Akamatsu et al., 1997Go, 2000Go). Moreover, the promoter analysis indicated that PACE4 expression is regulated by a mechanism distinct from that of furin (Tsuji et al., 1997Go, 1999aGo; Yoshida et al. 2001Go). Transgenic studies have also revealed unique functions for PACE4. Furin is required for embryo turning and ventral closure (Roebroek et al., 1998Go). Embryos lacking PACE4 display varying degrees of holoprosencephaly (Constam and Robertson, 2000Go). In contrast, embryos lacking PC8/LPC apparently develop normally (Constam and Robertson, 1999Go).

Specific inhibitors of individual SPCs would not only be powerful tools for clarifying the different functions of each SPC but may also be useful as therapeutic agents. Peptidylchloroalkylketones containing the SPC consensus cleavage motif, RXK/RR, were shown to be potent inhibitors for the activation of virus fusion protein catalyzed by SPCs (Garten et al., 1994Go). However, these inhibitors were highly cytotoxic and showed no selectivity for any SPC family proteases. {alpha}1-Antitrypsin Portland ({alpha}1-PDX) is an engineered {alpha}1-antitrypsin ({alpha}1-AT) variant designed as a furin inhibitor (Anderson et al., 1993Go). {alpha}1-AT is a member of the serpin (serine protease inhibitor) family. Serpins have been shown to function as suicide substrates. They associate with proteases by presenting a bait residue, in their reactive site loop (RSL) that is thought to mimic normal substrate of the enzyme. Following cleavage of the exposed RSL of serpin by protease, serpins undergo a significant conformational rearrangement resulting in the formation of an SDS-stable protease/serpin complex (Wright, 1996Go). Mutations at the RSL alter the protease specificity of the serpin. A naturally occuring mutation, known as {alpha}1-AT Pittsburgh, at the {alpha}1-AT reactive site AIPM358 into AIPR358, changed the specificity of this serpin from an inhibitor of elastase into an inhibitor of thrombin (Owen et al., 1983Go). Thomas and co-workers showed that {alpha}1-PDX is a highly selective furin inhibitor (Jean et al., 1998Go). {alpha}1-PDX is an engineered variant of human {alpha}1-AR that carries two mutations, Ala355/Arg, and Met358/Arg in its RSL to provide the minimal consensus sequence (RXXR) for efficient recognition and processing by furin. However, we proved that PACE4 is also inhibited by {alpha}1-PDX and forms a stable PACE4/ {alpha}1-PDX complex as does furin (Tsuji et al., 1999bGo). Therefore, more specific inhibitors than {alpha}1-PDX are essential in order to define precisely each SPC's unique biological role and elaborate on the extent of the functional overlap between the members of this family.

In this paper, we prepared three kinds of rat {alpha}1-AT variants, RVPR (AVPM352/RVPR) corresponding to rat {alpha}1-PDX, AVRR (AVPM352/AVRR) and RVRR (AVPM352/RVRR). We next compared the in vitro and ex vivo sensitivity of PACE4, furin and PC6 against variants {alpha}1-PDX, AVRR and RVRR. Striking differences in the sensitivity of each SPC against these variants were revealed. These results provide useful information required for the design of more specific synthetic SPC inhibitors.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Materials

Peptidyl 4-methylcoumaryl 7-amides (MCAs), leupeptin, trans-epoxysuccinyl-L-leucylamido-(guanidino) butane (E-64), chymostatin and pepstatin, were purchased from Peptide Institute (Osaka, Japan). Bestatin was from Nippon Kayaku (Tokyo, Japan). Ovoinhibitor was from Takara Shuzo (Kyoto, Japan). Human recombinant tissue inhibitor of metalloprotease(TIMP)-2 was from Chemicon (Temecula, CA). Human {alpha}1-AT, TPCK-treated bovine trypsin and bovine thrombin were from Sigma (St Louis, MO). Rabbit anti-human {alpha}1-AT antiserum was from ZYMED (San Francisco, CA). Purified kexstatin mutant was a gift from Dr K.Oda (Kyoto Institute of Technology, Kyoto, Japan). The rat {alpha}1-AT, its variant (Pittsburgh M352/R) and rat complement pro-C3 cDNAs were kindly provided by Dr Y.Ikehara (Fukuoka University, Fukuoka Japan). Truncated soluble furin ({Delta}704/pAC) and PC6A (PC6A/pRcCMV) expression plasmids were a gift from Dr K.Nakayama (Tsukuba University, Tsukuba, Japan). Easy Tag TM Express Protein Labeling Mix[35S] was from NEN Life Science (Boston, MA). Antibody against E-cadherin (H-108) was from Santa Cruz Biotechnology, Santa Cruz (CA). The other reagents used were of the highest grade available.

Construction of expression plasmids

Human PACE4A-I cDNA was subcloned into the mammalian cell expression vector pALTERMAX (Promega, Madison, WI), as described previously (Nagahama et al., 1998Go). The rat {alpha}1-PDX (AVPM352/RVPR) was prepared as described previously and subcloned into BamHI and EcoRI sites of the pcDNA3 vector (Invitrogen, Carlsbad) (Tsuji et al., 1999bGo). The novel variants (AVRR and RVRR type) of rat {alpha}1-AT were prepared with two steps of PCR using PstI-linked sense mutagenic primers, GCTGCAGGAGCCACTGTGGTGGAGGCCGTCCGCAGGTC [coding for Arg(bold) at positions 351 and 352] and GCTGCAGGAGCCACTGTGGTGGAGCGCGTCCGCAGGTC [ coding for Arg (bold) at positions 349, 351 and 352], respectively, as reported previously. These cDNAs were subcloned into BamHI and EcoRI sites of pcDNA3. The cDNAs coding for rat {alpha}1-AT variants devoid of a signal peptide were generated and subcloned into BamHI and HindIII sites of the pQE30 vector (Qiagen, Hilden, Germany) as described previously (Tsuji et al., 1999bGo). The full sequence of the insert was confirmed using an automated ALF DNA sequencer (Pharmacia, Uppsala, Sweden).

Transfection and immunoprecipitation

HEK293 cells (transformed human embryonic kidney cells) were grown at 37°C under 5% CO2 in Dulbecco's modified Eagle's medium supplemented with 10% FCS and antibiotics. FuGENETM6 Transfection Reagent (Roche Diagnostics GmbH, Mannheim, Germany) was used for transfection of cells with the expression plasmid according to the manufacturer's instruction. After transfection for 48 h, the cells were labeled with 100 µCi/ml [35S]Met/Cys for 8 h. The conditioned medium was then immunoprecipitated with anti-PACE4 HomoB, anti-SCD or anti-{alpha}1-AT antibodies as reported previously. The sample was resolved by SDS–polyacrylamide gel electrophoresis (SDS–PAGE) followed by fluorography (Laemmli, 1970Go). The radioactive bands in the gel were then analyzed using a BAS-1500 bioimaging analyzer (Fuji Film, Tokyo, Japan).

Establishment of Lovo cell lines expressing the {alpha}1-AT variant

Lovo cells (human colon adenocarcinoma) were stably transfected with cDNA for {alpha}1-AT (control) or the variants, {alpha}1-PDX, AVRR and RVRR {alpha}1-AT, which had been cloned into the pcDNA3 vector. After G418 selection (0.2 mg/ml) these cell lines were named Lovo-C, Lovo-PDX, Lovo-AVRR and Lovo-RVRR, respectively.

Expression and purification of recombinant {alpha}1-AT variants

The purification of {alpha}1-AT variants from Escherichia coli was carried out as described previously (Tsuji et al. 1999bGo). The preparation obtained by Ni2+–NTA column chromatography was further purified by gel filtration on Ultrogel AcA-34 (SEPRACOR, Vilkneuve-La-Garenne, France).

Preparation of recombinant PACE4, furin and PC6

HEK293 cells were transfected with the expression plasmids as mentioned above. Following a 48 h transfection, the cells were rinsed twice with phosphate-buffered saline and incubated in serum-free Opti MEM (Gibco BRL, Rockville, MD). After 24 h, the conditioned medium was concentrated by ultrafiltration and stored at –80°C until use.

Enzyme assays

The protease activity of SPC was assayed with L-pyroglutamyl (pyr)-RTKR-MCA as described previously (Tsuji et al., 1999bGo). Unless otherwise stated the reaction mixture contained 0.1 M Tris–HCl, pH 7.5, 100 µM pyr-RTKR-MCA, 2 mM CaCl2, 10 µg/ml each of leupeptin, E-64, bestatin and pepstatin, 1 µg/ml chymostatin, 10 µg/ml ovoinhibitor and 30 ng/ml TIMP-2. The enzyme activity was expressed as nmoles of methylcoumarylamide released per hour per milliliter of enzyme. Trypsin and thrombin activity was assayed with benzyloxycarbonyl (Z)-FR-MCA and t-butyloxycarbonyl (Boc)-VPR-MCA, respectively, at 37°C. ß-Hexosaminidase activity was assayed with 4-methylumbelliferyl-2-acetamido-2-deoxy-ß-D-glucopyranoside as substrate (Sakuraba et al., 1982Go). Protein was determined by the method of Bradford using a Bio-RAD protein assay reagent with BSA as a standard (Bradford, 1976Go).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Expression and purification of recombinant {alpha}1-AT variants

The His-tagged rat {alpha}1-AT variants devoid of signal peptide, {alpha}1-PDX (AVPM352/RVPR), AVRR (AVPM352/AVRR) and RVRR (AVPM352/RVRR) were purified from transformed E.coli by Ni2+–NTA column chromatography and Ultrogel AcA-34 gel filtration. All the variants were eluted with 50 mM imidazole buffer, pH 7.0, from the Ni2+–NTA column and further purified to almost homogeneity by gel filtration (Figure 1AGo). The actions of these variants on trypsin and thrombin were first examined (Figure 1BGo). Whereas the trypsin activity was completely inhibited by the wild-type human {alpha}1-AT (IC50 = 0.35 µg/ml), neither {alpha}1-PDX nor RVRR variants had any inhibitory effect, although these variants contained arginine residue at the P1 position in the RSL. In contrast, the AVRR variant had very weak inhibitory activity and inhibited trypsin (IC50 = 100 µg/ml) at a 300-fold higher concentration than the wild-type {alpha}1-AT. On the other hand, neither {alpha}1-PDX, AVRR nor RVRR variants had any inhibitory effect against thrombin.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1. . Effects of {alpha}1-AT variants on trypsin activity. (A) SDS–PAGE of purified {alpha}1-AT variant from transfected E.coli. The variants were applied to 10% SDS–PAGE and stained with Coomassie brilliant blue. (B) Effects of wild-type human {alpha}1-AT and recombinant rat {alpha}1-AT variants on trypsin activity. Trypsin (40 ng) was incubated for 1 h with increasing amounts of human {alpha}1-AT (open circles), AVRR (closed squares), {alpha}1-PDX (closed circles), RVRR (closed triangles) variants in the presence of Z-FR-MCA substrate. The specific activity of trypsin in the absence of inhibitor was 1.72 µmol/mg/min.

 
Sensitivity of furin, PACE4 and PC6 to the various {alpha}1-AT variants

The ability of the {alpha}1-AT variants to inhibit cleavage of a synthetic substrate (pyr-RTKR-MCA) by furin, PACE4 and PC6 was examined in order to test the extent of their inhibitory specificity. The conditioned media from the HEK293 cells transiently expressing truncated soluble furin, PACE4A or PC6A were used as the source of enzymes. The protease activity was assayed in the presence of various protease inhibitors (leupeptin, E-64, chymostatin, bestatin, pepstatin, ovoinhibitor, TIMP-2) to exclude interference by other proteases, and the protease activity secreted was normalized on the basis of ß-hexosaminidase activity. ß-Hexosaminidase is a lysosomal enzyme but part of the enzyme is constitutively secreted into culture medium. Table IGo shows that the ratios of EDTA-sensitive protease activity to ß-hexosaminidase activity in the conditioned media from the cells expressing furin, PC6 and PACE4 were 215-, 164- and 37.4-fold higher, respectively, than those from control cells. These conditioned media were used to examine the inhibitory effect of recombinant {alpha}1-AT variants in vitro. The recombinant {alpha}1-AT variants produced by E.coli are unglycosylated, and therefore there is a fear that these variants might be inactivated during incubation because unglycosylated {alpha}1-AT is easily degraded by other proteases in the conditioned medium. We first examined the time-dependent inactivation of furin and PC6 by recombinant {alpha}1-PDX prior to evaluating the selectivity of the variants. Progress curves for the hydrolysis of pyr-RTKR-MCA by furin and PC6 in the presence or absence of {alpha}1-PDX are shown in Figure 2Go. As the concentration of {alpha}1-PDX increased, the initial burst phase of the progress curve shortened and the steady-state equilibrium was achieved more rapidly, which indicates a slow-binding inhibition, as did the experiments using purified furin. Thus, these results show that we can correctly evaluate the inhibitory activity of an {alpha}1-AT variant against SPCs using the conditioned medium from cells expressing SPC as a source of enzyme and the recombinant {alpha}1-AT variant. Sufficient enzyme to cleave an equal amount of substrate was added to the reaction mixture containing the {alpha}1-AT variants at various concentrations (30, 10, 2, 0.4 µg/ml, 80, 16, 3.2 ng/ml) and incubated at 37°C for 15 h. As a negative control, the activity in the presence of 20 mM EDTA was also determined. EDTA-sensitive SPC activity was calculated by subtraction of EDTA-insensitive activity from the activity in the absence of EDTA. Figure 3Go shows inhibition profiles of the {alpha}1-AT variants {alpha}1-PDX, AVRR and RVRR towards pyr-RTKR-MCA cleavage activity by PACE4, furin and PC6. The concentrations of the {alpha}1-AT variants required for 50% inhibition (IC50) are presented in Table IIGo. {alpha}1-PDX inhibits PACE4, furin and PC6 at the nanomolar level. The sensitivity of PACE4 (IC50 = 20 nM) to {alpha}1-PDX was less than those of furin (IC50 = 1.6 nM) and PC6 (IC50 = 1.1 nM). Previously, we reported that immunopurified PACE4 had significant activity toward Boc-QRR-MCA and Z-RR-MCA which have no arginine at the P4 position, unlike furin (Tsuji et al., 1999bGo). Therefore, we expected that PACE4 would be more sensitive to the AVRR variant than furin. Unexpectedly, the AVRR variant barely inhibited PACE4 whereas furin (IC50 = 20 nM) and PC6 (IC50 = 39 nM) were both inhibited to the same extent by this variant. On the other hand, the RVRR variant seems to be more selective toward PACE4 and furin than PC6. PACE4 (IC50 = 5 nM) and furin (IC50 = 11 nM) were inhibited at 120–60-fold lower concentrations of the RVRR variant than PC6 (IC50 = 620 nM). The orders of inhibition for PACE4, furin and PC6 by the variants were RVRR>PDX, PDX>RVRR>AVRR, and PDX>AVRR>>RVRR, respectively. pyr-RTKR-MCA and Boc-RVRR-MCA which contain the RXK/RR motif have been found to be the best synthetic substrates for all SPCs. Furin can cleave RXK/RR efficiently but RXXR less so. However, the preferential cleavage sequence of SPC estimated using the peptidyl-MCA substrate was not coincident with the effective inhibitory sequence in the RSL of {alpha}1-AT.


View this table:
[in this window]
[in a new window]
 
Table I. . Theprotease activities in the conditioned culture medium from HEK293 cells transiently expressing furin, PC6 and PACE4
 


View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. . Progress curve for the hydrolysis of pyr-RTKR-MCA by furin and PC6 in the absence or presence of the indicated concentrations of {alpha}1-PDX. The conditioned medium concentrates from cells expressing furin (5 µl) or PC6 (2 µl) were reacted with 0, 50, 200 and 500 ng/ml {alpha}1-PDX at 37°C in 1.0 ml of 0.1 M Tris–HCl, pH 7.5, 100 µM pyr-RTKR-MCA, 2 mM CaCl2 and protease inhibitors. The reaction was monitored every 20 (furin) or 30 min (PC6) by recording the changes in fluorescence at 460 nm upon excitation at 380 nm.

 


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3. . Inhibition of PACE4, furin and PC6 activities by {alpha}1-AT variants in vitro. Increasing amount of variants AVRR (closed circles), {alpha}1-PDX (opened circles) or RVRR (opened squares) were added to the reaction mixture containing PACE4 (upper), furin (middle) or PC6 (lower). The mixtures were then incubated for 12 h. All assays were performed in duplicate.

 

View this table:
[in this window]
[in a new window]
 
Table II. . Inhibition of PACE4, furin and PC6 by the recombinant {alpha}1-AT variants
 
Complex formation of PACE4, furin and PC6 with {alpha}1-AT variants ex vivo

{alpha}1-AT variants ({alpha}1-PDX, AVRR and RVRR variants) were tested for their ability to form SDS-stable complexes with PACE4, furin and PC6 ex vivo. Individual SPC and the variants were co-expressed in HEK293 cells and then the complex in the conditioned medium was immunoprecipitated with either anti-SPC antibody (anti-SCD and anti-PACE4 HomoB) or anti-{alpha}1-AT antibody as shown in Figure 4Go. The wild-type {alpha}1-AT did not form a complex and it was secreted in a 55 kDa form. On the other hand, in addition to the bands of secreted mature PACE4 and {alpha}1-AT, a band (180 kDa) corresponding to the protease/inhibitor complex which was cross-reactive with both anti-PACE4 HomoB and anti-{alpha}1AT antibodies, was observed when PACE4 was co-expressed with variants {alpha}1-PDX or RVRR. In contrast, this complex was barely detected when PACE4 and the AVRR variant were co-expressed, even though only a half of the AVRR variant was secreted into the culture medium as the cleaved form (51 kDa) such as in the cases of {alpha}1-PDX and RVRR. In the case of PC6, all {alpha}1-AT variants could form a complex with the enzyme; however, the band of the PC6/RVRR variant complex was less intense than those of the complexes with variants {alpha}1-PDX and AVRR. Moreover, half of the RVRR variant secreted was the native size of {alpha}1-AT, whereas {alpha}1-PDX and AVRR variants were secreted as cleaved forms. Similarly, furin could form a complex with all variants, but the ability of these variants to form complexes varied. The observed orders of reactivity for these variants to furin and PC6 were AVRR>PDX>RVRR and PDX>=AVRR>RVRR, respectively. The AVRR variant could form a complex with both PC6 and furin, however, it had neither inhibitory activity in vitro nor complex formation activity ex vivo against PACE4. These findings indicate that AVRR variant is a highly selective inhibitor against PC6 and furin.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 4. . Co-expression of SPC and {alpha}1-AT variants in HEK293 cells. HEK293 cells (3.5 cm dish) were transfected with expression plasmids (2.5 µg) for PACE4, PC6 or furin in the presence of the expression plasmids (2.5 µg) for {alpha}1-AT variant, AVRR, {alpha}1-PDX or RVRR. After transfection for 48 h, the cells were labeled with [35S]Met/Cys for 8 h as described in Materials and methods. The conditioned medium was then immunoprecipitated with anti-PACE4 HomoB (Anti-PACE4), anti-SCD or anti-antitrypsin (Anti-AT) antibodies. The immunoprecipitates were analyzed by SDS–PAGE (7.5% gel) and fluorography.

 
Inhibition of proC3 processing by the AVRR variant ex vivo

The inhibitory effect of the AVRR variant on the processing of rat complement proC3 mediated by endogenous SPC in HEK293 cells was examined. ProC3 is synthesized as a single polypeptide chain precursor (180 kDa) and processed to the mature form consisting of {alpha} chain (115 kDa) and ß chain (75 kDa) linked together by disulfide bonds. Rat proC3 is then cleaved at RRRR670{downarrow} and secreted into culture medium (Oda et al., 1992Go). As shown in Figure 5Go (left), although wild-type {alpha}1-AT had no effect on proC3 maturation, endogenous proC3 processing activity was blocked by expression of variants AVRR, {alpha}1-PDX and RVRR in HEK293 cells. However, the inhibitory effect of these variants differed. Whereas the expression of {alpha}1-PDX or RVRR resulted in complete inhibition of proC3 processing, a significant amount of maturated C3 {alpha} and ß chain was detected when variant AVRR was expressed. PCR analysis showed that HEK293 cells express furin, PACE4, PC6 and PC8. These convertases have proC3 processing activity, however, PC8 is not inhibited by {alpha}1-PDX (Jean et al., 1998Go). Therefore, the processing of proC3 into mature C3 by furin + PC6 and PACE4 was estimated to be 90 and 10%, respectively, in control HEK293 cells. The involvement of PC6 was considered to be very small, because there was no difference in the processing efficiency between {alpha}1-PDX and RVRR variant expressing cells. To confirm the selective inhibitory effect of variants AVRR and RVRR on the PACE4-mediated proC3 processing in HEK293 cells, expression vectors for these variants and proC3 were co-transfected into HEK293 cells stably expressing PACE4. As shown in Figure 5Go (right), the AVRR variant barely inhibited proC3 processing, whereas the RVRR variant inhibited the processing completely. The complex of PACE4 with the RVRR variant was detected but the complex with AVRR was not. These results indicate that the majority of proC3 was processed by PACE4 in this cell line and that the AVRR variant could not block PACE4-mediated proC3 processing. In contrast, the RVRR variant was confirmed to have a strong inhibitory effect on PACE4 activity in the cells. Thus, the selectivity of the AVRR variant against PACE4 was clearly demonstrated to be distinct from those of the {alpha}1-PDX and RVRR variants both in vitro and ex vivo.



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 5. . Inhibition of proC3 maturation by {alpha}1-AT variants. Control and HEK 293 cells stably expressing PACE4 were transfected with an expression plasmid for rat complement proC3 in the presence of expression plasmids for the {alpha}1-AT variants. After transfection for 48 h, the cells were labeled with [35S]Met/Cys for 8 h as described in Materials and methods. The conditioned medium was immunoprecipitated with anti-C3 and anti-PACE4 HomoB (Anti-PACE4) antibodies. The immunoprecipitates were analyzed by SDS–PAGE (7.5% gel) and fluorography. The band in the gel exhibiting radioactivity was quantified using a BAS-1500 bioimaging analyzer and MacBAS software. The processing efficiency is indicated below each panel.

 
Effect of {alpha}1-AT variants on the maturation of E-cadherin

E-cadherin is a 120 kDa transmembrane, Ca2+-dependent cell adhesion molecule. Cadherins are initially synthesized as inactive precursors and cleavage of the propeptide at a consensus SPC clevage site is required for its adhesiveness (Ozawa and Kemler, 1990Go). Previously, Posthaus et al. showed that the human colon carcinima cell line, Lovo, which expresses no functional furin (Takahashi et al., 1993Go), processed human pro E-cadherin (RQKR154{downarrow}) as efficiently as cells expressing active furin (Posthaus et al., 1998Go). Therefore, an alternative convertase other than furin was postulated to be responsible for the maturation of pro-E-cadherin. Lovo cells express PACE4, PC6 and PC8 (Seidah et al., 1994Go, 1996Go). To assess which convertase is responsible for maturation of E-cadherin, we analyzed the processing of E-cadherin in Lovo cells stably transfected with the cDNA of {alpha}1-AT variants. Lovo cells expressing control {alpha}1-AT (L-control AT) and AVRR variant (L-AVRR1) fully processed pro-E-cadherin (135 kDa) to mature E-cadherin (120 kDa); however, expression of variants {alpha}1-PDX and RVRR caused a slight reduction in the pro-E-cadherin processing as shown in Figure 6AGo. Approximately 20% of pro-E-cadherin was not maturated in cell lines L-PDX 1 and 2 as well as in L-RVRR 1 and 2. PC8 is not sensitive to the {alpha}1-AT variant (Jean et al., 1998Go), and the AVRR variant has no inhibitory activity against PACE4. Moreover, although PC6 is less sensitive to the RVRR variant than {alpha}1-PDX, both variants had the same inhibitory effect on pro-E-cadherin processing. Therefore, these results indicate that ~20% of pro-E-cadherin is maturated by PACE4, and the remainder is processed by PC8 or other {alpha}1-PDX-resistant enzymes. In contrast with the effect of exogenously expressed {alpha}1-AT variant on pro-E-cadherin maturation, the morphology of Lovo cells was greatly influenced by variants {alpha}1-PDX and RVRR. As shown in Figure 6BGo, the formation of cell aggregates was promoted in the cells expressing {alpha}1-PDX and RVRR, although the AVRR variant had little effect. Since only the AVRR variant has no inhibitory activity against PACE4 from among the {alpha}1-AT variants tested, it is highly likely that PACE4 is involved in the activation of cell surface proteins which regulate cell migration.



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 6. . Processing of E-cadherin in Lovo cells stably transfected with control and {alpha}1-AT variants ({alpha}1-PDX, RVRR and AVRR), and the morphological appearance of these cells. (A) Lovo cells were biosynthetically labeled with [35S]Met/Cys for 12 h. The cell extract was then immunoprecipitated with anti-E-cadherin IgG, followed by resolution by SDS–PAGE as described in Materials and methods. The processing efficiency is indicated below each panel. The position of precursor (135 kDa) and mature (120 kDa) forms of E-cadherin are indicated on the right. (B) Lovo cells were trypsinized, seeded on non-coated plastic dishes and cell morphology was examined after incubation for 5 days.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Furin, PACE4, PC6 and PC8 function in the constitutive secretory pathway. However, few studies have specifically focused their attention on the roles of PACE4, even though recent histological and genetic studies have indicated unique functions for PACE4. Highly sensitive and specific inhibitors of individual SPC are helpful for clarifying the distinct functions of each SPCs. Recently, an endogenous furin inhibitor protein (PI8) was characterized (Dahlen et al., 1998Go) and several bio-engineered protein-based SPC inhibitors have also been developed (Lu et al., 1993Go; Rompaey et al., 1997Go; Jean et al., 1998Go; Komiyama and Fuller, 2000Go). However, their specificity to SPCs is not yet clear. In the present study, we attempted to make a more specific {alpha}1-AT variant which could discriminate among the SPCs. Novel {alpha}1-AT variants, AVRR and RVRR, were prepared by site-directed mutagenesis and their inhibitory activity was compared with that of {alpha}1-PDX (RVPR variant) by both the inhibitory effect on the cleavage of substrate and the complex formation.

The most surprising aspect of this study was the differences between the substrate specificity of SPC determined using synthetic substrates and cleavage specificity towards the RSL sequence of the {alpha}1-AT variant. Tetrapeptidyl MCA substrates which have a Arg–X–Lys/Arg–Arg consensus motif are the best substrates for furin, PACE4 and PC6 (Nakayama, 1997Go; Tsuji et al., 1999bGo). However, furin was less sensitive to the RVRR variant than {alpha}1-PDX (RVPR). Inhibition of PC6 required an ~100-fold higher concentration of the RVRR variant than PACE4 and furin. Moreover, the AVRR variant inhibited furin and PC6 activities but not PACE4. Recently, the importance of the residues surrounding the cleavage site, especially the carboxyl side of P1 residue, in the inhibitory activity of serpin was shown. Sun et al. revealed the importance of the P4' residue in protease inhibitor 9 (PI-9, granzyme B inhibitor) by scanning mutagenesis of its RSL (Sun et al., 2001Go). This inhibitor is also a member of the serpin family and inhibits granzyme B. The P4' residue of PI-9 plays a role in binding of the protease to the inhibitor, suggesting that the P4' residue facilitates positioning of the RSL within the active site of the target protease. The residues located at the carboxy side of P1 in {alpha}1-AT variants might have distinct effects on the interactions with furin, PACE4 and PC6. Sun et al. also showed that substitution of the P1 Glu with Asp resulted in a much poorer inhibitor that is efficiently cleaved by granzyme B. Taken together, the loss of inhibitory effect for the AVRR variant on PACE4 activity might be explained as follows. The {alpha}1-AT–protease interaction involves the reversible formation of an initial complex, which is followed by conversion to a stable complex through cleavage of the inhibitor between the P1 and P1' residues, and this in turn triggers rapid insertion of the RSL into the serpin A ß-sheet before deacylation is completed (inhibitory pathway) (Wright, 1996Go). Alternatively, when proteolysis is completed before the RSL insertion, the protease escapes from the stable complex formation, releasing active protease and cleaved inhibitor (substrate pathway). Our results suggest that PACE4 could complete the cleavage at AVRR{downarrow} before the RSL insertion occurs because the P1 site in the RSL of the AVRR variant is preferred by PACE4 much more than furin and PC6, and it escapes from the stable protease/inhibitor complex. Alternatively, PACE4 might dissociate from {alpha}1-AT during a conformational change of the protease/inhibitor complex after cleavage (P1{downarrow}P1') because binding of PACE4 to the RSL lacking the arginine residue at the P4 position is looser than those of furin and PC6. A third possibility worth considering is that a cleavage at a position distinct from P1–P1' (Arg–Ser353) by PACE4 caused an inactivation of the AVRR variant. A possible cleavage site for PACE4, Arg–Gln–Thr–Arg276 is located at the N-terminal side of RSL in rat {alpha}1-AT. However, this idea can be ruled out because no cleaved {alpha}1-AT with a size smaller than 51 kDa was detected. To our knowledge, the P' residues on the carboxyl side of the RSL are not considered to be an important determinant of SPC inhibition. Further analysis on the roles of residues at the carboxyl side of P1 is necessary to understand the distinct specificity of {alpha}1-AT variants against SPCs. Although X-ray structural analysis of SPCs has not yet been carried out, molecular modeling of the catalytic domain of furin (Creemers et al., 1993Go), PC2 and PC3 (Lipkind et al., 1995Go) was performed on the basis of their homology (25–30%) with bacterial subtilisins. They predicted negatively charged residues (Asp and Glu) in the S1, S2 and S4 subsites which can directly interact with basic residues in the substrates via formation of the salt bridges. However, the difference in the their selectivity for individual substrates cannot yet be explained. SPCs all possess a well conserved HomoB domain (also called P domain) at the carboxy side of the catalytic domain and this domain appears to be necessary for correct folding of the catalytic domain and to regulate its specialized features (Zhou et al., 1998Go). The HomoB domain is not present in bacterial subtilisin and no homologous protein sequence with the HomoB region has yet been found. Moreover, none of the proteases belonging to the SPC family has been investigated by X-ray analysis. Therefore, the data required for modeling of the SPC/{alpha}1-AT variant complex are not available at this time. Our results indicate that {alpha}1-AT variants would be good tools for clarifying the different specificities of each SPC. The scanning mutagenesis of the RSL of {alpha}1-AT will provide useful information on the substrate specificity of SPCs.

Recently various peptide inhibitors of SPC have been developed. Polyarginine was shown to be a potent and relatively specific inhibitor of furin (Cameron et al., 2000Go). However, furin and PACE4 were both inhibited by polyarginine peptides, although PC1 was much less sensitive to the peptides than furin and PACE4. Zhong et al. reported that the prosegment of furin was a potent inhibitor of furin, PC6 and PC8 (Zhong et al., 1999Go). Compared with these peptide inhibitors reported previously, {alpha}1-AT variants are much more specific for SPCs with the series of {alpha}1-AT variants (PDX, AVRR and RVRR variants) showing varied selectivity against furin, PC6 and PACE4. Although the inhibitory activities of polyarginine and the prosegment of furin against trypsin-like protease were not reported, these peptides are expected to function as competitive inhibitors of trypsin-like protease because of their basic amino acid residues. Thus, the {alpha}1-AT variants described here will allow us to define more precisely the unique biological roles of SPCs and elaborate on the extent of functional overlap between the members of this family. In addition, after the crystal structures of SPCs are solved, these {alpha}1-AT variants will provide useful information required for the design of more specific synthetic SPC inhibitors.


    Notes
 
1 Present address: Drug Discovery Laboratories, Mitsubishi Pharma Corporation, 25-1 Shodai-Ohtani, 2-Chome Hirakata, Osaka 573-1153, Japan Back

2 To whom correspondence should be addressed. E-mail: matsuda{at}bio.tokushima-u.ac.jp Back

In discussing residues of the reactive site loop of {alpha}1-antitrypsin, the bait amino acid that interacts with the S1 site of the protease is referred to as the P1 residue, with the amino acids on the amino terminal side of the scissile reactive center bond labeled P1, P2, P3, etc. and the amino acids on the carboxy side P11, P2', etc. (Schechter and Berger, 1967Go).


    Acknowledgments
 
We thank Dr K.Nakayama for the gift of the truncated furin cDNA and Lovo cells, Dr K.Oda for the gift of the kexstatin-I mutant, and Dr Y.Ikehara for the gift of rat {alpha}1-AT cDNA and complementary proC3 cDNA. We also thank Messrs Kiyoto Naitoh, Kensuke Sakurai and Ms Yuka Sasaki for technical assistance. This work was supported by a Grand-in-Aid for Scientific Research (C) and Priority Area (Intracellular Proteolysis) from the Ministry of Education, Culture, Sports, Science and Technology of Japan.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Akamatsu,T., Daikoku,S., Nagamune,H., Yoshida,S., Mori,K., Tsuji,A. and Matsuda,Y. (1997) Histochem. Cell Biol., 108, 95–103.[CrossRef][Web of Science][Medline]

Akamatsu,T., Matsuda,Y., Tsumura,K., Tada,J., Parvin,M.H., Wei,W., Kanamori,N. and Hosoi,K. (2000) Biochem. Biophys. Res. Commun., 272, 410–415.[CrossRef][Web of Science][Medline]

Anderson,E.D., Thomas,L., Hayflick,J.S. and Thomas,G. (1993) J. Biol. Chem., 268, 24887–24891.[Abstract/Free Full Text]

Bradford,M.M. (1976) Anal. Biochem., 72, 248–254.[CrossRef][Web of Science][Medline]

Bruzzaniti,A., Goodge,K., Jay,P., Taviaux,S.A., Lam,M.H.C., Berta,P., Martin,T.J., Moseley,J.M. and Gillespie,M.T. (1996) Biochem. J., 314, 727–731.

Cameron,A., Appel,J., Houghten,R.A. and Lindberg,I. (2000) J. Biol. Chem., 275, 36741–36749.[Abstract/Free Full Text]

Constam,D.B. and Robertson,E.J. (1999) J. Cell. Biol., 144, 139–149.[Abstract/Free Full Text]

Constam,D.B. and Robertson,E.J. (2000) Genes. Dev., 14, 1146–1155.[Abstract/Free Full Text]

Constam,D.B., Calfon,M. and Robertson,E.J. (1996) J. Cell. Biol., 134, 181–191.[Abstract/Free Full Text]

Creemers,J.W.M., Siezen,R.J., Roebroek,A.J.M., Ayoubi,T.A. Huylebroeck,D. and Van de Ven,W.J.M. (1993) J. Biol. Chem., 268, 21826–21834.[Abstract/Free Full Text]

Dahlen,J.R., Jean,F., Thomas,G., Foster,D.C. and Kisiel,W. (1998) J. Biol. Chem., 273, 1851–1854.[Abstract/Free Full Text]

Fuller,R.S., Brake A.J. and Thorner,J. (1989) Science, 246, 482–486.[Abstract/Free Full Text]

Garten,W., Hallenberger,S., Ortmann,D., Schafer,W., Vey,M., Angliker,H., Shaw,E. and Klenk,H.D. (1994) Biochimie, 76, 217–225.[Medline]

Gordon,V.M., Rehemtulla,A. and Leppla,S.H. (1997) Infect. Immun., 65, 3370–3375.[Abstract]

Halban,P.A. and Irminger, J.-C. (1994) Biochem. J., 299, 1–18.

Jean,F., Stella,K., Thomas,L., Liu,G., Xiang,Y., Reason,A.J. and Thomas,G. (1998) Proc. Natl Acad. Sci. USA, 95, 7293–7298.[Abstract/Free Full Text]

Kiefer,M.C., Tucker,J.E., Joh,R., Landsberg,K.E., Saltman,D. and Barr,P.J. (1991) DNA Cell Biol., 10, 757–769.[Web of Science][Medline]

Komiyama,T. and Fuller,R.S. (2000) Biochemistry, 39, 15156–15165.[CrossRef][Medline]

Laemmli,U.K. (1970) Nature, 227, 680–685.[CrossRef][Medline]

Lipkind,G., Gong,Q. and Steiner,D.F. (1995) J. Biol. Chem., 270, 13277–13284.[Abstract/Free Full Text]

Lu,W., Zhang,W., Molloy,S.S., Thomas,G., Ryan,K., Chiang,Y., Anderson,S. and Laskowski,M.,Jr (1993) J. Biol. Chem., 268, 14583–14585.[Abstract/Free Full Text]

Meerabux,J., Yaspo,M.L., Roebroek,A.J., Van de Ven,W.J., Lister,T.A. and Young,B.D. (1996) Cancer Res., 56, 448–451.[Abstract/Free Full Text]

Mori,K., Kii,S., Tsuji,A., Nagahama,M., Imamaki,A., Hayashi,K., Akamatsu,T., Nagamune,H. and Matsuda,Y. (1997) J. Biochem., 121, 941–948.[Abstract/Free Full Text]

Nagahama,M., Taniguchi,T., Hashimoto,E., Imamaki,A., Mori,K., Tsuji,A. and Matsuda,Y. (1998) FEBS Lett., 434, 155–159.[CrossRef][Web of Science][Medline]

Nakagawa,T., Hosaka,M., Torii,S., Watanabe,T., Murakami,K. and Nakayama,K. (1993) J. Biochem., 113, 132–135.[Abstract/Free Full Text]

Nakayama,K. (1997) Biochem. J., 327, 625–635.

Nakayama,K., Kim,W.S., Torii,M., Hosaka,S., Nakagawa,T., Ikemizu,J., Baba,T. and Murakami,K. (1992) J. Biol. Chem., 267, 5897–5900.[Abstract/Free Full Text]

Oda,K., Misumi,Y., Ikehara,Y., Brennan,S.O., Hatsuzawa,K., Nakayama,K. (1992) Biochem. Biophys. Res. Commun., 189, 1353–1361.[CrossRef][Web of Science][Medline]

Owen,M.C., Brennan,S.O., Lewis,J.H. and Carrel,R.W. (1983) New Engl. J. Med., 309, 694–698.[Abstract]

Ozawa,M. and Kemler,R. (1990) J. Cell. Biol., 111, 1645–1650.[Abstract/Free Full Text]

Posthaus,H., Dubois,C.M., Laprise, M-H., Grondin,F., Suter,M.M. and Müller,E. (1998) FEBS Lett., 438, 306–310.[CrossRef][Web of Science][Medline]

Roebroek,A.J.M., Umans,L., Pauli,I.G.L., Robertson,E.J., van Leuven,F., Van de Ven,W.J.M. and Constam,D.B. (1998) Development, 125, 4863–4876.[Abstract]

Rompaey,L.V., Ayoubi,T., Van de Ven,W. and Marynen,P. (1997) Biochem. J., 326, 507–514.

Sakaguchi,T., Matsuda,Y., Kiyokage,R., Kawahara,N., Kiyotani,K., Katunuma,N., Nagai,Y. and Yoshida,T. (1991) Virology, 184, 504–512.[CrossRef][Web of Science][Medline]

Sakuraba,H., Aoyagi,T. and Suzuki,Y. (1982) Clin. Chim. Acta, 125, 275–282.[CrossRef][Web of Science][Medline]

Schechter,I. and Berger,A. (1967) Biochem. Biophys. Res. Commun., 27, 157–162.[CrossRef][Web of Science][Medline]

Seidah,N.G., Chrétien,M. and Day,R. (1994) Biochimie, 76, 197–209.[Medline]

Seidah,N.G., Hamelin,J., Mamarbachi,M., Dong,W., Tadros,H., Mbikay,M., Chrétien,M. and Day,R. (1996) Proc. Natl Acad. Sci. USA, 93, 3388–3393.[Abstract/Free Full Text]

Smeekens,S.P. and Steiner,D.F. (1990) J. Biol. Chem., 265, 2997–3000.[Abstract/Free Full Text]

Smeekens,S.P., Avruch,A.S., LaMendola,J., Chan,S.J. and Steiner,D.F. (1991) Proc. Natl Acad. Sci. USA, 88, 340–344.[Abstract/Free Full Text]

Sun,J., Whisstock,J.C., Harriott,P., Walker,B., Novak,A., Thompson,P.E., Smith,A.I. and Bird,P.I. (2001) J. Biol. Chem., 276, 15177–15184.[Abstract/Free Full Text]

Takahashi,S., Kasai,K., Hatsuzawa,K., Kitamura,N., Misumi,Y., Ikehara,Y., Murakami,K. and Nakayama,K. (1993) Biochem. Biophys. Res. Commun., 195, 1019–1026.[CrossRef][Web of Science][Medline]

Tsuji,A., Higashine,K., Hine,C., Mori,K., Tamai,Y., Nagamune,H. and Matsuda,Y. (1994) Biochem. Biophys. Res. Commun., 200, 943–9500.[CrossRef][Web of Science][Medline]

Tsuji,A., Hine,C., Tamai,Y.,Yonemoto,K., Mori,K., Yoshida,S., Bando,M., Sakai,E., Mori,K., Akamatsu,T. and Matsuda,Y. (1997) J. Biochem., 122, 438–452.[Abstract/Free Full Text]

Tsuji,A., Yoshida,S., Hasegawa,S., Bando, Miwa., Yoshida,I., Koide,S., Mori,K. and Matsuda,Y. (1999a) J. Biochem., 126, 494–502.[Abstract/Free Full Text]

Tsuji,A., Hashimoto,E., Ikoma,T., Taniguchi,T., Mori,K., Nagahama,M. and Matsuda, Y, (1999b) J. Biochem., 126, 591–603.[Abstract/Free Full Text]

Wright,H.T. (1996) BioEssays, 18, 453–464.[CrossRef][Web of Science][Medline]

Yoshida,I., Koide,S., Hasegawa,S., Nakagawara,A., Tsuji,A. and Matsuda,Y. (2001) Biochem. J., 360, 683–689.[CrossRef][Web of Science][Medline]

Zhong,M., Munzer,J.S., Basak,A., Benjannet,S., Mowla,S., Decroly,E., Chrétien M. and Seidah,N.G. (1999) J. Biol. Chem., 274, 33913–33920.[Abstract/Free Full Text]

Zhou,A., Martin,S., Lipkind,G., LaMendola,J. and Steiner,D.F. (1998) J. Biol. Chem., 273, 11107–11114.[Abstract/Free Full Text]

Zhou,A., Webb,G., Zhu,X. and Steiner,D.F. (1999) J. Biol. Chem., 274, 20745–20748.[Free Full Text]

Received September 10, 2001; revised November 12, 2001; accepted November 16, 2001.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Protein Eng Des SelHome page
A. Tsuji, H. Kanie, H. Makise, K. Yuasa, M. Nagahama, and Y. Matsuda
Engineering of {alpha}1-antitrypsin variants selective for subtilisin-like proprotein convertases PACE4 and PC6: Importance of the P2' residue in stable complex formation of the serpin with proprotein convertase
Protein Eng. Des. Sel., April 1, 2007; 20(4): 163 - 170.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
M. Gauster, A. Hrzenjak, K. Schick, and S. Frank
Endothelial lipase is inactivated upon cleavage by the members of the proprotein convertase family
J. Lipid Res., May 1, 2005; 46(5): 977 - 987.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
T. Osterwalder, A. Kuhnen, W. M. Leiserson, Y.-S. Kim, and H. Keshishian
Drosophila Serpin 4 Functions as a Neuroserpin-Like Inhibitor of Subtilisin-Like Proprotein Convertases
J. Neurosci., June 16, 2004; 24(24): 5482 - 5491.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Pullikotil, M. Vincent, S. T. Nichol, and N. G. Seidah
Development of Protein-based Inhibitors of the Proprotein of Convertase SKI-1/S1P: PROCESSING OF SREBP-2, ATF6, AND A VIRAL GLYCOPROTEIN
J. Biol. Chem., April 23, 2004; 279(17): 17338 - 17347.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Nour, A. Basak, M. Chretien, and N. G. Seidah
Structure-Function Analysis of the Prosegment of the Proprotein Convertase PC5A
J. Biol. Chem., January 24, 2003; 278(5): 2886 - 2895.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tsuji, A.
Right arrow Articles by Matsuda, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsuji, A.
Right arrow Articles by Matsuda, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?