Protein Engineering, Vol. 15, No. 7, 575-584,
July 2002
© 2002 Oxford University Press
Subunit interface mutation disrupting an aromatic cluster in Plasmodium falciparum triosephosphate isomerase: effect on dimer stability
1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore 560012 and 2 Molecular Biology and Genetics Unit, Jawaharlal Nehru Center for Advanced Scientific Research, Jakkur Campus, Jakkur P.O., Bangalore 560004, India
| Abstract |
|---|
|
|
|---|
A mutation at the dimer interface of Plasmodium falciparum triosephosphate isomerase (PfTIM) was created by mutating a tyrosine residue at position 74, at the subunit interface, to glycine. Tyr74 is a critical residue, forming a part of an aromatic cluster at the interface. The resultant mutant, Y74G, was found to have considerably reduced stability compared with the wild-type protein (TIMWT). The mutant was found to be much less stable to denaturing agents such as urea and guanidinium chloride. Fluorescence and circular dichroism studies revealed that the Y74G mutant and TIMWT have similar spectroscopic properties, suggestive of similar folded structures. Further, the Y74G mutant also exhibited a concentration-dependent loss of enzymatic activity over the range 0.110 µM. In contrast, the wild-type enzyme did not show a concentration dependence of activity in this range. Fluorescence quenching of intrinsic tryptophan emission was much more efficient in case of Y74G than TIMWT, suggestive of greater exposure of Trp11, which lies adjacent to the dimer interface. Analytical gel filtration studies revealed that in Y74G, monomeric and dimeric species are in dynamic equilibrium, with the former predominating at low protein concentration. Spectroscopic studies established that the monomeric form of the mutant is largely folded. Low concentrations of urea also drive the equilibrium towards the monomeric form. These studies suggest that the replacement of tyrosine with a small residue at the interface of triosephosphate isomerase weakens the subunitsubunit interactions, giving rise to structured, but enzymatically inactive, monomers at low protein concentration.
Keywords: aromatic cluster/dimer stability/Plasmodium falciparum triosephosphate isomerase/subunit interface/Y74G mutant
| Introduction |
|---|
|
|
|---|
Subunit interfaces of oligomeric proteins play an important role in the stability, assembly and function of proteins (Klotz et al., 1970
Triosephosphate isomerase (TIM), a homodimeric, glycolytic enzyme catalyzing the interconversion of glyceraldehyde-3-phosphate to dihydroxyacetone phosphate (Knowles, 1991
), has proved to be an important model system. It is a prototype of the widely occurring ß8/
8 (TIM) barrel and has been studied extensively with respect to its structure and function (Alber et al., 1981
; Petsko et al., 1993
). Pioneering studies on this enzyme by various research groups have provided useful insights on its stability (Rentier-Delrue et al., 1993
; Borchert et al., 1994
; Garza-Ramos et al., 1994
; Yuksel et al., 1994
; Sun et al., 1995
; Mainfroid et al., 1996a
), subunit interactions at the interface (Kuntz et al., 1992
; Perez-Montfort et al., 1999
), activity under different conditions (Richard, 1991
) and unfolding behavior (McVittie et al., 1977
; Asakawa and Mohrenweiser, 1982
; Gokhale et al., 1999
; Gopal et al., 1999
; Lambeir et al., 2000
). All reported triosephosphate isomerases from different sources exist as dimers, with the exception of Thermotoga maritima, which is a tetramer (Maes et al., 1999
). Schliebs et al. have reported the dissociation constant of the dimeric trypanosomal TIM to be of the order of 1011 M (Schliebs et al., 1997
). The folding pathway of the TIM dimer is described by a consecutive first-order folding to a monomer, followed by a rate-limiting second-order association reaction. This two-step process implies the formation of a structured monomer prior to dimer formation (Zabori et al., 1980
; Mainfroid et al., 1996b
; Rietveld and Ferreira, 1998
).The unfolding pathway of TIM has recently been shown to involve a monomeric intermediate (Morgan et al., 2000
).
Earlier attempts to monomerize trypanosomal triosephosphate isomerase by Borchert et al. involved the deletion of a segment of the interface loop (loop 3), causing disruption of the interface interactions and generation of monomeric species (Borchert et al., 1994
). However, the monomeric enzyme exhibited only 0.1% of the wild-type enzyme activity. More recently, Schliebs et al reported the generation of monomeric form of trypanosomal triosephosphate isomerase by mutating two interface residues, viz. T75R and G76E, which also showed a 1000-fold reduction in activity (Schliebs et al., 1997
).
We have been focusing on Plasmodium falciparum triosephosphate isomerase (PfTIM) as a model system for understanding the interactions determining folding, stability and subunit association (Velanker et al., 1997
; Gokhale et al., 1999
; Gopal et al., 1999
). The crystal structure of PfTIM determined at 2.2 Å resolution (Velanker et al., 1997
) has a very high structural similarity to all other known triosephosphate isomerase structures (Wierenga et al., 1987
, 1991
; Lolis et al., 1990
; Zhang et al., 1994
). The overall surface area buried in the dimeric interface of PfTIM is 1800 Å2 per subunit, which constitutes 15.5% of the total solvent-accessible area of the isolated monomers. The interface is predominantly polar (four positive and three negative residues lie at the interface) and contains an inter-subunit salt bridge between R98 and E77. Loop 3 [V66A80; the residue numbering used here follows the PfTIM sequence as reported earlier (Velanker et al., 1997
)], which protrudes sim;13 Å out of the bulk of the monomer and docks into a narrow pocket close to the active site of the other subunit (Velanker et al., 1997
), contributes substantially to intersubunit interactions. This loop is very important for dimer stability as sim;80% of the intersubunit atomatom contacts involve this loop, a feature noted earlier for other triosephosphate isomerases (Wierenga et al., 1987
, 1991
; Lolis et al., 1990
; Zhang et al., 1994
). We have previously reported that a mutation from tyrosine to cysteine (Y74C) at the tip of the loop 3 resulted in a cavity at the interface leading to weakening of subunitsubunit interactions. Prolonged aerial oxidation of this cysteine gave rise to a covalent cross-link with Cys13 of the other subunit. This oxidized form of the mutant, which contains two symmetry-related intersubunit disulfide bonds, was found to be appreciably stabilized, relative to the reduced form (Gokhale et al., 1999
; Gopal et al., 1999
).
In this work, in an attempt to generate monomers, we replaced the Tyr74 residue by the smallest amino acid, Gly. Tyr74 makes several critical contacts at the dimer interface, particularly with residues Cys13, Glu97 and Tyr101 from the other subunit and is also a part of an aromatic cluster involving residues Tyr74A, Tyr101B, Phe102B and Phe69A. Aromatic clusters have frequently been implicated in the stabilization of folded protein structures. Quadrupolequadrupole interactions involving proximal aromatic rings have been suggested to be important contributors to protein stability (Burley and Petsko, 1985
, 1988
). Figure 1
illustrates the environment of Tyr74 in the wild-type PfTIM and shows the anticipated effect of the Y74G mutation. The aromatic cluster present at the interface in PfTIM is also shown.
|
The results reported here suggest that in the mutant Y74G, appreciable dissociation is evident at a concentration of sim;10 µM, with a concurrent loss of enzymatic activity. The concentration dependence of fluorescence and circular dichroism (CD) spectra suggests that the monomer is substantially folded whereas activity studies reveal that dissociation leads to a significant attenuation of activity.
| Materials and methods |
|---|
|
|
|---|
Reagents
-Glycerol phosphate dehydrogenase, NADH, glyceraldehyde-3-phosphate dehydrogenase and 5,5'-dithiobis(2-nitrobenzoic acid) (DTNB) were purchased from Sigma Chemical (St. Louis, MO) and used without further purification. The substrate glyceraldehyde-3-phosphate was obtained as the diethylacetal monobarium salt and processed to its active form according to the manufacturer"s instructions. The concentration of glyceraldehyde-3-phosphate extracted was estimated using glyceraldehyde 3-phosphate dehydrogenase. Restriction enzymes and T4 DNA ligase were procured from Amersham Pharmacia (Amersham, UK) and Taq DNA polymerase from Bangalore Genei (Bangalore, India). All other chemicals were procured locally and were of analytical-reagent grade. Conditions recommended by the manufacturer were used for all molecular biology reagents. The Escherichia coli strain AA200 was a gift from Dr Barbara Bachmann of the E.coli Genetic Stock Center (New Haven, CT).
Mutagenesis and protein purification
The PfTIM gene was cloned into pTrc99A vector, called pARC1008 in E.coli strain AA200, which has a null mutation in the host TIM gene (Ranie et al., 1993
). The detailed purification procedure has been published previously (Velanker et al., 1997
). The mutant Y74G was constructed from wild-type TIM using the method of megaprimer polymerase chain reaction (PCR) (Sarkar and Sommer, 1990
). The mutagenic oligonucleotide, 5'GGAAATGGATCAGGTACAGGTGAAGTA3' along with a 3' oligonucleotide (5'ACGGATCCTTACATAGCACTTTTTATTATATC3') was used to amplify a 546 bp fragment with PfTIMC1 [wild-type TIM cloned in the expression vector pTRC99A (Ranie et al., 1993
)] as template. PCR was carried out for 30 cycles in 50 ml of solution containing 10 mM TrisHCl, pH 9.0, 1.5 mM MgCl2, 50 mM KCl, 0.01% gelatin, 2.5 mM dNTPs, 400 nM oligonucleotide primers, 5 ng template and 2 U Taq DNA polymerase with denaturation at 93°C for 15 s, annealing at 55°C for 15 s and extension at 73°C for 30 s. This fragment was gel purified and used as megaprimer along with a 5' primer (5'CAGAATTCCATGGCTAGAAAATATTTTGTCGC3') in the second PCR with PfTIMC1 as template. The conditions used were denaturation at 93°C for 45 s, followed by annealing at 68°C for 30 s and extension at 73°C for 30 s for 30 cycles. The buffer conditions used were same as in the first PCR with 50 ml of reaction mixture containing 400 nM 5' primer, 750 ng megaprimer and 5 ng template. This yielded a fragment of 764 bp, which was restriction digested with NcoI and BamH1, ligated with appropriately cut vector, pTRC99A (Amann et al., 1988
) and transformed into DH5a. Clone PfTIM (Y74
G), which contained a DNA fragment of the expected size, was partially sequenced and found to contain the mutation tac
ggt (Y74
G) at nucleotide position 220222. A second mutation c
t, at position, 201, resulting from non-template mediated addition of a at the 3' end of the megaprimer by Taq polymerase, was also seen (Jagath-Reddy et al., 1996
). However, this mutation does not result in change of the amino acid. This stretch of sequence also contained one more mutation, at position 396 (a
g). This again being a silent mutation did not lead to change in the protein sequence. E.coli strain AA200 (garB10, fhuA22, ompF627, fadL701, relA1, pit-10, spoT1, tpi-1, phoM510, merB1) was transformed with PfTIM(Y74
G), induced with IPTG and found to express high levels of a 28 kDa protein. The cell lysate was subjected to ammonium sulfate precipitation. Y74G could be selectively precipitated at 95% saturated ammonium sulfate (63%, w/v). Following this, the protein was further purified by ion-exchange chromatography using a Resource Q column. Yields of 6080 mg protein/l of E.coli culture were obtained. This protein was completely characterized by electrospray mass spectrometry as described under Results. The protein concentration was determined by the Bradford method (Bradford, 1976
). Bovine serum albumin (BSA) was used to construct the calibration curve.
TIM assay
Kinetic measurements were carried out according to the method of Plaut and Knowles (Plaut and Knowles, 1972
) in a Shimadzu UV210A double-beam spectrophotometer at room temperature. The cuvette contained 100 mM triethanolamine buffer, pH 7.6, 5 mM EDTA, 0.5 mM NADH and
-glycerol phosphate dehydrogenase (20 µg/ml) and 0.162.4 mM glyceraldehyde-3-phosphate. Enzyme activity was determined by monitoring the decrease in absorbance at 340 nm. The dependence of the initial rate on the substrate concentration was analysed according to the MichaelisMenten equation. The values for the kinetic parameters (Km and kcat) were calculated from LineweaverBurke plots.
Fluorescence spectra
Fluorescence emission spectra were recorded on a Hitachi Model 650-60 spectrofluorimeter. The protein samples were excited at 280 nm and the emission spectra recorded from 300 to 400 nm. The excitation and emission bandpasses were kept at 5 nm. For quenching studies, KI was added to the protein solution and incubated for 5 min, following which the fluorescence spectra were recorded. The fluorescence intensities were normalized for constructing the SternVolmer plots. 1 mM sodium thiosulfate and 100 mM KCl were added in KI quenching studies to sequester I3- ions, that are formed on dissolving KI in water and to maintain the ionic strength of the solution, respectively. Corrections for inner-filter effects were made to obtain the final spectra. The excitation wavelength for quenching studies was 290 nm.
Circular dichroism
CD measurements were carried out on a JASCO 715 spectropolarimeter. Ellipticity changes at 220 and 280 nm were monitored to follow the unfolding transition. A pathlength of 1 mm was used for the far-UV spectra and a 5 mm pathlength cuvette was used for the near UV-CD spectra. Spectra were averaged over four scans at a scan rate of 10 nm/min.
Rate of cysteine labelling with Ellmans reagent
The rate of cysteine labelling was determined using Ellmans method (Riddles et al., 1983
) using DTNB. Protein (4 µM) was incubated with DTNB (5-fold molar excess) in 100 mM TrisHCl, pH 8.0. The rate of labelling was monitored by following the increase in thionitrobenzoate anion (TNB2) concentration in the reaction mixture at 412 nm, until saturation was reached. The extinction of 14 500 M1 cm1 was used to calculate the thionitrobenzoate anion (TNB2) concentration.
Mass spectrometry
Electrospray ionization mass spectrometry (ESI-MS) was performed on a Hewlett-Packard HP-1100 electrospray mass spectrometer coupled to an on-line 1100 Series HPLC system. ESI was carried out using a capillary with an i.d. of 0.1 mm. The tip was held at 5000 V in the positive ion detection mode. Nebulization was assisted by N2 gas (99.8%) at a flow-rate of 10 l/min. The spray chamber was held at 300°C. The ion optics zone was optimized for maximum ion transmission. The best signal was obtained when a declustering potential (fragmenter voltage) of 200 V was set for detection. Data were acquired across a mass range of m/z 1253000, using a conventional quadrupole with a cycle time of 3 s. The spectrometer was tuned using five calibration standards provided by the manufacturer. Data processing was done using the deconvolution module of the Chemstation software to detect multiple charge states and obtain derived masses.
Size-exclusion HPLC
Analytical gel filtration was carried out using a calibrated TSK-3000SW gel filtration column (600x7.5 mm id, 10 µm film thickness) fitted to a Hewlett-Packard 1100 Series HPLC system. The protein sample was eluted at a flow-rate of 0.4 ml/min with 100 mM TrisHCl, pH 8.0 containing 200 mM NaCl. The effect of urea on the quaternary structure of the protein was monitored by incubation at the desired concentration of urea for 30 min before passing the sample through the gel filtration column equilibrated at the same urea concentration.
| Results |
|---|
|
|
|---|
Design of mutation
PfTIM has been shown to have a cysteine residue at position 13, which is part of the dimer interface (Velanker et al., 1997
). Earlier work on an interface mutant, Y74C, showed the formation of a symmetrically related bis-disulfide between the subunits but the fully reduced mutant (Y74Cred) was considerably less stable than the wild-type or the Y74Cox form. The replacement of Y74 also results in the loss of potential aromatic contacts (Figure 1
).We therefore decided to explore the consequences of replacing Tyr74 by the smallest amino acid, glycine, with the expectation that this mutant might considerably destabilize the dimer interface, possibly resulting in dissociation to monomeric form.
Characterization of the purified Y74G mutant protein
The mutant protein was obtained by the overexpression of the corresponding gene in the E.coli strain AA200 (null for TIM). On SDSPAGE a single band around 28 kDa is seen for Y74G. Analysis of Y74G by ESI-MS yielded a derived mass of 27.697 kDa (Figure 2
. It may be noted that under our conditions of electrospray only the protein monomer is detected). The calculated molecular mass of Y74G from the sequence is found to be 27.829 kDa. The disagreement between the observed and the calculated masses may be accounted for by assuming that Met1 is lost from the protein expressed in E.coli, a feature established earlier for the wild-type enzyme (Velanker et al., 1997
; Gokhale et al., 1999
). It is noteworthy that this mutant does not carry the A163V replacement which was noted in the case of TIMWT, presumably as a different clone was used in the mutagenesis protocol (see Methods). ESI-MS analysis of a tryptic digest yielded the peptide fragments F70K85 and A150K175 for both TIMWT and mutant enzymes. The observed masses of 1629.7 Da (F70K85) and 2923.1 Da (A150K175) in TIMWT and 1523.8 Da (F70K85) and 2895.1 Da (A150K175) in the mutant at the site of the engineered mutation and inadvertently introduced mutation site in TIMWT, respectively, confirm the sequence of Y74G. The purified form of the protein was checked for enzymatic activity using a coupled enzyme assay. The mutant protein was found to have a specific activity of 360430 U/mg of protein (the protein concentration was 10 µM). In contrast, the wild-type enzyme had a specific activity of 7800 8000 U/mg of protein (the protein concentration was 0.4 nM), suggesting that the mutant was almost 2030-fold less active. A more elaborate analysis of the concentration dependence of enzyme activity is given later.
|
Comparison of the UV spectra for TIMWT and Y74G indicated a slightly lower absorption for Y74G at 280 nm, probably due to loss of the Tyr74 contribution to the overall UV spectrum (Figure 3A
em) is red shifted to 334 nm in the case of the mutant, whereas for TIMWT it is 331 nm (Figure 3D
|
Enzyme activity
The specific activities of the wild-type and the mutant enzymes were determined using the method of Plaut and Knowles (Plaut and Knowles, 1972
). The catalytic parameters were calculated using the LineweaverBurke plot. In initial experiments, it was observed that in the concentration range 100.1µM, the activity of the Y74G mutant was extremely small compared with TIMWT. For the determination of the kinetic parameters, TIMWT was studied at a fixed concentration of 0.4 nM, whereas a substantially higher concentration of 2 µM was used for Y74G. Under these conditions, reasonably accurate determination of activity was possible for the mutant. It should be noted that for the Y74G mutant at a concentration of 2 µM we observed sim;60% of the maximum activity, suggesting that even at this concentration there is a significant population of monomer. Table I
shows the values of Km and kcat of the wild-type and mutant in comparison with triosephosphate isomerase from other sources. It is apparent that the Km values of the mutant and the wild-type are very similar, but the kcat for Y74G is almost sim;25-fold less, suggesting that the mutation has led to reduced enzyme activity. Figure 4
shows the variation of the specific activity with protein concentration for the two enzymes. In the case of TIMWT no concentration dependence is seen above 0.5x10-9 M (500 pM), whereas at lower concentrations in the range 0400 pM, a steep increase in activity with concentration is observed (Figure 4
, inset). A plausible explanation for this observation is that subunit dissociation occurs at low concentrations, with the monomeric species probably exhibiting negligible or no activity. In the case of the Y74G mutant a dramatic fall in the activity is observed below 10 µM, with no concentration dependence above a concentration of sim;15 µM. Clearly, the stability of the dimeric species is dramatically lowered in the case of the mutant enzyme, which may be attributed to subunit dissociation and/or to the fact that creation of a cavity very close to Cys13 may result in movement of the critical active site residue, Lys12, resulting in diminished activity in the mutant dimer. In order to probe further the stability of the interface, we examined the concentration dependence of activity in the presence of relatively low urea concentrations of 02 M. It was anticipated that urea may perturb the subunit interactions at these concentrations, without significantly disrupting the ß8/
8 barrel structure in the monomers (Jaenicke and Rudolph, 1986
; West and Price, 1988
; Herold and Kirschner, 1990
; Kornblatt et al., 1995
). Figure 4
shows that in the range 01.5 M urea, there is no effect on enzyme activity at high protein concentrations of sim;150 µM. The samples were diluted to measure activity at this concentration. Preliminary experiments showed that refolding of the mutant protein back to its active form (sim;80% of original activity) after dilution took almost 1 h. Therefore, to minimize the refolding effects the activity was measured immediately. However, at much lower protein concentrations there is a steep fall in enzyme activity with increasing urea concentration. Indeed, at 2 M urea, the mutant loses almost half of its activity even at the highest protein concentration studied (sim;140 µM). In this concentration regime, urea was found to have no effect on the enzymatic activity of TIMWT. The effect of urea on enzyme activity at various protein concentrations was limited to 02 M urea, where the denaturant is largely without effect on the property of the coupling enzyme (
-glycerol phosphate dehydrogenase).
|
|
Rate of cysteine labelling
PfTIM contains four cysteine residues (Cys13, Cys126, Cys196 and Cys217), of which Cys13 is buried at the dimer interface whereas the other three are distant from the site of mutation. Ellmans reagent was used to find the rates of labelling of the cysteines in the two proteins. Figure 5
shows that the rate of cysteine labelling in Y74G was considerably faster than that observed for the wild-type enzyme. This indicates that the mutation at the interface has indeed perturbed the dimer interface of the enzyme.
|
Fluorescence quenching by KI
The intrinsic fluorescence of P.falciparum TIM is dominated by contributions from two tryptophan residues, Trp11 and Trp168. As noted earlier, the latter is positioned on the surface loop and is distant from the dimer interface. Trp11 faces the interior of a monomeric subunit but is proximate in the sequence to a critical residue Cys13 that is involved in making critical contacts at the dimer interface (Velanker et al., 1997
). It may therefore be anticipated that subunit dissociation may result in structural readjustments in the vicinity of Trp11, with attendant changes in fluorescence spectra. Figure 6
shows the SternVolmer plots for the quenching of the tryptophan fluorescence by a polar quencher, KI, for both TIMWT and mutant proteins determined over a wide range of protein concentrations. When the two proteins are compared at a concentration of 1 µM it is clearly seen that tryptophan fluorescence of Y74G is dramatically quenched by KI, as compared with the behaviour observed for TIMWT. In the case of the wild-type enzyme the quenching curves observed over the range 0.242.4 µM are similar, whereas a pronounced concentration dependence is observed in the Y74G mutant. The quenching curves at low protein concentration show a decidedly upward curvature (Figure 6A
) in the case of Y74G. It is likely that subunit dissociation may result in the exposure of positively charged residues buried at the dimer interface, which may facilitate I- localization, leading to preferential quenching of Trp11 upon dissociation. Figure 7
summarizes the effect of addition of low concentrations of urea on the concentration dependence of the SternVolmer constant. At a low protein concentration (sim;3 µM), relatively large values of KSV are obtained which are insensitive to urea concentration up to 2 M. In the absence of urea there is a dramatic fall in KSV in the region 310 µM, with no concentration dependence observed above 25 µM. This suggests that the association of folded subunits is essentially complete by 20 µM. Low concentrations of urea clearly destabilize subunit interactions, with a progressive increase in the protein concentration required to minimize fluorescence quenching.
|
|
Far-UV-CD
Far-UV-CD studies did not show any pronounced loss of the secondary structure even at sim;0.2 µM protein concentration and the ellipticity at 220 nm decreased linearly with decrease in protein concentration, suggesting that Y74G is structured even at very low concentrations (data not shown). Near-UV-CD measurements on Y74G mutant at low concentrations could not be recorded owing to experimental limitations.
Unfolding studies
The overall stability of the wild-type and the mutant was studied using various spectroscopic methods. Equilibrium denaturation studies in urea showed that TIMWT retains considerable structure even in 8 M urea (Gokhale et al., 1999
). It is seen that up to 6 M urea there is no significant change in the emission maximum (
em) and the emission intensity drops by only 3040%. However, there is a sharp change in the emission intensity between 6 and 8 M urea, suggesting a significant change in the Trp environment (Figure 8
). In the case of Y74G it is seen that the urea denaturation is concentration dependent. The Cm values (concentration of urea at which 50% of the protein is unfolded) are appreciably smaller at lower protein concentration, suggesting a possible shift in the equilibrium between dimer and monomer, in favour of the monomeric species. The latter has a significantly lower Cm value than the former (Figure 8
). The changes in the secondary structure of the two proteins with urea were monitored using far-UV-CD measurements at 220 nm (data not shown). It is seen that even at 8 M urea there is no substantial loss in the secondary structure in TIMWT, whereas the secondary structure of the mutant, Y74G, collapses at 2.6 M urea concentration (data not shown). Similar observations were made when GdmCl was used as a denaturant. In this case, TIMWT had a Cm of 1.2 M, whereas Y74G at a concentration of 30 µM, where dimeric species predominate, had a very low Cm of 0.2 M (data not shown).
|
Gel filtration
Gel filtration profiles for TIMWT on a calibrated TSK 3000SW gel filtration column show that the folded dimeric protein elutes at 18.0 ml under the conditions used. The gel filtration profile for TIMWT shows no change upon lowering the protein concentration or adding urea even at 3 M concentration (Figure 9D
) (Gokhale et al., 1999
). In the case of Y74G there is a pronounced asymmetry of the gel filtration profile with a clearly detectable shoulder at a higher elution volume (Figure 9A
). Over the concentration range 20250 µM, Y74G elutes predominantly as a dimeric species, with a shoulder presumably indicating the presence of a dissociated monomeric species. Collection of fractions corresponding to the major peak and the shoulder yielded similar profiles consistent with equilibration (data not shown). Upon addition of urea there is a significant change in the gel filtration profile of Y74G. At 1.5 M urea there is a clear shift in the elution profile to higher elution volumes, suggesting the existence of predominantly monomeric species (Figure 9B
). Further increase in urea concentration results in the appearance of a broad peak at low elution volumes (9.8 ml), which may be attributed to a protein aggregate (Figure 9C
). Aggregation of partially unfolded proteins in denaturant solutions has been widely reported (Havel et al., 1986
; Horowitz and Butler, 1993
).
|
| Discussion |
|---|
|
|
|---|
We have looked on the effect of disrupting the aromatic cluster at the subunit interface in P.falciparum triosephosphate isomerase (PfTIM) on its structure and activity. The mutation chosen, Y74G, also abolishes key intersubunit contacts. The choice of this mutational site was guided by the earlier observation that the Y74C mutation was significantly destabilized; a finding that occurred serendipitously while attempting to reinforce the dimer interface by a covalent disulfide cross-link (Gopal et al., 1999
Equilibrium denaturation studies indeed demonstrate that the mutation has destabilized the protein considerably. The mutant was found to melt in urea with a Cm of 1.2 M (30 µM, Y74G) whereas, in comparison, the wild-type was fairly robust and retained substantial structure even in 6 M urea. A similar decrease in Cm was noted when GdmCl was used as a denaturant. Similar destabilization was reported earlier for the Y74Cred mutant (Gopal et al., 1999
). The rate of cysteine labelling monitored using Ellmans reagent showed that rapid saturation of accessible sites in Y74G is achieved within 5 min, whereas for TIMWT saturation is observed only after sim;20 min. The surface accessibilities of the four cysteine residues, viz. Cys13, Cys126, Cys196 and Cys217, in TIMWT dimer are 0.1, 0, 36.5 and 2.8%, respectively, and in the monomer are 90.5, 0, 36.6 and 2.9%, respectively [surface accessibility calculations used a probe radius of 1.4 Å water molecule; van der Waals radii of all the heavy atoms in the protein were taken from Chothia (Chothia, 1976
); The program used was Naccess Ver. 2.1]. The facile reaction of the thiol groups in Y74G suggests a significantly greater exposure of cysteine residues compared with TIMWT. It is noteworthy that Cys13, which is at the dimer interface and almost inaccessible, may become completely exposed on dissociation. Interestingly, the corresponding Cys residue in trypanosomal TIM (Cys14) (as numbered in the trypanosomal sequence) and related TIMs has been shown to be labelled by variety of sulfhydryl reagents. In these cases covalent labelling may proceed either through the intermediacy of a dissociated species or by reagent attack, facilitated by dynamic movements of side chains clustered in the interface region (Garza-Ramos et al., 1994
, 1996
; Perez-Montfort et al., 1999
;). Although no attempt was made in the present study to delineate the specific sites of labelling, from the available literature on trypanosomal TIM (Garza-Ramos et al., 1994
, 1996
; Perez-Montfort et al., 1999
) and the fact that the other three cysteine residues are far from the site of mutation, the enhanced rate of labelling of Y74G mutant can be attributed to the enhanced accessibility of the interface cysteine.
A comparison of the kinetic properties of TIMWT and Y74G establishes that the mutant enzyme exhibits an sim;25-fold reduction in kcat, without any significant change in the Km value. Significantly, the activity of the mutant enzyme was found to be concentration dependent in the range 0.110 µM, whereas the wild-type protein was found to show a similar behavior over a very low concentration range of 25300 pM. A similar concentration dependence has been reported for human TIM, where the wild-type protein showed dilution-dependent inactivation at concentrations ranging from 10 to 200 pM, whereas the mutant M14Q showed concentration dependence in the range 10350 nM (Mainfroid et al., 1996b
). It may be noted that Cys13 in PfTIM and Met14 in human TIM occupy structurally equivalent positions. These results suggest that the loss of activity in the Y74G mutant may indeed be correlated with subunit dissociation. In the presence of urea (
2 M), the concentration-dependent loss of activity occurs at substantially higher protein concentration (sim;25 µM), indicating that the denaturant facilitates the subunit dissociation (Figure 4
). The enhanced rate of intrinsic tryptophan fluorescence quenching observed for Y74G as compared with TIMWT and the concentration dependence of the SternVolmer constant (KSV) provide further support for the presumption that subunit dissociation is enhanced in the mutant enzyme. The presence of Trp11 near the subunit interface provides a ready rationalization for increased quenching upon dissociation. Thus, both enhanced cysteine labelling and tryptophan quenching may be attributed to the unmasking of Cys13 and Trp11 upon dissociation. It is pertinent that Lys12, an active site residue important for binding the substrate via electrostatic interactions with a phosphate group, is flanked by these two residues. Dissociation may therefore alter the position of the residue that provides the anchor for the substrate, thereby altering the catalytic rate. The results of size-exclusion chromatography also suggest that unlike TIMWT, the mutant Y74G dissociates readily at low urea concentrations, yielding predominantly monomeric species. Studies in the absence of urea, at very low protein concentrations, were precluded by the limitations of the sensitivity of detection.
The results of the present study suggest that the Y74G mutation in PfTIM significantly destabilizes the subunit interface, facilitating dissociation of the dimer into the monomeric species. The concentration dependence of the kinetic properties of Y74G and the enhanced accessibility of the interface residue Cys13 suggest that monomeric species are significantly populated below a protein concentration of 5 µM. Interestingly, the far-UV-CD and fluorescence spectra of Y74G are found to be concentration independent, even at concentrations as low as 0.143 µM. These results may be indicative of the fact that the TIM monomer is indeed substantially folded, with only minor perturbations of the structure in the vicinity of the active site. A previous attempt at generating a monomeric TIM involved a replacement of 15 residues of loop 3 with eight residues in trypanosomal TIM. The resulting deletion mutant was monomeric and folded, as demonstrated by crystallography, and showed sim;0.1% of the activity of the wild-type enzyme (Borchert et al., 1994
). Two mutants of trypanosomal TIM, H47N (Schliebs et al., 1996
) and T75R/G76E (Schliebs et al., 1997
), have been shown to be monomeric with reduced stability and an almost a sim;1000-fold reduction in catalytic activity. An interface mutant of human TIM, M14Q, has been shown to exhibit concentration dependence of activity in the range 10350 nM. Two other mutants, M14Q/R98Q and R98Q, were catalytically inactive (Mainfroid et al., 1996b
). In our study, the concentration dependence of Y74G activity suggests that the monomeric form may be largely inactive. Inspection of the crystal structures of triosephosphate isomerases from several sources suggests that the two independent active sites in the dimer are composed by residues exclusively located on individual subunits. This suggests that the generation of fully active monomer should indeed be possible if all elements of function in the subunits are left unperturbed upon dissociation. The critical dependence of the activity on the quaternary structure may be ascribed to the Lys12 residue, which has been shown in all available TIM crystal structures to adopt an unusual backbone conformation with positive Ramachandran
values (Velanker et al., 1997
). The neighbouring Cys13 residue appears to make critical interface contacts. Structural changes induced at position 13 following dissociation may, in turn, propagate to Lys12, resulting in attenuation of activity. In the present study, Cys13 was perturbed by replacing the tyrosine residue at position 74 with a glycine residue. From the available evidence, we conclude that an appreciable population of folded structures exists in the monomeric TIM. Further, engineering of the Y74G mutant, to avoid local structural changes, which may result in enhanced enzymatic activity of monomeric triosephosphate isomerase, is an attractive possibility.
| Notes |
|---|
3 To whom correspondence should be addressed. E-mail: pb{at}mbu.iisc.ernet.in
| Acknowledgments |
|---|
This research was supported by a grant from the Department of Science and Technology, Government of India. The mass spectrometry facility is supported by the `Drug and Molecular Design program of the Department of Biotechnology, Government of India. K.M. and S.K.S. were supported by a Research Associateship of the Department of Biotechnology, Government of India and Senior Research Fellowship of the Council for Scientific and Industrial Research, Government of India. We are grateful to Soumya Sinha Ray and Chandana Sengupta for preliminary experiments with the Y74G mutant protein.
| References |
|---|
|
|
|---|
Alber,T., Banner,D.W., Bloomer,A.C., Petsko,G.A., Phillips,D., Rivers,P.S. and Wilson,I.A. (1981) Philos. Trans. R. Soc. Lond. B, Biol. Sci., 293, 159171.[Web of Science][Medline]
Albright,R.A., Mossing,M.C. and Matthews,B.W. (1996) Biochemistry, 35, 735742.[CrossRef][Medline]
Amann,E., Birgit,O. and Abel,K. (1988) Gene, 69, 301315.[CrossRef][Web of Science][Medline]
Asakawa,J. and Mohrenweiser,H.W. (1982) Biochem. Genet., 20, 5976.[CrossRef][Web of Science][Medline]
Bashir,A., Perham,R.N., Scrutton,N.S. and Berry,A. (1995) Biochem. J., 312, 527533.[Medline]
Borchert,T.V., Pratt,K., Zeelen,J.P., Callens,M., Noble,M.E., Opperdoes,F.R., Michels,P.A. and Wierenga,R.K. (1993) Eur. J. Biochem., 211, 703710.[Web of Science][Medline]
Borchert,T.V., Abagyan,R., Jaenicke,R. and Wierenga,R.K. (1994) Proc. Natl Acad. Sci. USA, 91, 15151518.
Bradford,M.M. (1976) Anal. Biochem., 72, 248254.[CrossRef][Web of Science][Medline]
Breiter,D.R., Resnik,E. and Banaszak,L.J. (1994) Protein Sci., 3, 20232032.[Web of Science][Medline]
Burley,S.K. and Petsko,G.A. (1985) Science, 229, 2328.
Burley,S.K. and Petsko,G.A. (1988) Adv. Protein Chem., 39, 125189.[Web of Science][Medline]
Casal,J.I., Ahern,T.J., Davenport,R.C., Petsko,G.A. and Klibanov,A.M. (1987) Biochemistry, 26, 12581264.[CrossRef][Medline]
Chothia,C. (1976) J. Mol. Biol., 105, 112.[CrossRef][Web of Science][Medline]
Darnall,D.W. and Klotz,I.M. (1975) Arch. Biochem. Biophys., 166, 651682.[CrossRef][Web of Science][Medline]
Garza-Ramos,G., Tuena de Gomez-Puyou,M., Gomez-Puyou,A., Yuksel,K.U. and Gracy,R.W. (1994) Biochemistry, 33, 69606965.[CrossRef][Medline]
Garza-Ramos,G., Perez-Montfort,R., Rojo-Dominguez,A., de Gomez-Puyou,M.T., Gomez-Puyou,A. (1996) Eur. J. Biochem., 241, 114120.[Web of Science][Medline]
Gokhale,R.S., Ray,S.S., Balaram,H. and Balaram,P. (1999) Biochemistry, 38, 423431.[CrossRef][Medline]
Goodsell,D.S. and Olson,A.J. (1993) Trends Biochem Sci., 18, 6568.[CrossRef][Web of Science][Medline]
Gopal,B., Ray,S.S., Gokhale,R.S., Balaram,H., Murthy,M.R.N. and Balaram,P. (1999) Biochemistry, 38, 478486.[CrossRef][Medline]
Havel,H.A., Kauffman,E.W., Plaisted,S.M. and Brems,D.N. (1986) Biochemistry, 25, 65336538.[CrossRef][Medline]
Herold,M. and Kirschner,K. (1990) Biochemistry, 29, 19071913.[CrossRef][Medline]
Horowitz,P.M. and Butler,M. (1993) J. Biol. Chem., 268, 25002504.
Jaenicke,R. and Rudolph,R. (1986) Methods Enzymol., 131, 218250.[Medline]
Jagath-Reddy,J., Rao,N.A., Savithri,H.S. (1996) Curr. Sci., 71, 710712.
Jones,S. and Thornton,J.M. (1995) Prog. Biophys. Mol. Biol., 63, 3165.[CrossRef][Web of Science][Medline]
Jones,S., Marin,A. and Thornton,J.M. (2000) Protein Eng., 13, 7782.
Klotz,I.M., Langerman,N.R. and Darnall,D.W. (1970) Annu. Rev. Biochem., 39, 2562.[CrossRef][Web of Science][Medline]
Klotz,I.M., Darnall,D.W.and Langerman,N.R. (1975) In Neurath,H. and Hill,R.L. (eds), The Proteins, Academic Press, New York, pp. 293411.
Knowles,J.R. (1991) Nature, 350, 121124.[CrossRef][Medline]
Kohl,L., Callens,M., Wierenga,R.K., Opperdoes,F.R. and Michels,P.A.M. (1994) Eur. J. Biochem., 220, 331338.[Web of Science][Medline]
Kornblatt,J.A., Kornblatt,M.J. and Hoa,G.H. (1995) Biochemistry, 34, 12181223.[CrossRef][Medline]
Kuntz,D.A., Osowski,R., Schudok,M., Wierenga,R.K., Muller,K., Kessler,H., Opperdoes,F.R. (1992) Eur. J. Biochem., 207, 441447.[Web of Science][Medline]
Lambeir,A.M., Opperdoes,F.R. and Wierenga,R.K. (1987) Eur. J. Biochem., 168, 6974.[Web of Science][Medline]
Lambeir,A.M., Backmann,J., Ruiz-Sanz,J., Filimonov,V., Nielsen,J.E., Kursula,I., Norledge,B.V. and Wierenga,R.K. (2000) Eur. J. Biochem., 267, 25162524.[Web of Science][Medline]
Lolis,E., Alber,T., Davenport,R.C., Rose,D., Hartman,F.C. and Petsko,G.A. (1990). Biochemistry, 29, 66096618.[CrossRef][Medline]
Maes,D. et al. (1999) Proteins, 37, 441453.[CrossRef][Web of Science][Medline]
Mainfroid,V., Mande,S.C., Hol,W.G., Martial,J.A. and Goraj,K. (1996a) Biochemistry, 35, 41104117.[CrossRef][Medline]
Mainfroid,V., Terpstra,P., Beauregard,M., Frere,J.M., Mande,S.C., Hol,W.G., Martial,J.A. and Goraj,K. (1996b) J. Mol. Biol., 257, 441456.[CrossRef][Web of Science][Medline]
McVittie,J.D., Esnouf,M.P. and Peacocke,A.R. (1977) Eur. J. Biochem., 81, 307315.[Web of Science][Medline]
Milla,M.E. and Sauer,R.T. (1995) Biochemistry, 34, 33443351.[CrossRef][Medline]
Morgan,C.J., Wilkins,D.K., Smith,L.J., Kawata,Y., Dobson,C.M. (2000) J. Mol. Biol., 300, 1116.[CrossRef][Web of Science][Medline]
Nordhoff,A., Bucheler,U.S., Werner,D. and Schirmer,R.H. (1993) Biochemistry, 32, 40604066.[CrossRef][Medline]
Ostoa-Saloma,P., Garza-Ramos,G., Ramirez,J., Becker,I., Berzunza,M., Landa,A., Gomez-Puyou,A., Tuena de Gomez-Puyou,M. and Perez-Montfort,R. (1997) Eur. J. Biochem., 244, 700705.[Web of Science][Medline]
Perez-Montfort,R., Garza-Ramos,G., Alcantara,G.H., Reyes-Vivas,H., Gao,X.G., Maldonado,E., de Gomez-Puyou,M.T. and Gomez-Puyou,A. (1999) Biochemistry, 38, 41144120.[CrossRef][Medline]
Petsko,G.A., Kenyon,G.L., Gerlt,J.A., Ringe,D. and Kozarich,J.W. (1993) Trends Biochem. Sci., 18, 372376.[CrossRef][Web of Science][Medline]
Plaut,B. and Knowles,J.R. (1972) Biochem. J., 129, 311320.[Web of Science][Medline]
Putman,S.J., Coulson,A.F., Farley,I.R., Riddleston,B. and Knowles,J.R. (1972) Biochem. J., 129, 301310.[Web of Science][Medline]
Rajarathnam,K., Sykes,B.D., Kay,C.M., Dewald,B., Geiser,T., Baggiolini,M. and Clark-Lewis,I. (1994) Science, 264, 9092.
Ranie,J., Kumar,V.P. and Balaram,H. (1993) Mol. Biochem. Parasitol., 61, 159169.[CrossRef][Web of Science][Medline]
Rentier-Delrue,F., Mande,S.C., Moyens,S., Terpstra,P., Mainfroid,V., Goraj,K., Lion,M., Hol,W.G. and Martial,J.A. (1993) J. Mol. Biol., 229, 8593.[CrossRef][Web of Science][Medline]
Richard,J.P. (1991) Biochemistry, 30, 45814585.[CrossRef][Medline]
Riddles,P.W., Blakeley,R.L., Zerner,B. (1983) Methods Enzymol., 91, 4960.[Web of Science][Medline]
Rietveld,A.W. and Ferreira,S.T. (1998) Biochemistry, 37, 933937.[CrossRef][Medline]
Sarkar,G. and Sommer,S.S. (1990) Biotechniques, 8, 404407.[Web of Science][Medline]
Schliebs,W., Thanki,N., Eritja,R. and Wierenga,R.K. (1996) Protein Sci., 5, 229239.[Web of Science][Medline]
Schliebs,W., Thanki,N., Jaenicke,R. and Wierenga,R.K. (1997) Biochemistry, 36, 96559662.[CrossRef][Medline]
Steif,C., Weber,P., Hinz,H.J., Flossdorf,J., Cesareni,G. and Kokkinidis,M. (1993) Biochemistry, 32, 38673876.[CrossRef][Medline]
Sun,A.Q., Yuksel,K.U. and Gracy,R.W. (1992) J. Biol. Chem., 267, 2016820174.
Sun,A.Q., Yuksel,K.U. and Gracy,R.W. (1995) Arch. Biochem. Biophys., 322, 361368.[CrossRef][Web of Science][Medline]
Thoma,R., Hennig,M., Sterner,R. and Kirschner,K. (2000) Structure, 8, 265276.[Medline]
Tsukuba,T., Sakai,H., Yamada,M., Maeda,H., Hori,H., Azuma,T., Akamine,A. and Yamamoto,K. (1996 ) J. Biochem. (Tokyo), 119, 126134.
Velanker,S.S., Ray,S.S., Gokhale,R.S., Suma,S., Balaram,H., Balaram,P. and Murthy,M.R.N. (1997) Structure, 5, 751761.[Medline]
West,S.M. and Price,N.C. (1988) Biochem. J., 251, 135139.[Web of Science][Medline]
Wierenga,R.K., Kalk,K.H. and Hol,W.G. (1987) J. Mol. Biol., 198, 109121.[CrossRef][Web of Science][Medline]
Wierenga,R.K., Noble,M.E., Postma,J.P., Groendijk,H., Kalk,K.H., Hol,W.G. and Opperdoes,F.R. (1991) Proteins, 10, 3349.
Yuksel,K.U., Sun,A.Q., Gracy,R.W. and Schnackerz,K.D. (1994) J. Biol. Chem., 269, 50055008.
Zabori,S., Rudolph,R. and Jaenicke,R. (1980) Z. Naturforsch., Teil C, 35, 9991004.
Zhang,Z., Sugio,S., Komives,E.A., Liu,K.D., Knowles,J.R., Petsko,G.A. and Ringe,D. (1994) Biochemistry, 33, 28302837.[CrossRef][Medline]
Received June 26, 2001; revised March 19, 2002; accepted April 3, 2002.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








