Protein Engineering vol. 16 no. 12 pp. 1063-1069, 2003
© 2003 Oxford University Press
Dissection of the structural determinants involved in formation of the dimeric form of D-amino acid oxidase from Rhodotorula gracilis: role of the size of the ßF5ßF6 loop
Department of Structural and Functional Biology, University of Insubria, Via J. H. Dunant, 3, 21100 Varese, Italy
1 To whom correspondence should be addressed. e-mail: luciano.piubelli{at}uninsubria.it
| Abstract |
|---|
|
|
|---|
The role of the long loop connecting ß-strands F5 and F6 (21 amino acids, Pro302LeuAspArgThrLysSerProLeuSerLeuGlyArgGlySerAlaArgAlaAlaLysGlu322) present in Rhodotorula gracilis D-amino acid oxidase (RgDAAO) was investigated by site-directed mutagenesis. This loop was proposed to play an important role in the head-to-tail monomermonomer interaction of this dimeric flavoenzyme: in particular, by means of electrostatic interactions between positively charged residues of the ßF5ßF6 loop of one monomer and negatively charged residues belonging to the
-helices I3' and I3'' of the other monomer. We produced a mutant of RgDAAO (namely, DAAO
LOOP2), in which only minor structural perturbations were introduced (only five amino acids were deleted; new sequence of the ßF5ßF6 loop is Pro302LeuAspArgThrLeuGlyArgGlySerAlaArgAlaAlaLysGlu317), and the charge of the ßF5ßF6 loop not modified. The
LOOP2 mutant is monomeric, has a weaker binding with the FAD cofactor, a decrease of the kinetic efficiency, and slight modifications in its spectral properties. The short version of the loop does not allow a correct monomermonomer interaction, and its presence in the monomeric DAAO is a destabilizing structural element since the
LOOP2 mutant is highly susceptible to proteolysis. These results, confirming the role of this loop in the subunits interaction and thus in stabilization of the sole dimeric form of RgDAAO, put forward the evidence that even a short deletion of the loop generates a consistent variation of the enzyme structurefunction properties.
Keywords: flavoprotein/oligomerization state/rational design/structural stability
| Introduction |
|---|
|
|
|---|
The enzyme D-amino acid oxidase (DAAO, EC 1.4.3.3) is a flavoprotein containing as a coenzyme a non-covalently bound molecule of FAD per 40 kDa protein monomer. It catalyzes the dehydrogenation of D-amino acids to the corresponding imino acids, which spontaneously hydrolyze to
-keto acids and NH4+. The reduced FAD cofactor is then reoxidized by molecular oxygen to yield hydrogen peroxide. A wealth of kinetic and structural studies has been carried out on the enzyme purified from pig kidney (pkDAAO) and on that purified from the yeast Rhodotorula gracilis (RgDAAO) (for a recent review see Pilone, 2000
DAAO is a component of the glutathione reductase (GR) family, the most thoroughly studied FAD-containing family. The protein members of this populous class catalyze diverse reactions and all of them adopt the Rossmann fold (Rossmann et al., 1974
). In particular, DAAO belongs to the second subfamily, GR2, members of which align well only in their N-terminus (
30 residues) (Dym and Eisenberg, 2001
). Flavoproteins are often multisubunit proteins constituted either by identical or by different polypeptide chains, but only few members of this class underwent a detailed protein engineering investigation to correlate the monomermonomer interaction and the enzyme functionality, e.g. the dimeric flavoprotein disulphide oxidoreductases and DAAO (Perham et al., 1996
; Pollegioni et al., 2003
). The renewed interest in the evolution of oligomeric proteins is also connected to the investigation of the biological and biotechnological significance of the oligomerization (for a review see DAlessio, 1999
). In fact, while the multimeric organization is frequently linked to the enzyme function, less is known of the role of the stable interaction between identical subunits. Following the resolution of the 3D structures of pkDAAO and RgDAAO, two different dimerization modes were proposed for the two enzymes (Mattevi et al., 1996
; Umhau et al., 2000
). In the head-to-tail monomer orientation of RgDAAO (the mode of dimerization resulting in the largest buried area, 3049 Å2), an important role has been proposed for a long loop (21 amino acid residues, from Pro302 to Glu322) connecting ß-strands F5 and F6 (ßF5ßF6 loop, Figure 1A) (Pollegioni et al., 2002
). In particular, electrostatic interactions between positively charged residues of the ßF5ßF6 loop of one monomer (namely, Arg314, Arg318 and Lys321) and negatively charged residues belonging to the
-helices I3' and I3'' (namely, Asp269, Glu273 and Glu276) of the other monomer could play an important role in the stabilization of the dimer (Pollegioni et al., 2002
). The presence of this long loop is a peculiar structural characteristic of RgDAAO; it is not conserved in pkDAAO and indeed a head-to-head mode of dimerization (different from that of RgDAAO and characterized by a lower buried surface area, 1512 Å2) has been proposed for the mammalian enzyme (Mattevi et al., 1996
).
|
By site-directed mutagenesis of RgDAAO, a mutant enzyme (DAAO
LOOP), lacking the main part of the ßF5ßF6 loop (14 amino acid residues, from Ser308 to Lys321, Figures 1B and 2), was obtained as a stable monomeric holoenzyme in solution (Piubelli et al., 2002
LOOP mutant retains the FAD cofactor and shows only slight modifications in its spectral and kinetic properties. Thermodynamic studies performed on monomeric and dimeric RgDAAO forms showed that the shift to such a monomeric form anyway resulted in an enzyme more sensitive to thermal denaturation (Pollegioni et al., 2003
|
Here, a second deleted mutant of RgDAAO (namely, DAAO
LOOP2), in which only minor structural perturbations were introduced and the charge of the ßF5ßF6 loop not modified, was designed, produced and characterized. The ultimate aim was to identify the effect of the different structural determinants on RgDAAO, in particular to evaluate the effect of the length of the loop on the structure, functionality and dimeric state of this flavoenzyme. | Materials and methods |
|---|
|
|
|---|
Design and modeling of DAAO
LOOP2 mutant
The model of the DAAO
LOOP2 mutant was built using the SWISS MODEL automated protein modeling server (Peitsch, 1996
) on the basis of the amino acid sequence of the designed mutant and the 3D coordinates of the wild-type RgDAAO (PDB code: 1c0p) (Umhau et al., 2000
). The conformation of the altered loop was refined using the software package Swiss-PDBViewer, both by minimizing the energy as computed by partial implementation of the GROMOS force field and by scanning a database of experimentally determined loop structures (Guex and Peitsch, 1997
; URL: http://www.expasy.ch/spdbv).
Mutagenesis, enzyme expression and purification, and spectral characterization
The DNA was manipulated essentially as described in Sambrook et al. (Sambrook et al., 1989
). The RgDAAO gene containing the desired mutation was generated by site-directed mutagenesis using the Altered Sites® II kit (Promega) and the cDNA coding for the wild-type RgDAAO subcloned in the pAlterTM vector as template (Molla et al., 2000
) and the mutation introduced using the following 54mer mutagenic oligonucleotide: CGGATCGTCCTGCCTCTCGACCGGAC ACTCGGCAGGGGCAGCGCACGAGCGGCG. Restriction analysis and DNA sequencing confirmed the presence of the desired deletion. Using the EcoRI restriction site, the mutant cDNA was subcloned into the expression vector pT7.7A and the resulting plasmid (pT7
LOOP2) used to transform the BL21(DE3)pLysS Escherichia coli expression strain. The recombinant enzyme was purified by a procedure similar to that reported in Molla et al. (Molla et al., 1998
) and Piubelli et al. (Piubelli et al., 2002
). We performed gel-permeation chromatography using a Superdex 200 column in an ÄKTA system. The column was equilibrated with 50 mM potassium phosphate, pH 8, 0.15 M NaCl, 10% (v/v) glycerol, 0.3 mM EDTA. The purified enzyme was then concentrated in an Amicon apparatus and desalted using a PD10 column (Amersham Biosciences) equilibrated in 50 mM potassium phosphate, pH 7.5, 10% (v/v) glycerol and 2 mM EDTA. We determined the molecular mass under native conditions by gel-permeation chromatography (see above); a calibration curve was set up using dextran blue (Mr = 2 000 000) and the following standard proteins: cytochrome c (Mr = 12 400), chimotrypsinogen (Mr = 25 000), ovalbumin (Mr = 45 000), bovine serum albumin (Mr = 66 000) and ß-amylase (Mr = 200 000). The N-terminal sequence was determined using an automated protein sequencer (Procise 492 Protein Sequencer; Applied Biosystems). The extinction coefficient for the oxidized mutant DAAO was determined by measuring the change in absorbance after release of the flavin by heat denaturation (an extinction coefficient of 11 300 M1 cm1 at 450 nm for free FAD was used). The apoprotein form of the DAAO
LOOP mutant was obtained by dialysis in the presence of a chaotropic agent, as described in Casalin et al. (Casalin et al., 1991
).
Stability of DAAO forms in E.coli cells soluble extract
The effect of E.coli crude extract on wild-type and mutant DAAOs was determined by western blot analysis following the incubation of purified DAAO samples with E.coli crude extract (in a total protein:DAAO ratio
1000:1, w/w). Protein samples (containing 0.25 µg of DAAO) withdrawn at different times of incubation were diluted in the sample buffer for SDSPAGE, boiled for 3 min, and loaded on a 12% (w/v) polyacrylamide gel. Proteins were then transferred electrophoretically to a nitrocellulose membrane (ImmobilonTM-NC; Millipore). DAAO forms were detected by immunostaining using rabbit anti-DAAO polyclonal antibodies and visualized using anti-(rabbit IgG) Ig conjugate to alkaline phosphatase and 5-bromo-4-chloro-3-indolyl phosphate and nitro-blue-tetrazolium chloride as dye (Molla et al., 1998
; Piubelli et al., 2002
).
Determination of the isoelectric point under non-denaturing conditions
Isoelectrofocusing was carried out in a flat bed apparatus, FBE-3000 (Amersham Biosciences), using a 6% (w/v) polyacrylamide gel slab containing 2.5% (v/v) of both Pharmalyte® 58 and Pharmalyte® 310 (Amersham Biosciences). As anodic solution 1 M H3PO4 was used and as cathodic solution 1 M NaOH. The gel was stained for DAAO activity with 100 mM potassium phosphate, pH 8.5, containing 80 mM D-alanine, 0.5 mM iodonitrotetrazolium violet, in the absence or in the presence of 0.01 mM FAD.
Activity assay
DAAO activity was assayed with an oxygen electrode at 25°C as described in Molla et al. (Molla et al., 1998
), using 28 mM D-alanine as substrate. One DAAO unit corresponds to the amount of enzyme that converts 1 µmol of D-alanine per minute.
Thermal and pH stability
To investigate the thermal stability of the DAAO
LOOP, temperature-ramp experiments were performed in a Jasco FP-750 spectrofluorometer, equipped with a software-driven Peltier system (Pollegioni et al., 2003
). The heating rate was 0.5°C/min. Fixed wavelength measurements were taken using emission wavelengths of 340 and 526 nm, and excitation wavelengths of 298 and 455 nm for tryptophan and flavin fluorescence, respectively (a 10 nm emission and excitation bandwidth was used). Enzyme (0.1 mg/ml,
2.5 µM) was in 50 mM potassium phosphate, pH 7.5, 10% (v/v) glycerol and 2 mM EDTA. For pH stability, 0.6 µM DAAO was incubated at 25°C in 15 mM TrisHCl, 15 mM Na2CO3, 15 mM H3PO4 and 250 mM KCl, adjusted to the desired pH value. The time course of the residual activity was determined by means of the polarographic assay method as described above.
Limited proteolysis experiments
DAAO
LOOP (0.33 mg/ml) was incubated at 25°C in 100 mM sodium pyrophosphate, pH 8, with 10% (w/w) trypsin. For electrophoretic analysis, protein samples (7 µg of DAAO) taken at different times after the addition of trypsin were diluted in the sample buffer for SDSPAGE, boiled for 3 min and then loaded on a 12% (w/v) polyacrylamide gel. Gels were stained with Coomassie Blue R-250 and the intensities of the protein bands were determined by densitometric analysis using Kodak 1D 3.5 software. To determine the time course of enzyme inactivation, the residual DAAO activity on protein samples withdrawn at different times of incubation was measured by the polarographic method described above (
0.3 µg of DAAO/assay). The kinetics of inactivation and of protein fragment formation and degradation were determined by fit of the experimental data to a single exponential decay equation using KaleidaGraphTM (Synergy Software).
| Results |
|---|
|
|
|---|
Design and production of DAAO
LOOP2 mutant
The deletion mutant was designed following the same procedure adopted for DAAO
LOOP, described in detail in Piubelli et al. (Piubelli et al., 2002
). In the case of the
LOOP mutant a substantial part of the ßF5ßF6 loop, including three positively charged amino acid residues, was removed. Instead, the new DAAO mutant was designed to eliminate a shorter part of this loop: the sequence removed (Lys307Ser308Pro309Leu310Ser311, Figure 2) belongs to the N-terminal end of the ßF5ßF6 loop and does not include any of the positively charged amino acid residues involved in the electrostatic interactions between RgDAAO monomers (Pollegioni et al., 2003
). A model of this mutant (see Materials and methods), named DAAO
LOOP2, shows only minor structural modification in the loop region (Figure 1B).
The DAAO
LOOP2 mutant protein was produced using the strain BL21(DE3)pLysS E.coli as host, transformed with the pT7
LOOP2 expression plasmid. As in the previously expressed recombinant wild-type and
LOOP DAAOs, the cloning procedure resulted in a fusion protein, since six additional residues (MetAlaArgIleArgLeu) are added at the N-terminus of the protein before the first methionine (Molla et al., 1998
). The presence of this short peptide was demonstrated not to alter the overall properties of the wild-type RgDAAO (Molla et al., 1998
). The highest expression level of the
LOOP2 mutant DAAO is obtained by cultivating cells at 37°C, inducing the protein expression at an A600
0.8, and then cultivating them at 25°C for an additional 67 h (data not shown). Growing the cells at a higher temperature after the induction results in the precipitation of part of the expressed protein as insoluble cellular aggregates (data not shown).
The DAAO
LOOP2 was not purified using the same procedure established for the
LOOP mutant (Piubelli et al., 2002
) since it is eluted in multiple peaks (at different NaCl concentrations) on cation exchange chromatography on the Source 15S column. An activity assay performed in the absence and in the presence of exogenous FAD shows that part of the
LOOP2 protein elutes in the apoprotein form, thus resulting in a very low purification yield (
10%). Thus, after anion exchange separation on a DEAESepharose column, and instead of cation exchange chromatography, the
LOOP2 mutant was purified through gel-permeation chromatography on a Superdex 200 column. The mutant DAAO elutes in a single broad peak with an elution volume corresponding to a molecular mass of 40.1 ± 6.6 kDa (the theoretical molecular mass calculated on the basis of the amino acid sequence is 40 174 Da) and thus in a monomeric state. However, SDSPAGE analysis of the purified DAAO mutant shows two protein bands (apparent molecular mass of 40.1 and
34 kDa), both recognized by the anti-DAAO polyclonal antibodies in western blot analysis: the band at lower electrophoretic mobility is approximately 2.5 times more intense than the other one. Furthermore, the isolectrofocusing analysis of the
LOOP2 mutant preparation carried out under native conditions also shows two bands with pIs of 7.45 and 7.7; the basic band is more intense than the acidic one (pIs of wild-type and
LOOP DAAOs determined under the same experimental conditions were 7.9 and 6.7, respectively) (Piubelli et al., 2002
). Both DAAO protein bands are active, also in the absence of exogenous FAD. N-terminal sequences of these two protein forms present in the DAAO
LOOP2 preparation, determined by Edman degradation, are identical to that of the wild-type DAAO (starting from Ala5, and thus showing the absence of the starting methionine).
Taken together, these results suggest that the
34 kDa
LOOP2 polypeptide originates from a proteolytic event in the C-terminal region of the
LOOP2 protein. Previous limited proteolysis experiments carried out on wild-type and
LOOP DAAOs demonstrated that the Arg318-Ala319 bond belonging to the ßF5ßF6 loop is sensitive to tryptic cleavage (Pollegioni et al., 1995
; Piubelli et al., 2002
). The ßF5ßF6 loop region is still present in the DAAO
LOOP2, and it should be still highly flexible and exposed to solvent, also because of the monomeric state of the mutant enzyme. This loop includes three positively charged amino acid residues (Arg314, Arg318 and Lys321, according to the wild-type DAAO numbering), the main target of proteolysis. Deletion of the C-terminal part of the protein starting from the ßF5ßF6 region (approximately 5055 amino acid residues) should result in an enzyme form with a 6.0 kDa decrease in molecular mass with respect to the entire
LOOP2 mutant (a value close to the difference observed by SDSPAGE between the two protein forms) and at a more acidic pI. Thus, we propose that in vivo a proteolytic event removes a basic segment by cleavage of a peptide bond of the ßF5ßF6 loop region, which is exposed to the solvent and highly flexible in the
LOOP2 DAAO mutant.
In order to verify this hypothesis, a fixed amount of purified wild-type,
LOOP, and
LOOP2 DAAOs were incubated under the same experimental conditions with the crude extract of E.coli cells strain BL21(DE3)pLysS. Samples were withdrawn at different times and analysed by western blotting (Figure 3). After 30 min of incubation, >50% of the 40.1 kDa
LOOP2 mutant was converted into a
34 kDa form and the conversion was complete in
1 h (Figure 3C). Interestingly, wild-type DAAO is also converted to a shorter,
34 kDa form (Pollegioni et al., 1995
), although the reaction is very slow: after 15 h of incubation, a small amount of full-length enzyme is still present (Figure 3A). In contrast, the
LOOP DAAO mutant is fully resistant to proteolytic cleavage (Figure 3B).
|
The conclusion that the
34 kDa
LOOP2 form is due to proteolysis is further supported by the observation that purification of this mutant under controlled conditions (i.e. at low temperature and in the presence of 2 mM PMSF and 0.7 µg/ml pepstatin A) results in the isolation of the sole 40.1 kDa form (with a purity
90%, as judged by SDSPAGE). Determination of the molecular weight by MALDI-TOF mass spectroscopy of the
LOOP2 preparations obtained using the two different purification conditions shows the presence of a protein of 40 167 Da in both cases (which is in good agreement with the theoretical molecular mass of
LOOP2 mutant, i.e. 40 174 Da) and a large amount of a polypeptide of 34 300 Da, though only in the preparation isolated under less controlled conditions. This latter value is in agreement with the mass of the Ala5Arg310 polypeptide fragment originating from a proteolytic cleavage at the level of Arg310 in the
LOOP2 DAAO mutant (corresponding to Arg314 in the wild-type enzyme) (see Figure 2).
Gel-permeation chromatography carried out at different protein concentrations (between 0.6 and 36 mg/ml) shows that the monomeric state of the
LOOP2 DAAO mutant is not dependent on the protein concentration in the range tested, as already observed for the wild-type and
LOOP DAAOs (Pilone, 2000
; Piubelli et al., 2002
).
Spectral properties, FAD binding and steady-state kinetics
The purified DAAO
LOOP2 mutant retains the binding of the FAD coenzyme, as confirmed by the absorption spectrum in the visible region, which is typical of a FAD-containing protein. The extinction coefficient of the mutant at 455 nm is 11 900 M1 cm1, an intermediate value between that of the wild-type (12 600 M1 cm1) and that of the
LOOP DAAOs (11 300 M1 cm1) (Molla et al., 1998
; Piubelli et al., 2002
). Significant changes are evident in the visible absorption spectrum, in particular the decrease in the intensity of the band at 380 nm and the bathochromic shift of the 455 nm peak to 449 nm: these spectral alterations are indicative of small modifications of the microenvironment surrounding the isoalloxazine moiety of the FAD molecule (data not shown). The binding constant for the coenzyme was determined by titrating the apoprotein with increasing amounts of FAD and by monitoring the reconstitution following the quenching of the protein fluorescence at 342 nm (Casalin et al., 1991
): a 5-fold higher Kd value of the apoproteinFAD complex than that of wild-type RgDAAO was determined, a value similar to that measured for DAAO
LOOP (Table I).
|
A circular dichroism (CD) spectrum in the near-UV region of the
LOOP2 protein could be superimposed on that of the DAAO
LOOP mutant and was thus different from that of wild-type (see figure 2 in Pollegioni et al., 2003
LOOP mutant with respect to the wild-type DAAO was explained as the consequence of an increased exposure of the residue Trp243 which, in each subunit, is placed in strict contact with the corresponding residue in the other subunit at the dimer interface (Pollegioni et al., 2003
The apparent steady-state kinetic parameters were determined using D-alanine (the most frequently used DAAO substrate) and D-tryptophan (in order to evaluate whether the mutation affects the ability of the mutant to accommodate a substrate with a bulky side chain) as substrates at a fixed (21%) oxygen concentration. The Vmax and Km values determined on D-tryptophan are similar to those determined for DAAO
LOOP, whereas smaller values for the kinetic parameters are determined using D-alanine as substrate (Table I). On both substrates, the monomeric mutant DAAOs are less active than the wild-type one.
pH and thermal stability
No significant differences regarding the pH stability are found between the wild-type and the
LOOP2 DAAOs in the pH range 58. However, by increasing the pH above 8.5, the stability of the monomeric enzyme significantly decreased (data not shown). Thermal denaturation of DAAO
LOOP2 was monitored by temperature-ramp measurements, following an increase in either FAD or tryptophan fluorescence. In the first case, the two monomeric DAAO mutants show a similar increase in flavin fluorescence and
5°C lower Tm values than the dimeric wild-type DAAO (Figure 4A). When the temperature-induced loss of the tertiary structure was monitored by following the increase in Trp fluorescence, the
LOOP2 DAAO shows a behavior that is between those of wild-type and
LOOP DAAOs (Figure 4B). These data show that the loss of the tertiary structure elements and of the flavin cofactor occurs at lower temperatures in the two monomeric mutants than in the dimeric wild-type DAAO, confirming the stabilizing effect of the dimerization.
|
Limited proteolysis
One of the most interesting features of the
LOOP2 mutant seems to be its increased susceptibility to proteolytic cleavage compared with wild-type and
LOOP DAAO forms. In the ßF5ßF6 loop region, three peptide bonds are possible targets for trypsin cleavage: Arg305Thr306, Arg314Gly315 and Arg318Ala319 (numbering according to DAAO wild-type). In the wild-type DAAO, limited proteolysis removed the fragment between Thr306 and Arg318, at an observed rate constant of 0.2 min1 (Pollegioni et al., 1995
). In the DAAO
LOOP mutant, only the Arg305Thr306 bond is still present; both the cleavage (at a rate constant of
0.006 min1) and the subsequent total degradation of the proteolyzed enzyme form occurred slowly (Piubelli et al., 2002
). SDSPAGE analysis of the time course of trypsinolysis of the
LOOP2 mutant under the same experimental conditions used for wild-type and
LOOP DAAOs, shows that the 40.1 kDa
LOOP2 enzyme is rapidly converted to a form of
34 kDa (>95% in <1 min, Figure 5). This latter form is then completely degraded in
4 h, without any further detectable intermediates: densitometric analysis of the gel shows that the observed rate constant of degradation of this
34 kDa form is 0.028 min1. Such a value is significantly higher than those determined for wild-type and
LOOP DAAOs (Piubelli et al., 2002
). The activity loss of
LOOP2 is monophasic [similar to that observed with
LOOP mutant (Piubelli et al., 2002
), whereas the activity loss of wild-type DAAO was biphasic (Pollegioni et al., 1995
)], and with an apparent rate constant of
0.02 min1, thus corresponding to the degradation of the
34 kDa form. A correspondence between the rate of enzyme inactivation and that of degradation of the
34 kDa form was also observed for the
LOOP mutant (see table 2 in Piubelli et al., 2002
). The rapid degradation of the full-length mutant form is due to the cleavage at the level of the susceptible bonds in the ßF5ßF6 loop still present in the
LOOP2 mutant: the structural model of the monomeric DAAO
LOOP2 shows that Arg310, as well as Arg314, is fully exposed to solvent (Figure 1C).
|
| Discussion |
|---|
|
|
|---|
More than 20 years ago site-directed mutagenesis was first used to modify the active site of an enzyme of known structure and mechanism. Since then, this method has contributed far-reaching insights into catalysis, specificity, stability and folding of proteins (Brannigan and Wilkinson, 2002
LOOP2 mutant, have lost the optimal orientation required to interact with their negative counterparts on the other monomer or that the electrostatic interaction is not sufficient to stabilize the dimeric enzyme form. Some of the properties of the
LOOP2 mutant are identical to those of the
LOOP protein (e.g. the Kd for FAD and the near-UV CD spectrum), whereas other properties are somewhere between those of the wild-type and those of
LOOP DAAOs (e.g. the absorption spectrum and the thermal stability).
A main feature of the DAAO
LOOP2 is represented by its extreme susceptibility to proteolytic cleavage. Clearly, this observation suggests that the remaining part of the ßF5ßF6 loop in the
LOOP2 mutant is exposed to the solvent and highly flexible and thus it is readily susceptible to proteolytic attack (in particular at the level of Arg310 of
LOOP2 sequence), even during the purification procedure (see Figure 3). Limited proteolysis is known to occur exclusively at hinges and fringes regions (Neurath, 1980
): preferential sites of proteolysis are characterized by enhanced flexibility or local unfolding (Fontana et al., 1986
, 1997
; Hubbard, 1998
). Therefore, limited proteolysis is a powerful tool to identify flexible surface loops. The resolution of the 3D structure of dimeric RgDAAO shows that the B-factor is remarkably high in the long loop connecting ßF5 and ßF6 (Umhau et al., 2000
; Pollegioni et al., 2002
) indicating that part of the loop is very flexible, in particular the Ala317Lys321 region. Limited proteolysis experiments on
LOOP2 DAAO indicate that the flexibility of the remaining part of the ßF5ßF6 loop is further increased following the deletion. The ßF5ßF6 loop can be considered a destabilizing structural element in the monomeric form: in fact, when its interaction with the other DAAO subunit is lost, the resulting protein form is highly sensitive to proteolytic cleavage and denaturation. A similar effect is not observed in the
LOOP mutant, in which a large part of the loop (14 out the 21 residues) has been eliminated, therefore demonstrating that it is not due to the different oligomeric state of the mutant and wild-type DAAO. This result is in perfect agreement with that recently observed following the thermal denaturation of wild-type and
LOOP DAAO forms in the presence and in the absence of thiocyanate (see figure 9 in Pollegioni et al., 2003
). In fact, the denaturation of the monomeric wild-type DAAO obtained by thiocyanate treatment (and with no alteration in the ßF5ßF6 loop protein sequence) is observed at a lower temperature than that of the monomeric
LOOP mutant (lacking 14 residues in the ßF5ßF6 loop), pointing to specific modification(s) of DAAO tertiary structure induced by the lipophilic ion.
The second structural element fundamental for the protein stabilization is represented by the coenzyme binding: temperature-ramp experiments demonstrated that the flavin release triggers the protein denaturation (Pollegioni et al., 2003
) and limited proteolysis experiments highlighted the looser conformation (and higher susceptibility to proteolysis) of the apoprotein form (Pollegioni et al., 1995
). Instead, the loss of the dimeric state does not significantly alter the coenzyme binding, thus supporting the hypothesis of independence of the two structural determinants on protein stability.
In conclusion, these results further confirm that the dimeric aggregation state in yeast DAAO, a member of the GR2 subfamily of FAD-containing protein (Dym and Eisenberg, 2001
), is not required for the FAD binding or the catalytic competence of the enzyme, but it plays an important role in protein stability (versus denaturant agents and proteolysis). Correct conformation and the whole length of the ßF5ßF6 loop are required in order to obtain a stable monomermonomer interaction. The presence in the protein of a shorter form of this loop, as in the one produced here, does not enable dimer formation, although the positively charged residues are still present. In any case, our results do not rule out the option that the electrostatic interactions could play a pivotal role in dimerization, since the conversion to a monomeric state in the
LOOP2 mutant DAAO could also be as a result of an alteration in the correct positioning of charged residues required in order to stabilize the interactions between monomers.
| Acknowledgements |
|---|
We thank Dr Gennaro Ferranti for the mass spectrometry determinations and Dr Stefania Iametti for CD measurements. This work was supported by grants from Italian MURST to M.S.P. (Prot 2002057751), from Fondo di Eccellenza 2001, University of Insubria, to M.S.P., and from FAR 2001 to L.P. and FAR 2002 to M.S.P.
| References |
|---|
|
|
|---|
Brannigan,J.A. and Wilkinson,A.J. (2002) Nat. Rev. Mol. Cell Biol., 3, 964970.[CrossRef][Web of Science][Medline]
Casalin,P., Pollegioni,L., Curti,B. and Pilone,M.S. (1991) Eur. J. Biochem., 197, 513517.[Web of Science][Medline]
DAlessio,G. (1999) Prog. Biophys. Mol. Biol., 72, 271298.[CrossRef][Web of Science][Medline]
Dym,O. and Eisenberg,D. (2001) Protein Sci., 10, 17121728.[CrossRef][Web of Science][Medline]
Fontana,A., Fascina,G., Vita,C., Dalzoppo,D., Zamai,M. and Zambonin,M. (1986) Biochemistry, 25, 18471851.[CrossRef][Medline]
Fontana,A., Zambonin,M., Polverino de Laureto,P., De Filippis,V., Clementi,A. and Scaramella,E. (1997) J. Mol. Biol., 266, 223230.[CrossRef][Web of Science][Medline]
Guex,N. and Peitsch,M.C. (1997) Electrophoresis, 18, 27142723.[CrossRef][Web of Science][Medline]
Hubbard,S.J. (1998) Biochim. Biophys. Acta, 1382, 191206.[CrossRef][Medline]
Mattevi,A., Vanoni,M.A., Todone,F., Rizzi,M., Teplyakov,A., Coda,A., Bolognesi,M. and Curti,B. (1996) Proc. Natl Acad. Sci. USA, 93, 74967501.
Molla,G., Vegezzi,C., Pilone,M.S. and Pollegioni,L. (1998) Protein Expr. Purif., 14, 289294.[CrossRef][Web of Science][Medline]
Molla,G., Porrini,D., Job.,V., Motteran,L., Vegezzi,C., Campaner,S., Pilone,M.S. and Pollegioni,L. (2000) J. Biol. Chem., 275, 2471524721.
Neurath,H. (1980) In Jaenicke,R. (ed.), Protein Folding. Elsevier, North Holland, pp. 501504.
Peitsch,M.C. (1996) Biochem. Soc. Trans, 24, 274279.[Web of Science][Medline]
Perham,R.N., Leistler,B., Solomon,R.G. and Guptasarma,P. (1996) Biochem. Soc. Trans, 24, 6166.[Web of Science][Medline]
Pilone,M.S. (2000) Cell. Mol. Life Sci., 57, 17321747.[CrossRef][Web of Science][Medline]
Piubelli,L., Caldinelli,L., Molla,G., Pilone,M.S. and Pollegioni,L. (2002) FEBS Lett., 526, 4348.[CrossRef][Web of Science][Medline]
Pollegioni,L., Ceciliani,F., Curti,B., Ronchi,S. and Pilone,M.S. (1995) Biochem. J., 310, 577583.
Pollegioni,L., Diederichs,K., Molla,G., Umhau,S., Welte,W., Ghisla,S. and Pilone,M.S. (2002) J. Mol. Biol., 324, 535546.[CrossRef][Web of Science][Medline]
Pollegioni,L., Iametti,S., Fessas,D., Caldinelli,L., Piubelli,L., Barbiroli,A., Pilone,M.S. and Bonomi,F. (2003) Protein Sci., 12, 10181029.[CrossRef][Web of Science][Medline]
Regan,L. (1999) Curr. Opin. Struct. Biol., 9, 494499.[CrossRef][Web of Science][Medline]
Rossmann,M.G., Moras,D. and Olsen,K.W. (1974) Nature, 250, 194199.[CrossRef][Medline]
Sambrook,J., Fritsch,E.P. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Umhau,S., Pollegioni,L., Molla,G., Diederichs,K., Welte,W., Pilone,M.S. and Ghisla,S. (2000) Proc. Natl Acad. Sci. USA, 97, 1246312468.
Received July 9, 2003; revised September 28, 2003; accepted October 21, 2003
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
L. Caldinelli, S. Iametti, A. Barbiroli, F. Bonomi, L. Piubelli, P. Ferranti, G. Picariello, M. S. Pilone, and L. Pollegioni Unfolding Intermediate in the Peroxisomal Flavoprotein D-Amino Acid Oxidase J. Biol. Chem., July 2, 2004; 279(27): 28426 - 28434. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sacchi, E. Rosini, G. Molla, M. S. Pilone, and L. Pollegioni Modulating D-amino acid oxidase substrate specificity: production of an enzyme for analytical determination of all D-amino acids by directed evolution Protein Eng. Des. Sel., June 1, 2004; 17(6): 517 - 525. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





