Protein Engineering, Vol. 15, No. 7, 585-593,
July 2002
© 2002 Oxford University Press
Improving the carboligase activity of benzoylformate decarboxylase from Pseudomonas putida by a combination of directed evolution and site-directed mutagenesis
1 Institut für Enzymtechnologie der Heinrich-Heine-Universität Düsseldorf, im Forschungszentrum Jülich, D-52426 Jülich, 3 Biochemisches Institut, Christian-Albrechts-Universität Kiel, D-24098 Kiel and 4 Institut für Biotechnologie 2, Forschungszentrum Jülich GmbH, D-52425 Jülich, Germany
| Abstract |
|---|
|
|
|---|
Benzoylformate decarboxylase (BFD) from Pseudomonas putida was subjected to directed molecular evolution to generate mutants with increased carboligase activity which is a side reaction of the enzyme. After a single round of random mutagenesis mutants were isolated which exhibited a 5-fold increased carboligase activity in aqueous buffer compared to the wild-type enzyme with a high enantiomeric excess of the product (S)-2-hydroxy-1-phenyl-propanone. From the same library, mutants with enhanced carboligase activity in water-miscible organic solvents have been isolated. The selected mutants have been characterized by sequencing, revealing that all mutants carry a mutation at Leu476, which is close to the active site but does not directly interact with the active center. BFD-L476Q has a 5-fold higher carboligase activity than the wild-type enzyme. L476 was subjected to saturation mutagenesis yielding eight different mutants with up to 5-fold increased carboligase activity. Surprisingly, all L476 mutants catalyze the formation of 2-hydroxy-1-phenyl-propanone with significantly higher enantioselectivity than the wild-type enzyme although enantioselectivity was not a selection parameter. Leu476 potentially plays the role of a gatekeeper of the active site of BFD, possibly by controlling the release of the product. The biocatalyst could be significantly improved for its side reaction, the CC bond formation and for application under conditions that are not optimized in nature.
Keywords: benzoylformate decarboxylase/directed evolution/organic solvents/random mutagenesis/ThDP/total activity
| Introduction |
|---|
|
|
|---|
The use of enzymes in bioorganic chemistry is now widely recognized as a versatile alternative to traditional organic chemistry (Azerad, 1995
Enzymes which catalyze CC bond formation such as aldolases, transketolases, oxynitrilases (Fessner and Walter, 1996
; Seoane, 2000
) and thiamin-diphosphate (ThDP)-dependent enzymes (Pohl, 1997
; Iding et al., 1998
; Schellenberger, 1998
; Schörken and Sprenger, 1998
; Sprenger and Pohl, 1999
; Ward and Baev, 2000
; Ward and Singh, 2000
) are of great importance in bioorganic chemistry.
ThDP-dependent benzoylformate decarboxylase (BFD, EC 4.1.1.7, accession no. J05293) from Pseudomonas putida is involved in the degradation of aromatic compounds of the mandelate catabolism (Gunsalus et al., 1953a
,b
; Stanier et al., 1953
). The BFD gene has been cloned (Tsou et al., 1990
) and the crystal structure solved (Hasson et al., 1998
). The main enzymatic reaction catalyzed by BFD is the non-oxidative decarboxylation of benzoylformate to benzaldehyde. Additionally the enzyme catalyzes the enantioselective formation of CC bonds (Wilcocks et al., 1992
) as a side reaction with yet unknown physiological role. Due to this carboligase activity BFD has recently been introduced as a catalyst for the enantioselective formation of (S)-2-hydroxy-1-phenylpropan-1-one [(S)-2-HPP; Figure 1
] from benzaldehyde and acetaldehyde (Iding et al., 2000
) as well as for the enantioselective formation of other asymmetric 2-hydroxy ketones (Dünnwald et al., 2000
), enantiomerically pure (R)-benzoin and benzoin derivatives (Demir et al., 1999
) starting from different donor and acceptor aldehydes. The main problem concerning the application of substituted benzaldehyde derivatives as adducts for the formation of 2-hydroxy ketones is the low solubility of many of these compounds in aqueous buffer solution. Therefore, a catalytic process in the presence of organic solvents is of interest to increase the solubility of the aldehyde substrates and to facilitate the recovery of products. However, enzymes which are optimized for biological systems often show low stability and catalytic activity in non-natural environments (Arnold, 1993
). In the case of BFD the wild-type enzyme is sufficiently stable in the presence of organic solvents, but the side reaction of the enzyme shall be synthetically used, which is characterized by a significantly lower catalytic activity than the main reaction. The use of enzymes in technical processes requires catalytic activities as high as possible for optimal productivity; therefore, BFD variants with enhanced carboligase activity in the presence of organic solvents would be useful biocatalysts.
|
Directed evolution has rapidly emerged to be the method of choice for the development and selection of mutated enzymes with improved properties (Bornscheuer and Pohl, 2001
Our goal was to obtain improved BFD muteins with enhanced carboligase activity in water-miscible organic solvents by directed evolution. We established a screening system in which the carboligase activity of the enzyme was monitored by a rapid colorimetric assay. Here we demonstrate that by using this system BFD mutants with increased carboligase activity in aqueous buffer and mutants with enhanced carboligase activity in water-miscible organic solvents were generated. In the highly active mutants, Leu476, which is not located in the active center of the enzyme, has been mutated.
Leu476 revealed to be a hot spot region for carboligase activity and has been investigated further by saturation mutagenesis which was shown to enhance the effectiveness of directed evolution (Miyazaki and Arnold, 1999
; Liebeton et al., 2000
). This approach resulted in muteins with different residues at this position with up to 5-fold increased carboligase activity and higher enantioselectivity compared to the BFD wild-type enzyme.
| Materials and methods |
|---|
|
|
|---|
Reagents
Chemicals used in this work were purchased from Fluka (Taufkirchen, Germany) or Sigma (Taufkirchen). Enzymes for recombinant DNA work were purchased from New England Biolabs (Schwalbach, Germany), Roche Molecular Biochemicals (Mannheim, Germany) or Gibco BRL (Karlsruhe, Germany). For affinity chromatography of BFD variants, Ni-NTA-agarose (Qiagen, Hilden, Germany) was used. Oligonucleotide primers were obtained from MWG Biotech (Ebersberg, Germany).
Generation of plasmid libraries of the BFD gene
The BFDHis gene was amplified by error-prone PCR (epPCR) in the presence of 0.2 mM dATP and 1 mM dGTP, dCTP, dTTP each, with 5 U Taq DNA polymerase (Gibco BRL, Karlsruhe, Germany) and varying concentrations of MgCl2 and MnCl2 (Table I
) to influence the fidelity of the Taq DNA polymerase. The plasmid pKK233-2/BFDHis (Iding et al., 2000
) was used as template and the oligonucleotides pKK233-2 for (5' CACACAGGAAACAGACCA-TGG 3') and pKK233-2 rev (5' TCCGCCAAAACAGCCAAGCTT 3') as 5'- and 3'-primers, which are complementary to the vector regions immediately flanking the NcoI and HindIII sites, respectively. The following amplification conditions were applied: step 1: 95°C, 1 min; step 2: 50°C, 1 min; step 3: 72°C, 1 min; step 4: 72°C, 5 min. Steps 13 were repeated 30 times. Each PCR reaction was digested with DpnI at 37°C for 2 h to remove methylated wild-type DNA. Fragments of 1.6 kb were isolated by extraction from an agarose gel, purified and digested with NcoI and HindIII at 37°C for 2 h. The digested fragments were purified and ligated into the NcoI and HindIII digested expression vector pKK233-2 (Clontech, Palo Alto CA, USA). The Escherichia coli strain SG13009/pREP4 (Qiagen) was transformed with one of the ligation mixtures each according to Inoue et al. (Inoue et al., 1990
), plated on LB agar plates containing 100 µg/ml ampicillin and 25 µg/ml neomycin and incubated at 37°C. A total of 4x102 independent clones of each PCR reaction were transferred into 96-well plates and screened for carboligase activity. A total of 4x103 independent clones of E.coli transformed with the ligation mixture of PCR condition 3 (Table I
: 1.5 mM MgCl2, 0.5 mM MnCl2) were transferred into 96-well plates. After 20 h growth at 37°C these masterplate cultures were stored with 10% glycerol at 80°C.
|
Construction of BFDHis variants with single amino acid exchanges
The two mutants with a single amino acid exchange corresponding to each of the two amino acid substitutions found in BFD-S181T-L476PHis were constructed. The plasmid DNA pKK233-2/BFD-S181T-L476PHis was digested with NcoI and NheI and the 920 bp fragment carrying the mutation TCA
ACA (S181T) was ligated into the NcoI/NheI digested vector pKK233-2/BFDHis lacking the corresponding fragment, leading to the single mutant plasmid pKK233-2/BFD-S181THis. The plasmid DNA pKK233-2/BFD-S181T-L476PHis was further digested with NheI and HindIII and the 670 bp fragment carrying the mutation CTG
CCG (L476P) was ligated into the NheI/HindIII digested vector pKK233-2/BFDHis lacking the respective fragment yielding the single mutant BFD-L476PHis. The resulting vectors pKK233-2/BFD-S181THis and pKK233-2/BFD-L476PHis were transformed into E.coli SG 13009/pREP4 cells.
Saturation mutagenesis
Saturation mutagenesis was performed as described for site-directed mutagenesis with the Quick Change XL kit (Stratagene, La Jolla, CA, USA). The L476 (codon 14261428) degenerated saturation mutagenesis primers were: 476satmut1 for (5'GCAGAAAACGTTCCTGGGWDSGATGTGCCAGGGATCG 3') and 476satmut1 rev (5'CGATCC-CTGGCACATCSDWCCCAGGAACGTTTTCTGC 3') as well as 476satmut2 for (5'GCAGAAAACGTTCCTGGGSNSGATGTGCCAGGGATCG 3') and 476satmut2 rev (5'CGATCCCTGGCACATCSNSCCCAGGAACGTTTTCTGC 3'). The plasmid pKK233-2 including the wild-type BFDHis (wtBFDHis) gene was amplified in a PCR reaction (step 1: 95°C, 30 s; step 2: 55°C, 30 s; step 3: 68°C, 15 min; 18 cycles) and the parental DNA template was digested with DpnI. The mutated plasmids (annealed double-stranded nicked DNA molecules) were transformed into XL10-Gold E.coli cells, which are able to repair nicks in plasmids (Stratagene) and plated on LB agar plates containing 100 µg/ml ampicillin. Transformed E.coli XL 10-Gold cells were pooled, plasmid DNA was prepared and transformed into competent E.coli SG 13009/pREP4 cells (Qiagen) which were plated on LB agar plates containing 100 µg/ml ampicillin and 25 µg/ml neomycin. A total of 2x103 independent clones were transferred into 96-well plates. Masterplate cultures were grown at 37°C and then stored with 10% glycerol at 80°C.
Selection of variants with BFD activity and stability in organic solvents
For screening, masterplates were replicated into 96-well plates containing 100 µl LB medium with 100 µg/ml ampicillin and 25 µg/ml neomycin and incubated for 20 h at 37°C. A total of 40 µl of each culture was then transferred into 96-deep-well plates containing 1.2 ml LB medium with 100 µg/ml ampicillin and 25 µg/ml neomycin. After incubation at 37°C for 4 h, protein expression was induced by the addition of 1 mM isopropyl-ß-D-thiogalactoside (IPTG). The plates were incubated at 37°C for 16 h. Cells were harvested by centrifugation for 15 min at room temperature at 4000 r.p.m. (Rotina 35R Hettich, Tuttlingen, Germany). The cell pellets were dispersed in 100 µl potassium phosphate buffer (50 mM, pH 7.0) containing ThDP (0.5 mM) and MgSO4 (2.5 mM), cell lysis was achieved by the addition of 1 mg/ml lysozyme and incubation at 30°C for 30 min on a shaker. A 50 µl aliquot of each crude extract was then transferred into two fresh 96-well plates, respectively, and 50 µl of 2-fold substrate solution in potassium phosphate buffer (50 mM, pH 7.0) containing 0.5 mM ThDP, 2.5 mM MgSO4, 80 mM benzaldehyde, 1 M acetaldehyde and either 3 or 7.2 M ethanol was added to the crude extract of each clone. The reaction mixture was incubated at 30°C for 4 h. Afterwards, the 96-well plates were centrifuged (15 min, 4000 r.p.m., room temperature) and 100 µl of supernatant was transferred into fresh 96-well plates and assayed for the accumulation of 2-HPP with a colorimetric assay (Breuer et al., manuscript submitted). To each well containing 100 µl supernatant of the reaction mixture 10 µl of 3 M NaOH and then 10 µl of 0.4% 2,3,5,-triphenyltetrazolium chloride (Figure 2
) in methanol were added and the formation of the red formazan dye was monitored by measuring the absorbance at 510 nm using a THERMOmax plus plate reader (Molecular Devices, Sunnyvale, CA, USA). The time of the development of the red color was taken as an indicator for the amount of 2-HPP in the mixture. The relation of activities in 1.5 and 3.6 M ethanol was taken as an indicator of activity in the presence of ethanol.
|
Expression and purification of selected BFDHis variants
Expression and purification of wtBFDHis and BFDHis variants was performed as described for PDC (Pohl et al., 1998
) using potassium phosphate buffer (50 mM, pH 7.0) for Ni-NTA chromatography and potassium phosphate buffer (50 mM, pH 6.0), containing ThDP (0.5 mM) and MgSO4 (2.5 mM) as elution buffer for the subsequent gel chromatography. Lyophilized BFDHis muteins stored at 20°C were stable for several months.
Protein determination
Determination of protein concentration was performed according to Bradford (Bradford, 1976
) using BSA for calibration.
Enzymatic synthesis in buffer and analysis of 2-HPP
To measure initial carboligase activities 1050 µg purified wtBFDHis or BFDHis mutein were incubated in 0.5 ml of 50 mM KPi, pH 7.0, containing 0.5 mM ThDP, 2.5 mM MgSO4 in the presence of 20, 40 or 60 mM benzaldehyde and 500 mM acetaldehyde for 30 min at 30°C. After heat inactivation of the enzymes, the resulting 2-HPP formed was measured using an analytical HPLC system (Gynkotek, Germering, Germany) with an ultraviolet monitor (263 nm). Separation was performed on a C18-Hypersil column (C&S, Langerwehe, Germany) using 0.5%/20% acetic acid/acetonitrile (v/v) as eluent. The flow rate was 1.1 ml/min. The retention time for 2-HPP was 12.8 min. The enantiomeric excess (ee) of 2-HPP was investigated by chiral-phase HPLC. The reaction mixtures were extracted with trichloromethane (1:1) and phases were separated by centrifugation (13 000 r.p.m.). Chiral-phase HPLC was performed on a Chiralcel OB (Daicel, Düsseldorf, Germany) using i-hexane/isopropanol 95:5 as eluent and a flow rate of 0.75 ml/min. The retention time for (S)-2-HPP was 20.6 min and for (R)-2-HPP 44.4 min.
Enzymatic synthesis of 2-HPP in the presence of organic solvents
The activity of wtBFDHis and BFDHis muteins in the presence of organic solvents was studied by incubating 20100 µg/ml purified enzyme in 50 mM KPi, pH 7.0, containing 0.5 mM ThDP, 2.5 mM MgSO4, 20, 40 or 60 mM benzaldehyde, 500 mM acetaldehyde and 1.5 or 3.6 M ethanol or varying concentrations of DMSO (1050%) for 30 min at 30°C. After heat inactivation of the enzymes, the 2-HPP formed was measured as described above.
Stability of carboligase activity in the presence of organic solvents
The stability of wtBFDHis and selected BFDHis muteins in the presence of organic solvents was investigated by incubating 50300 µg/ml purified enzyme in 50 mM KPi, pH 7.0 with 0.5 mM ThDP, 2.5 mM MgSO4 with or without addition of 1.5 M ethanol or 20% (v/v) DMSO, respectively. The incubations were carried out at 25°C. The carboligase activity of the enzymes was measured over 10 days. At different time intervals aliquots were removed from each incubation mixture and assayed for carboligase activity as described above.
Assay of decarboxylase activity
The decarboxylation of benzoylformate was studied using a coupled enzymatic test as described elsewhere (Iding et al., 2000
).
Kinetic measurements were taken at 30°C on a THERMOmax plus microtiterplate reader (Molecular Devices). Initial enzymatic activities were measured in the range of 0.0360 mM benzoylformate. The assay mixture was prepared from the following stock solutions prepared in potassium phosphate buffer (50 mM, pH 6.0) containing ThDP (0.5 mM) and MgSO4 (2.5 mM): benzoylformate solution (20 µl, 10-fold concentrated ranging from 0.06 to 120 mM, adjusted to pH 6.0), NADH (20 µl, 3.5 mM), horse liver alcohol dehydrogenase (HLADH, 10 µl, 2 U) and potassium phosphate buffer (50 µl, 50 mM, pH 6.0, 0.5 mM ThDP, 2.5 mM MgSO4). The components were mixed in a 96-well microplate, incubated at 30°C, and the reaction was started by the addition of BFD solution (100 µl, 0.025 U). The descending curve was examined at 340 nm and the linear slope was calculated from 0 to 90 s. Km, Vmax and Ki values were calculated by a non-linear fitting of the hyperbolic curves according to MichaelisMenten. One unit is defined as the amount of enzyme that catalyzes the decarboxylation of 1 µmol benzoylformate per minute at pH 6.0 and 30°C.
Stability of cofactor binding
The stability of cofactor binding by the holoenzymes was studied by incubating 0.1 mg/ml wtBFDHis or mutant BFDHis in 50 mM KPi, pH 6.5 or pH 8.0, without cofactors for 24 h. To follow the time course of inactivation, 50 µl samples were removed and decarboxylation activity was determined with the photometric assay. To measure residual activity, cofactors were omitted from the assay buffer.
Computer graphic studies
The structural models of the different mutations were constructed on the basis of the reported crystal structure of native BFD (Hasson et al., 1998
), using the programs WHATIF and Ribbons (Carson, 1991
) running on a Silicon Graphics workstation.
| Results and discussion |
|---|
|
|
|---|
Expression of protein and construction of the BFDHis random mutagenesis library
For the molecular evolution of BFD, the gene from P.putida was cloned with a hexahistidine (His) tag into a pKK 233-2 expression vector (Qiagen) that allows high expression levels in the E.coli strain SG 13009, the one-step purification of the enzyme via the His tag and the simple cloning of BFD libraries into the vector due to the presence of flanking NcoI and HindIII restriction sites which are not included in the BFD gene. The one-step purification of wtBFDHis yielded protein that is sim;95% pure (Iding et al., 2000
). The affinity tag does not interfere with the activity of the protein (Iding et al., 2000
).
The libraries were constructed by epPCR (Leung et al., 1989
; Cadwell and Joyce, 1992
; Zhao et al., 1998
). The PCR conditions for random mutagenesis were optimized to introduce a limited number of base substitutions into the BFD gene. The effects of several factors decreasing the fidelity of Taq DNA polymerase were examined as alteration of the MgCl2 concentration (1.5 or 7 mM), addition of MnCl2 (0 or 0.5 mM) and an imbalance of the deoxynucleotide pool (Table I
). The PCR was carried out under four sets of conditions and the PCR products were cloned and transformed into E.coli SG13009. A total of 4x102 independent clones of each library were tested for carboligation activity. The libraries showed between 4 and 74% inactive clones. Since the mutation frequency should not be too high to enable detection of optimized mutants (Kuchner and Arnold, 1997
), the library which showed 53% inactive clones was choosen for screening. Sequencing of several clones from these library revealed one to four nucleotide exchanges in the 1.6 kb BFD gene.
Development of a screening system
A total of 4.2x103 independent clones from this library were grown in deep-well microtiterplates; protein expression was induced by the addition of IPTG. The cells were harvested by centrifugation and lysis of the cells was carried out by incubation with lysozyme. The crude extracts were incubated with benzaldehyde and acetaldehyde as substrates for carboligation and the formation of 2-hydroxy ketones was monitored by a colorimetric assay using 2,3,5-triphenyltetrazolium chloride (Figure 2
), which is reduced by 2-hydroxy ketones leading to a red formazane dye (Breuer et al., manuscript submitted). Tetrazolium salt based reagents are described for detecting acyloins after paper chromatography (Touchstone, 1992
). The time of the development of the red color is a measure for the amount of 2-hydroxy ketones, here 2-HPP, formed by the BFD catalysis. The substrates benzaldehyde and acetaldehyde as well as the by-product acetoin do not interfere with this reaction.
Screening of the BFDHis mutant library for mutants with enhanced carboligase activity in water-miscible organic solvents
The random mutagenesis library was screened for carboligase activity in the presence of 1.5 M ethanol using the colorimetric assay. Approximately 50% of the mutant clones from the library showed measurable carboligase activity. Those clones were rescreened for residual carboligase activity in the presence of 3.6 M ethanol. The screening conditions were selected as follows: crude extract of wtBFDHis was incubated with substrate solution containing different concentrations of ethanol. The addition of 1.5 M ethanol was choosen for measuring initial activity (Ai) since wtBFDHis crude extract showed the same activity in the presence of 1.5 M ethanol as in buffer without ethanol. In the presence of 3.6 M ethanol the activity of wtBFD is decreasd to 20%. The relation of residual activity (Ar) and initial activity (Ai) was taken as an indicator for high carboligase activity in the presence of ethanol (Figure 3
). Clones with high carboligase activity in buffer and clones with >50% residual activity in the presence of 3.6 M ethanol were examined further.
|
Characterization of selected mutants
Sequence analysis. Clones 22H6, 22G1, 23C8 and 23E11 (Table IIa
) were subjected to DNA sequencing to determine the amino acid substitutions that had been introduced into these clones. They contain between two and four nucleotides exchanges (Table IIa
). One position has been mutagenized in three of four clones: Leu 476 to Gln (twice) or Pro (once). The clones 22H6, 22G1 and 23C8 were expressed in E.coli SG13009 and purified as described for wtBFDHis. To characterize the effects of the amino acid exchanges of the double mutant BFD-S181T-L476PHis (23C8) the two single mutants corresponding to each of the amino acid subtitutions were constructed, over-expressed and purified by Ni-chelat affinity chromatography.
|
Characterization of the carboligase activity of the wtBFDHis
The purified wtBFDHis enzyme is sufficiently stable in the presence of water-miscible organic solvents since it retains full activity after 10 days incubation in aqueous EtOH (1.5 M) or DMSO (20%, v/v) at 25°C (data not shown). The stability of wtBFDHis in water-miscible organic solvents at 25°C was examined in buffer, buffer containing 1.5 M ethanol or buffer containing 20% (v/v) DMSO. At different time intervals aliquots were removed from each incubation mixture and assayed for residual carboligation activity under standard conditions.
The initial rate velocities for the synthesis of 2-HPP were determined with 500 mM acetaldehyde and different benzaldehyde concentrations in buffer as well as in the presence of aqueous EtOH or DMSO (Table IIIa
). In aqueous buffer benzaldehyde concentrations >40 mM are not soluble. Higher benzaldehyde concentrations lead to a decrease of the initial reaction velocity which might be interpreted in terms of enzyme inactivation (Table IIIa
). The Km value for benzaldehyde was calculated to be higher than the maximal solubility of benzaldehyde in buffer (Dünnwald et al., 2000
). This means that the catalytic activity of wtBFDHis is limited by the low solubility of the substrate. In the presence of organic solvents such as 1.5 M EtOH or 20% DMSO 60 mM benzaldehyde can be dissolved resulting in an increased reaction velocity. Compared to the reaction in buffer, 1.5 M EtOH decreased the activity to sim;40%, whereas DMSO had no significant effect on the carboligase activity of the purified wtBFDHis.
|
Carboligase activity of selected BFDHis variants
We examined the carboligase activity of the purified BFDHis muteins 22G1, 22H6, 23C8 yielded by random mutagenesis as well as of the single mutants BFD-S181THis and BFD-L476PHis cloned from the double mutant 23C8. The initial rate velocities for the synthesis of 2-hydroxypropiophenone in buffer and in the presence of organic solvents were determined with 500 mM acetaldehyde and different concentrations of benzaldehyde (Table IIIb
).
Both L476Q mutants (22G1 and 22H6; Table II
) showed a sim;4-fold higher carboligase activity in aqueous buffer compared to the wild-type enzyme (Table IIIb
) with a slight decrease in activity in the presence of 60 mM benzaldehyde. Addition of 1.5 M ethanol to the L476Q variants resulted in a 3040% decrease of activity compared to their activity in buffer. In contrast, in the presence of 20% (v/v) DMSO the activity of the L476Q variants increased slightly compared to their activity in buffer. In the presence of DMSO the carboligase activity increased with increasing benzaldehyde concentrations up to 60 mM.
Both L476P mutants (single mutant L476P and 23C8; Table II
) revealed lower carboligase activity than the wtBFDHis in buffer, whereas these variants gained 80% of their activity in the presence of 1.5 M ethanol and showed a prominent 23-fold increase of carboligase activity in the presence of 20% (v/v) DMSO with an additional increase of activity at 60 mM benzaldehyde (Table IIIb
). The single mutant S181T showed the same activity like the wtBFDHis in aqueous buffer as well as in the presence of 1.5 M ethanol or 20% (v/v) DMSO (Table IIIb
) indicating that the L476 exchange was responsible for the effects on the carboligase activity of the variants derived by random mutagenesis.
Like wtBFDHis, all enzymes retain full carboligase activity after 10 days incubation in buffer containing 1.5 M ethanol or 20% (v/v) DMSO (data not shown). Mutant BFD-L476QHis was investigated for the pH and temperature optima of the carboligase reaction. The pH optimum for the carboligation of benzaldehyde and acetaldehyde to yield (S)-2-HPP was determined to pH
8.0 (data not shown) as for the wild-type BFD (Iding et al., 2000
). The highest carboligase activity of both enzymes, the wtBFDHis and the L476Q variant, was observed at 40°C, but the wild-type enzyme revealed a higher residual activity at 60°C reaction temperature compared to the L476 Q variant (data not shown).
Saturation mutagenesis at position L476
Due to the low mutation rate used during generation of the BFD mutant library not all of the remaining 19 amino acids could be introduced at each position because introduction of certain amino acids would require two or three base substitutions per codon. As a sensitive position in the protein that is important for improving the enzymes side reaction has been identified, saturation mutagenesis was applied to position L476 to introduce different amino acids. This method was shown to be a valuable completion to directed evolution (Miyazaki and Arnold, 1999
). Site-directed mutagenesis with two sets of degenerative PCR primers was carried out yielding a library of 2000 independent clones which were screened for carboligase activity. More than 50% of the library showed very high carboligase activity, so that crude extracts had to be diluted with buffer in order to measure in the linear range of the colorimetric assay, indicating that this position is quite important for carboligase activity. Assuming that all 19 amino acid substitutions had been generated by the saturation mutagenesis the library was assayed for activity in the presence of 1.5 and 3.6 M ethanol. Nineteen clones showing carboligase activity well above the wild-type level were further characterized. DNA sequencing of these clones revealed nine different mutations (Table IIb
), some were found several times. Except for the L476M substitution, multiple base exchanges were required for these replacements. Seven of the nine new muteins resulted in non-conservative substitutions.
Role of BFD position 476 in carboligase activity
The nine different L476 variants obtained by saturation mutagenesis and screened for high carboligase activity were purified and characterized. The expression levels of the BFD variants were the same as for the wild-type enzyme with sim;1015% of recombinant enzyme among the total soluble cell protein. All variants showed significantly higher carboligase activity compared to wtBFDHis in buffer as well as in the presence of water-miscible organic solvents (Table IIIc
). For most variants the reaction velocity in the presence of organic solvents was found to be proportional to the benzaldehyde concentration applied due to the increased solubility and distribution of the substrate. The tested organic solvents did not only influence the solubility of the substrate benzaldehyde but showed intrinsic effects on the enzymes. The addition of 1.5 M ethanol slightly decreased the carboligase activity of the BFD variants, but all L476 mutants showed higher residual activity in the presence of 1.5 M ethanol than the wtBFDHis or variant S181T (Table IIIa and b
). This means that the stability of the variants towards inactivation by ethanol is enhanced compared to the wildtype. Interestingly, all variants are more active in the presence of 20% (v/v) DMSO compared to their activity in buffer at a given benzaldehyde concentration. This was found especially for variants with hydrophobic (P, A, G) or basic (K, H) residues at position 476. Inactivation as well as stimulation of enzyme activity at low concentrations of organic solvents is described in the literature (Singh and Wang, 1979
; Guagliardi et al., 1989
; Kudryashova et al., 1997
; Gladilin and Levashov, 1998
; Blackwood and Bucke, 2000
), but very little is known about the effects of such solvents on the catalytic and structural properties of these enzymes.
Recently, a variant of subtilisin E from Bacillus subtilis was created to be more active in organic solvents such as DMF (Takagi et al., 2000
). In this subtilisin mutant two charged surface residues were substituted by uncharged Cys residues. You and Arnold (You and Arnold, 1994
) applied directed evolution on subtilisin E from B.subtilis to enhance total activity in aqueous DMSO which resulted in a variant with 157-fold enhanced activity over the parent in 60% (v/v) DMSO.
Stability of BFD variants in the presence of organic solvents
Like the BFD wild-type the BFD variants derived from saturation mutagenesis were investigated for stability in aqueous buffer, buffer containing 1.5 M ethanol or 20% (v/v) DMSO (data not shown). After 10 days incubation all variants retained full activity, demonstrating that the mutations that enhance catalytic activity have no significant effect on the enzyme stability. You and Arnold (You and Arnold, 1994
) obtained similar results for subtilisin E from B.subtilis. Mutations enhancing the catalytic activity occur without changes in stability indicating that both properties are not coupled.
Enantioselectivity of the carboligation reaction
The enantioselectivity of wtBFDHis and variants concerning the synthesis of (S)-2-HPP and the influence of the water-miscible organic solvents on the enantioselectivity for the reaction was investigated. In a previous paper we reported that for the wtBFDHis the enantioselectivity of (S)-2-HPP formation was found to be a function of temperature and benzaldehyde concentration (Iding et al., 2000
) showing decreasing ee of (S)-2-HPP with increasing temperature and benzaldehyde concentration. Under the given reaction conditions (500 mM acetaldehyde, 20, 40 or 60 mM benzaldehyde, 30°C reaction temperature) wtBFDHis showed slightly decreasing enantioselectivity with increasing benzaldehyde concentrations ranging from 85 to 81% ee (Table IVa
). All BFD variants with an amino acid exchange at position L476 revealed significantly higher enantioselectivity (Table IVb and c
) compared to the wtBFDHis with ee values from 92 to 97%. For most of the BFD variants a slight decrease in enantioselectivity with increasing benzaldehyde concentration was demonstrated as well. Only variant S181T showed ee values in the range of the wild-type enzyme with 8684%, strongly indicating that the exchange at position L476 is responsible for the improved enantioselectivity. A recent publication describes similar results from a lipase from Pseudomonas aeruginosa, where the flexibility of certain loop structures which are located far from the stereocenter of the substrate influence enantioselectivity (Liebeton et al., 2000
). Addition of either ethanol or DMSO to the reaction mixture did not influence the enantioselectivity of all BFDHis variants as well as the wtBFDHis (Table IVac
).
Thus, with all L476 muteins an improvement of enantioselectivity under reaction conditions that are useful in technical applications, e.g. 30°C reaction temperature or high benzaldehyde concentration, could be achieved, although enantioselectivity was not a selection parameter for screening of the random mutagenesis library.
Role of position 476 in the decarboxylation reaction
The decarboxylation of aromatic 2-keto acids is the main reaction of BFD which was not monitored during the screening of the libraries. To test the influence of the mutation of position L476 on the main reaction of BFD, the decarboxylation of benzoylformate, was investigated with the muteins derived from random and saturation mutagenesis (Table V
). Decarboxylase activity of muteins with exchanges in position 476 decreases in the series: S > K > L (wild type) > T > Q > H > M > C > A > G > P. This is not associated with significant changes of the Km value for the substrate benzoylformate. The decarboxylase activity of the wtBFDHis is inhibited by high concentrations of the substrate benzoylformate with a Ki value of sim;143 mM. This effect was enhanced by most of the mutations up to a Ki value of 45 mM for the mutein L476P.
|
Investigation of the ratio of decarboxylase versus carboligation activity revealed a preference of the carboligase side reaction over the main reaction for all variants (Table V
Stability of cofactor binding
For ThDP- and Mg2+-dependent decarboxylases the addition of the cofactors to the reaction buffer is necessary because the cofactors are non-covalently bound (Pohl, 1997
). We studied the cofactor binding in the wtBFDHis and the mutant enzymes by incubating the holoenzymes in cofactor-free buffer and determined the time course of inactivation by measuring the residual decarboxylation activity over 24 h (Table V
). wtBFDHis and S181T showed no loss of activity in cofactor-free buffer over 24 h. Variants L476M, L476S, L476Q and L476T showed a decrease of activity of sim;40% over 24 h, whereas variants L476A, L476G, L476C, L476P, L476K and L476H are rapidly inactivated in cofactor-free buffer with a t1/2 lower than 10 min (Table V
), indicating that the residue at position 476 influenced binding of the cofactors significantly. Decarboxylase activity of all variants could be restored by the addition of ThDP and magnesium ions to the reaction mixture (data not shown).
Computer graphic studies
Based on the crystal structure of BFD (Hasson et al., 1998
) the structural position of Leu476 was investigated. The quaternary structure of the enzyme is a homotetramer. Each monomer consists of three domains
, ß and
. The cofactor ThDP is bound at a dimer interface with the binding site formed by the
-domain of one monomer and the
-domain of another. The BFD tetramer can be described as a dimer of dimers with four active sites. Figure 4
gives a partial view on the active site at the interface between two monomers. The analysis showed that Leu476 is part of a loop on the surface of one monomer located near the active center cavity. The start and endpoint of the loop are two glycine residues (456 and 480), which may function as hinges. This loop covers the active center like a lid forming an hydrophobic cavity (Figure 4
). Residues Gly459 to Gly466 form an
-helix which is directly involved in cofactor binding (Hasson et al., 1998
). Residues Val467 to Phe483 are involved in contacts between monomers in the dimer. Residues Val473 and Leu476 of one monomer and Lys32 of the other monomer build a hydrophobic network. Polar or basic residues at position 476 could weaken the hydrophobic interaction between the two monomers. Thus, a faster entry of substrates in or a faster exit of product out of the active center could be possible because the lid is not locked firmly. This could also explain the rapid loss of cofactors of most L476 mutants (Table V
). Dordick (Dordick, 1992
) mentioned one approach to increase the flexibility of the active site by increasing active site polarity. This is confirmed by a study with subtilisin BNP' (Dordick, 1992
) indicating that increased polarity in the active site of the enzyme could improve catalytic activity in organic solvents with and without the addition of water. Exchange of Leu476 by other hydrophobic residues could maintain the hydrophobic network.
|
A direct interaction of L476 and L461 is possible, which could be influenced by the exchange at position L476. The residue L461 could probably support the V conformation of the cofactor ThDP which is energetically unfavorable, but is common among the ThDP-dependent enzymes. Guo et al. (Guo et al., 1998
Conclusions
BFD is a useful catalyst for organic synthesis, particularly for the enantioselective formation of
-hydroxy ketones. The productivity of the enzyme is limited by the solubility of the aromatic aldehyde substrates in aqueous buffers. With a combination of random and saturation mutagenesis we succeeded in enhancing the carboligase activity of BFD, which is a side reaction of the enzyme of hitherto unknown physiological function. Random mutagenesis showed that L476 plays an important role in the carboligase activity of BFD. Saturation mutagenesis at this position resulted in 10 variants with up to 5-fold enhanced carboligase activity, which were activated by a low concentration of DMSO. The improvement of activity had no deleterious effect on the enantioselectivity of the variants, since the L476 variants showed higher enantioselectivity than the wild type under conditions that are useful for synthetic application. There is excellent potential for improving a side reaction of an enzyme because it is not optimized by nature itself. As shown by Chen et al. (Chen et al., 1991
), additive effects of single amino acid substitutions that increase activity and stability of an enzyme will lead to further improvements in the future.
|
| Notes |
|---|
5 Present address: MPB Cologne GmbH, Neurather Ring 1, D-51063 Köln, Germany
2 To whom correspondence should be addressed. E-mail: b.lingen{at}fz-juelich.de ![]()
| Acknowledgments |
|---|
We gratefully acknowledge Michael Müller for his editorial support and for discussions. The skilful technical assistance of Katharina Range is gratefully acknowledged. This work was supported by the Deutsche Forschungsgemeinschaft in the scope of SFB 380.
| References |
|---|
|
|
|---|
Arjunan,P., Umland,T., Dyda,F., Swaminathan,S., Furey,W., Sax,M., Farrenkopf,B., Gao,Y., Zhang,D. and Jordan,F. (1996) J. Mol. Biol., 256, 590600.[CrossRef][Web of Science][Medline]
Arnold,F.H (1993) Curr. Opin. Biotechnol., 4, 450455.[CrossRef][Medline]
Azerad,R. (1995) Bull. Soc. Chim. Fr., 132, 1751.
Blackwood,A.D.and Bucke,C. (2000) Enzyme Microb. Technol., 27, 704708.[CrossRef][Web of Science][Medline]
Bornscheuer,U.T. and Pohl,M. (2001) Curr. Opin. Chem. Biol., 5, 137143.[CrossRef][Web of Science][Medline]
Bradford,M.M. (1976) Anal. Biochem., 72, 248254.[CrossRef][Web of Science][Medline]
Breuer,M., Pohl,M., Hauer,B., Lingen,B. (2002) Annal. Bioanal. Chem., submitted.
Cadwell,R.C. and Joyce,G.F. (1992) PCR Methods Appl., 2, 2833.[Medline]
Carson,M. (1991) J. Appl. Crystallogr., 24, 946950.[CrossRef]
Chen,K.Q. and Arnold,F.H. (1991) Biotechnology, 9, 10731077.[CrossRef][Medline]
Chen,K., Robinson,A.C., Van Dam,M.E., Martinez,P., Economou,C. and Arnold,F.-H. (1991) Biotechnol. Prog., 7, 125129.[CrossRef][Medline]
Demir,A.S., Dünnwald,T., Iding,H., Pohl,M. and Müller M. (1999) Tetrahedron Asymm., 10, 47694774.[CrossRef]
Dordick,J.S. (1992) Biotechnol. Prog., 8, 259267.[CrossRef][Medline]
Dünnwald,T., Demir,A.S., Siegert,P., Pohl,M. and Müller,M. (2000) Eur. J. Org. Chem., 21612170.
Economou,C., Chen,K. and Arnold,F.H. (1992) Biotechnol. Bioeng., 39, 658662.[CrossRef]
Faber,K. (1997) Biotransformations in Organic Chemistry. Springer, Berlin, Heidelberg, New York.
Fessner,W. and Walter,C. (1996) Topics Curr. Chem., 184, 97194.
Giver,L., Gershonen,A., Freskgard,P.O. and Arnold,F.H. (1998) Proc. Natl. Acad. Sci. USA, 95, 1280912813.
Gladilin,A.K. and Levashov,A.V. (1998) Biochemistry, 63, 345356.[Medline]
Guagliardi,A., Manco,G., Rossi,M. and Bartolucci,S. (1989) Eur. J. Biochem., 183, 2530.[Web of Science][Medline]
Gunsalus,I.C., Gunsalus,C.F. and Stanier,R.Y. (1953a) J. Bacteriol., 66, 538542.
Gunsalus,C.F., Stanier,R.Y. and Gunsalus,I.C. (1953b) J. Bacteriol., 66, 548553.
Guo,F., Zhang,D., Kahyaoglu,A., Farid,R.S. and Jordan,F. (1998) Biochemistry, 37, 1337913379.[CrossRef][Medline]
Hasson,M.S., Muscate,A., McLeish,M.J., Polovnikova,L.S., Gerlt,J.A., Kenyon,G.L., Petsko,G.A. and Ringe,D. (1998) Biochemistry, 28, 99189930.
Iding,H., Siegert,P., Mesch,K. and Pohl,M. (1998) Biochim. Biophys. Acta, 1385, 307322.[CrossRef][Medline]
Iding,H., Dünnwald,T., Greiner,L., Liese,A., Müller,M., Siegert,P., Grötzinger,J., Demir,A.S. and Pohl,M. (2000) Chemistry, 6, 14831495.[CrossRef][Web of Science][Medline]
Inoue,H., Nojima,H. and Okayama,H. (1990) Gene, 6, 2328.
Koeller,K.M. and Wong,C.H. (2001) Nature, 409, 232240.[CrossRef][Medline]
Kuchner,O. and Arnold,F.H. (1997) Trends Biotechnol., 15, 523530.[CrossRef][Web of Science][Medline]
Kudryashova,E.V., Gladilin,A.K., Vakurov,A.V., Heitz,F., Levashov,A.V. and Mozhaev,V.V. (1997) Biotechnol. Bioeng., 55, 267277.[CrossRef]
Leung,D.W., Chen,E. and Goeddel,D.V. (1989) BioTechnique, 1, 1115.
Liebeton,K., Zonta,A., Schimossek,K., Nardini,M., Lang,D., Dijkstra,B.W., Reetz,M.T. and Jaeger,K.-E. (2000) Chem. Biol., 7, 709718.[CrossRef][Web of Science][Medline]
Matsumura,I. and Ellington ,A.D. (2001) J. Mol. Biol., 305, 331339.[CrossRef][Web of Science][Medline]
May,O., Nguyen,P.T. and Arnold,F.H. (2000) Nat. Biotechnol., 18, 317320.[CrossRef][Web of Science][Medline]
Miyazaki,K. and Arnold ,F.H. (1999) J. Mol. Evol., 49, 716720.[CrossRef][Web of Science][Medline]
Moore,J.C. and Arnold,F.H. (1996) Nature Biotechnol., 14, 458467.[CrossRef][Web of Science][Medline]
Patel,R.N. (2000) In Patel,R.N. (ed.), Stereoselective Biocatalysis. Marcel Dekker, New York.
Pohl,M. (1997) Adv. Biochem. Eng. Biotechnol., 58, 1543.[Medline]
Pohl,M., Siegert,P., Mesch,K., Bruhn,H. and Grötzinger,J. (1998) Eur. J. Biochem., 257, 538546.[Web of Science][Medline]
Roberts,S.M. (1998) J. Chem. Soc., Perkin Trans., 1, 157169.
Schellenberger,A. (1998) Biochim. Biophys. Acta, 1385, 177186.[CrossRef][Medline]
Schörken,U. and Sprenger,G.A. (1998) Biochim. Biophys. Acta, 1385, 229243.[CrossRef][Medline]
Schulze,B. and Wubbolts,M.G. (1999) Curr. Opin. Biotechnol., 10, 609615.[CrossRef][Web of Science][Medline]
Seoane,G. (2000) Curr. Org. Chem., 4, 283304.
Sergienko,E.A. and Jordan,F. (2001) Biochemistry, 40, 73697381.[Medline]
Singh,T.J. and Wang,J.H. (1979) J. Biol. Chem., 254, 84668472.
Song,J.K. and Rhee,J.S. (2001) Biochim. Biophys. Acta, 1547, 370378.[CrossRef][Medline]
Sprenger,G.A. and Pohl,M. (1999) J. Mol. Catal. B: Enzymatic, 6, 145159.
Stanier,R.Y., Gunsalus,I.C. and Gunsalus,C.F. (1953) J. Bacteriol., 66, 543547.
Takagi,H., Hirai,K., Maeda,Y., Matsuzawa,H. and Nakamori,S. (2000) J. Biochem., 127, 617625.
Touchstone,J.C. (1992) Practice of Thin Layer Chromatography. John Wiley & Sons, New York.
Tsou,A.Y., Ransom,S.C., Gerlt,J.A., Buechter,D.D., Babbitt,P.C. and Kenyon,G.L. (1990) Biochemistry, 29, 98569867.[CrossRef][Medline]
Ward,O.P. and Baev,M. (2000) Decarboxylases in stereoselective catalysis. In Patel,R.N. (ed.), Stereoselective Biocatalysis. Marcel Dekker, New York, pp. 267287.
Ward,O.P. and Singh,A. (2000) Curr. Opin. Biotechnol., 11, 520526.[CrossRef][Web of Science][Medline]
Wilcocks,R., Ward,O.P., Collins,S., Dewdney,N.J., Hong,Y. and Prosen,E. (1992) Appl. Environ. Microbiol., 58, 16991704.
You,L. and Arnold,F.H. (1994) Protein Eng., 9, 7383.
Zhao,H., Giver,L., Shao,Z., Affholter,J.A. and Arnold,F.H. (1998) Nature Biotechnol., 16, 258261.[CrossRef][Web of Science][Medline]
Received November 30, 2001; revised March 15, 2002; accepted March 22, 2002.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
H. Henning, C. Leggewie, M. Pohl, M. Muller, T. Eggert, and K.-E. Jaeger Identification of Novel Benzoylformate Decarboxylases by Growth Selection Appl. Envir. Microbiol., December 1, 2006; 72(12): 7510 - 7517. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Siegert, M. J. McLeish, M. Baumann, H. Iding, M. M. Kneen, G. L. Kenyon, and M. Pohl Exchanging the substrate specificities of pyruvate decarboxylase from Zymomonas mobilis and benzoylformate decarboxylase from Pseudomonas putida Protein Eng. Des. Sel., July 1, 2005; 18(7): 345 - 357. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Geddie and I. Matsumura Rapid Evolution of {beta}-Glucuronidase Specificity by Saturation Mutagenesis of an Active Site Loop J. Biol. Chem., June 18, 2004; 279(25): 26462 - 26468. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Neylon Chemical and biochemical strategies for the randomization of protein encoding DNA sequences: library construction methods for directed evolution Nucleic Acids Res., February 27, 2004; 32(4): 1448 - 1459. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







