Skip Navigation

This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ge, X.
Right arrow Articles by Cao, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ge, X.
Right arrow Articles by Cao, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Protein Engineering vol. 16 no. 6 pp. 387-390, 2003
© 2003 Oxford University Press

Preliminary study on the structural basis of the antifungal activity of a rice lipid transfer protein

Xiaochun Ge1, Jichao Chen, Chongrong Sun and Kaiming Cao

Department of Biochemistry and Molecular Biology, School of Life Sciences, Fudan University, Shanghai 200433, China

1 To whom correspondence should be addressed. e-mail: gexiaochun1{at}yahoo.com.cn

Keywords: antifungal activity/disulfide bridge/rice lipid transfer protein/site-directed mutagenesis/structure


    Introduction
 Top
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Lipid transfer proteins (LTPs) belong to a group of proteins which occur widely in higher plants. Owing to their in vitro activity of transferring lipids between membranes, they were originally postulated to facilitate intracellular lipid transfer in vivo (Kader, 1975Go, 1996). However, later evidence that they were synthesized with an N-terminal signal peptide and localized extracellularly contradicts this hypothesis (Thoma et al., 1993Go). Therefore, other functions were suggested, including participating in defense reactions against plant pathogen attack (Molina et al., 1993Go; Garcia-Olmedo et al., 1995Go; Maldonado et al., 2002Go) and transporting of cutin monomer to aid in cuticle formation (Hollenbach et al., 1997Go). The facts that several LTPs in maize, barley and pepper leaves were induced by pathogen infection (Molina and Garcia-Olmedo, 1993Go; Molina et al., 1993Go; Park et al., 2002Go), some LTP isoforms in radish and sugar beet were demonstrated to inhibit the growth of bacterial and fungal pathogens in vitro (Terras et al., 1992Go; Nielsen et al., 1996Go) and high accumulation of LTPs occurs over exposed surfaces are consistent with the defensive role of LTPs (Thoma et al., 1993Go; Kader, 1996Go).

LTPs in different plants share common characteristics such as a signal peptide in the N-terminus, eight conserved cysteine residues engaged in forming four disulfide bonds, a basic isoelectric point (usually pH >8.0) and a low molecular weight (<10 kDa). Although the primary sequences of LTPs are not highly conserved, they have similar three-dimensional structures (Gincel et al., 1994Go; Gomar et al., 1996Go; Lerche and Poulsen, 1998Go; Poznanski et al., 1999Go). Until now, the crystal structures of LTPs in maize (Gomar et al., 1996Go, 1998; Lerche and Poulsen, 1998Go), wheat (Gincel et al., 1994Go; Charvolin et al., 1999Go; Tassin-Moindrot et al., 2000Go), barley (Lerche et al., 1997Go; Lerche and Poulsen, 1998Go; Douliez et al., 2001Go) and rice (Poznanski et al., 1999Go; Samuel et al., 2002Go) have been determined by X-ray crystallography or NMR spectroscopy. They all comprise a tunnel-like cavity organized by four {alpha}-helices and a long C-terminal tail without regular structure. Four disulfide bonds within the molecule stabilize the global fold. The long cavity can swell to accommodate one or two acyl chains when interacting with fatty acids (Lerche et al., 1997Go; Charvolin et al., 1999Go; Douliez et al., 2001Go).

Although the tertiary structures of LTPs have been determined, the structural basis for the resistance function of this kind of protein remains unknown. Some LTPs show very strong inhibitory activities whereas others do not. However, they have very similar three-dimensional structures. It is of interest to investigate what lies behind the difference in their function. In previous papers, we reported two cDNA sequences encoding lipid transfer proteins LTP110 and LTP144 in rice seedlings and showed that LTP110 is able to inhibit the growth of Pyricularia oryzae in vitro (Zhan et al., 1997Go; Ge et al., 1999Go, 2002). In this work, we studied the relationship between the antifungal activity of rice LTP110 and its structure by site-directed mutagenesis and especially point out, for the first time, that the Cys50–Cys89 disulfide bridge, previously considered to be critical to its structure and function, is dispensable for the inhibitory activity of LTP110.


    Materials and methods
 Top
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Materials

Expression vector pET32a(+) and host strain BL21(DE3)trxB were purchased from Novagen. Ni2+-chelating Sepharose Fast Flow and Phenyl Sepharose Fast Flow were purchased from Amersham Pharmacia Biotech. Enterokinase was donated by Fudan Zhangjiang Science and Technology Company.

Molecular modeling of LTP110

The Swiss-Model software package provided by the ExPASy Molecular Biology Server (http://cn.expasy.org) was used to predict the three-dimensional structure of LTP110. The detailed procedure was as follows: the ExNRL-3D database [derived from the Protein Data Bank (PDB)] was searched with the amino acid sequence of LTP110 and the most appropriate modeling template for Swiss-Model was selected. The selected modeling template was maize seedling LTP (63% identity with LTP110) from the ExNRL-3D database.

Construction of plasmids carrying mutant genes

A 0.5 kb long cDNA sequence encoding rice LTP110 was previously cloned into pSK+ vector, yielding the plasmid psk-LTP110 (Ge et al., 1999Go). The following primers were used to generate mutations: Tyr17Ala, Y17Aprimer1 (CCTGTCG GCTGTCATGGGG), Y17Aprimer2 (CACGGCGCGATC GACG); Asp45Ala, D45Aprimer1 (GCCGCTCGCCGCA CCGC), D45Aprimer2 (GGAGGAGGAGGCCTTTCC); Arg46Ala, R46Aprimer1 (GCCGACGCTCGCACCGCCTG), R46Aprimer2 (GGAGGAGGAAGCCTTTCC); Cys50Ala, C50Aprimer1 (CCGCCGCTAGCTGCCTCAAG), C50A primer2 (TGCGGCGGTCGGCGG); Pro72Leu, P72Lprimer1 (ATCCTTAGCAAATGTGGCGTC) and P72Lprimer2 (GGAGGCGGCGTTGCCC). The detailed procedure was performed according to the directions manual provided with the TaKaRa MutanBEST Kit (TaKaRa). Mutation residues were verified by DNA sequencing of the entire fragments. Based on the pSK-LTP110 plasmid, plasmids containing LTP mutants Tyr17Ala, Asp45Ala, Arg46Ala, Cys50Ala and Pro72Leu were successfully produced.

Cloning of the sequences encoding mature proteins of wild-type and mutant LTP110 in the pET32a(+) vector

The primers NLTP110

(GATGGATCCACCATGGCTGCGGTTAGCTGCGGCG)

        NcoI

and CLTP110

(TCAGAATTCCTATTAGTTGATCTTGGAG)

     EcoRI

were used to amplify the mature peptide coding regions of the wild-type and mutant LTP110 genes by the PCR method. The amplified NcoI–EcoRI fragment was then cloned into pET32a(+) vector. The accuracy of the clones was ensured by sequencing. The wild-type and mutant pET32a(+) recombinant plasmids were then used to transform BL21(DE)3trxB to express thioredoxin-LTP fusion proteins.

Expression and purification of thioredoxin-LTP fusion proteins

The bacterial growth and induction conditions were as described previously (Ge et al., 2002Go).

Digestion of thioredox-LTP fusion protein

The purified fusion proteins were dissolved in enterokinase buffer (150 mmol/l NaCl and 20 mmol/l Tris–HCl, pH 8.0) and then digested with enterokinase at room temperature for 6 h. The digested mixtures were loaded on to the Ni2+-chelating Sepharose Fast Flow column again and the flow-through proteins were collected and dialyzed against distilled water and then lyophilized.

Circular dichroism spectroscopy

The secondary structures of wild-type and mutant proteins were determined by circular dichroism in the far-ultraviolet region (190–250 nm). The measurements were performed with a JASCO 715 dichrograph at room temperature. The proteins were solubilized in deionized water at a final concentration of 0.5 mg/ml. A 1 mm quartz cell was used. Spectra were corrected for noise and background and were represented by the average of three measurements.

Lipid binding assay

Lipid binding activity was determined using 1-pyrenedodecanoic fatty acid as a fluorescent probe as described by Zachowski et al. (Zachowski et al., 1998Go).

Inhibition test

Pyricularia oryzae was grown on potato dextrose agar plates until spores were abundantly produced. The spores of P.oryzae were collected and the concentration was adjusted to 104 spores/ml using sterile water. The antifungal activity of wild-type and mutant LTP110 was measured in 96-well cell culture plates. Spore suspensions were incubated in microtiter wells with the indicated amounts of proteins (spores 10 µl + protein 20 µl, adjusting the final volume to 150 µl with potato dextrose medium). After 36 h of incubation at 28°C, germination of spores of P.oryzae was observed using an inverted microscope (Olympus) and photographed. Deionized water instead of protein was used as negative control in this assay.


    Results
 Top
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Our previous work indicated that rice LTP110 was able to inhibit the germination of spores of P.oryzae in vitro (Ge et al., 2002Go). Although numerous LTP members in plants have been shown to be growth inhibitors of fungal pathogens, others have not. It still remains elusive why proteins with similar structures exhibit different antipathogen activities. Sequence comparison showed that some amino acid residues are nearly 100% conserved in various nsLTPs. However, the reason why they have remained almost unchanged during the long evolutionary process is still not known. Since those evolutionarily conserved residues are supposed to be important in maintaining normal functions, in order to understand their roles in the relationship of structure–resistance function of LTP110, five residues, Tyr17, Asp45, Arg46, Cys50 and Pro72, were selected for mutation to examine whether they were indeed important in the antipathogen activity of LTP110.

Choice of mutations also took into account the protein structure of LTP110. The modeled structure of LTP110 was highly similar to the crystal structure of maize seedling LTP (Figure 1). From this structure, Tyr17 was located in helix I and was involved in a long-range hydrogen bond with Asn64 (found in all determined structures) and also hydrophobic interactions with Pro25 and Ile71, thus playing an important role in stabilizing the whole molecule. Asp45, whose carboxylate group makes a salt bridge with the N-terminal ammonium group in addition to the guanidinium groups of Arg46 and Arg47, showed a very important charge interaction within the molecule. Arg46 and Arg47, however, were also hydrogen bonded to the carbonyl groups of C-terminal residues. Hence Asp45, Arg46 and Arg47 participated in the most critical interaction constraining the terminal amino acids of this protein. Moreover, the triad Asp45–Arg46–Arg47 is strictly conserved in all nsLTPs. As for Pro72, apart from its high conservation, it distorted the structure of helix IV, thus participating in forming the internal cavity of the molecule. Cys50 was ligated with Cys89 by a disulfide bond, which was one of the four important disulfide bonds of LTPs. All these residues were considered to be crucial to the crystal structures of LTPs and therefore might also be important to their functions.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 1. Three-dimensional structural model of rice LTP110. The flat ribbon diagram was represented using the program Weblab viewer (Molecular Simulations). The mutation residues and the Cys50–Cys89 disulfide bond are shown in line style.

 
Wild-type thioredoxin-LTP110 and all mutant proteins were individually expressed in BL21(DE)3trxB host strains. They were highly purified after the two-step purification protocol through the His-tag affinity column and Phenyl Sepharose Fast Flow column. After digestion with enterokinase, all wild-type and mutant proteins were obtained. They all exhibited similar lipid-binding activities when subjected to lipid binding assay with 1-pyrenedodecanoic fatty acid (result not shown), indicating that mutations did not change the lipid-binding activity of this protein. Moreover, they also did not significantly affect the thermal stability of LTP110; all mutant proteins remained soluble when heated at 90°C for 5 min.

Circular dichroism (CD) in the far-ultraviolet region reflected the changes in the secondary structure. Figure 2 indicates that except for Asp45Ala and Pro72Leu, the negative peaks of all other mutants had shifted. Wild-type, Asp45Ala and Pro72Leu revealed a double minimum at 207 and 223 nm, which was characteristic of an {alpha}-helix structure. In contrast, the CD spectra of Arg46Ala and Cys50Ala displayed a negative band around 200 nm with a small shoulder between 220 and 230 nm, suggesting that the protein structures had been partially destroyed. The most notable change happened with Tyr17Ala, which showed a strong negative peak at 200 nm and also a shoulder at 194 nm, indicating that the secondary structure was strongly affected by mutation and the content of random coil conformation increased at the expense of the {alpha}-helix.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2. Comparison of the CD spectra of wild-type and mutant proteins.

 
Inhibition tests revealed that Asp45Ala and Cys50Ala retained antifungal activity close to wild-type LTP (Figure 3). However, Tyr17Ala, Arg46Ala and Pro72Leu mutants lost inhibition function. They did not show any resistance ability even when the protein concentration was increased to 0.5 mg/ml, implying that the structure related to antifungal activity had been destroyed.



View larger version (137K):
[in this window]
[in a new window]
 
Fig. 3. Comparison of the antifungal activities of WT and mutant proteins. Spores of P.oryzae were incubated for 36 h at 28°C with a protein concentration of 0.1 mg/ml. The control was deionized sterile water in place of protein.

 

    Discussion
 Top
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Since LTP110 lacks tryptophan and Tyr17 is the only tyrosine residue in the molecule, replacement of Tyr17 with Ala results in very low fluorescence intensity compared with other mutants. Tyr17Ala did not show any tyrosine fluorescence when measured with fluorescence spectrophotometry, while other mutant proteins showed the typical emission spectrum of tyrosine (not shown), just as the wild-type protein. Among the mutants, the CD spectrum of Tyr17Ala indicated the most serious change compared with that of wild-type. Taking into account the loss of inhibition function at the same time, our results demonstrated that Tyr17 is important in stabilizing the whole structure of the protein and also critical in maintaining antifungal activity. It has been reported that in rice seed LTP and maize seedling LTP, Tyr17 interacts with other residues to stabilize loop 1 and also forms a long-distance hydrogen bond with Asn64 to stabilize the whole molecule. Therefore, mutation of Tyr17 may cause the destruction of molecular structure and the resistance function of the whole protein. Almost all LTP1s found now are conserved in this residue except that a few are synonymously substituted by another aromatic amino acid, Phe, also implying its importance.

Neither Asp45Ala nor Pro72Leu produced very significant variations of the CD spectra, but their activities were different. Asp45Ala still retained similar activity to the wild-type protein, but Pro72Leu lost the antifungal activity at the same protein concentration. This indicates that Asp45Ala is a relatively mild mutation and did not cause significant changes in structure or inhibition activity. Since Asp45 is negative in charge and mutation to Ala will simultaneously result in an increase in positive charge in the whole molecule, the effects of the electrical charge change cannot be excluded. Further research is needed to determine if a higher isoelectric point contributes to its antifungal activity, since some LTPs with very strong inhibition function usually have much higher isoelectric points (Cammue et al., 1995Go). As for Pro72Leu, although the change of CD spectrum was barely noticeable, its antifungal activity was significantly reduced, suggesting that it is important to the inhibition function.

Replacement of Arg46 with Ala destroyed both the secondary structure and antifungal activity. In the crystal structure of rice seed LTP, Arg46 was considered to be involved in the salt bridge interaction to stabilize the whole structure and also in hydrogen bond formation with the C-terminal tail, which is essential in the dynamic process of binding lipids through position movement (Lerche et al., 1997Go; Poznanski et al., 1999Go). Mutation in this residue will cause a loss of these interactions. Further, Arg46Ala also reduces the positive charge, which may also contribute to loss of function.

The most surprising result came from the mutation of Cys50. Although it caused a change in secondary structure, in accord with the results of Desormeaux et al. (Desormeaux et al., 1992Go), it did not cause any significant reduction in inhibition function. Cys50 was proved to form a disulfide bond with Cys89 in all known structures of LTPs. As for LTP110, disruption of the Cys50–Cys89 disulfide bridge had no impact on the inhibition function, showing that the structure basis of antifungal activity does not involve this disulfide bond. Cleavage of the Cys50–Cys89 bridge only destroyed partial secondary structures and other disulfide bonds, and salt bridges or hydrophobic interactions continued to maintain the major part of the molecular structure. Moreover, loss of constraint by this disulfide bridge may make the C-termini more free (see Figure 1), which makes the protein more flexible. It still remains to be investigated if other disulfide bridges are indispensable for the function of this protein.

To our knowledge, this is the first analysis of the structure–resistance function relationship of nsLTPs. Our results clearly indicate that some conserved residues such as Tyr17, Arg46 and Pro72 are important in maintaining the resistance function of this protein. We also found, for the first time, that the Cys50–Cys89 disulfide bridge was dispensable for the resistance function, in contrast to previous expectations that disulfide bridges are essential. In addition, since all mutant proteins exhibited lipid-binding activity, but only some mutations destroyed the inhibition function, it can be concluded that the lipid-binding activity of LTP is not decisive for its antifungal activity. The fact that an LTP-like protein in onion seed, Ace-Amp1, has very strong inhibition activity while not exhibiting any lipid-binding activity (Cammue et al., 1995Go) also supports this view. Thus, other inhibition mechanisms of LTPs need to be considered and tested.


    Acknowledgement
 
This work was supported by the National Natural Science Foundation of China (30000037).


    References
 Top
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cammue,B.P., Thevissen,K., Hendriks,M., Eggermont,K., Goderis,I., Proost,P., Van Damme,J., Osborn,R.W., Guerbette,F. and Kader,J.C. (1995) Plant Physiol., 109, 445–455.[Abstract]

Charvolin,D., Douliez,J.P., Marion,D., Cohen-Addad,C. and Pebay-Peyroula,E. (1999) Eur. J. Biochem., 264, 562–568.[Web of Science][Medline]

Desormeaux,A., Blochet,J.-E., Pezolet,M. and Marion,D. (1992) Biochim. Biophys. Acta, 1121, 137–152.[CrossRef][Medline]

Douliez,J.P., Jegou,S., Pato,C., Molle,D., Tran,V. and Marion,D. (2001) Eur. J. Biochem., 268, 384–388.[Web of Science][Medline]

Garcia-Olmedo,F., Molina,A., Segura,A. and Moreno,M. (1995) Trends Microbiol., 3, 72–74.[CrossRef][Medline]

Ge,X.C., Liu,X.F., Zhan,S.X., Zhang,J.L., Sun,C.R. and Cao,K.M. (1999) Prog. Nat. Sci., 9, 413–418.

Ge,X.C., Chen,J.C, Lin,Y., Sun C.R. and Cao,K.M. (2002) Acta Biochim. Biophys. Sin., 34, 83–87.

Gincel,E., Simorre,J.P., Caille,A., Marion,D., Ptak,M. and Vovelle,F. (1994) Eur. J. Biochem., 226, 413–422.[Web of Science][Medline]

Gomar,J., Petit,M.C., Sodano,P., Sy,D., Marion,D. and Kader,J.C. (1996) Protein Sci., 5, 565–577.[Web of Science][Medline]

Gomar,J., Sodano,P., Sy,D., Marion,D., Kader,J.C., Vovelle,F. and Ptak,M. (1998) Proteins, 31, 160–171.[CrossRef][Web of Science][Medline]

Hollenbach,B., Schreiber,L., Hartung,W. and Dietz,K.J. (1997) Planta, 203, 9–19.[CrossRef][Web of Science][Medline]

Kader,J.C. (1975) Biochim. Biophys. Acta, 380, 31–34.[Medline]

Kader,J.C. (1996) Annu. Rev. Plant. Physiol. Plant Mol. Biol., 47, 627–654.[CrossRef][Web of Science]

Lerche,M.H. and Poulsen,F.M. (1998) Protein Sci., 7, 2490–2498.[Web of Science][Medline]

Lerche,M.H., Kragelund,B.B., Bech,L.M. and Poulsen,F.M. (1997) Structure, 5, 291–306.[Medline]

Maldonado,A.M., Doerner,P., Dixon,R.A., Lamb,C.J. and Cameron,R.K. (2002) Nature, 419, 399–403.[CrossRef][Medline]

Molina,A. and Garcia-Olmedo,F. (1993) Plant J., 4, 983–991.[CrossRef][Web of Science][Medline]

Molina,A., Segura,A. and Garcia-Olmedo,F. (1993) FEBS Lett., 316, 119–122.[CrossRef][Web of Science][Medline]

Nielsen,K.K., Nielsen,J.E., Madrid,S.M. and Mikkelsen,J.D. (1996) Plant Mol. Biol., 31, 539–552.[CrossRef][Web of Science][Medline]

Park,C.J., Shin,R., Park,J.M., Lee,G.J., You,J.S. and Paek,K.H. (2002) Plant Mol. Biol., 48, 243–254.[CrossRef][Web of Science][Medline]

Poznanski,J., Sodano,P., Suh,S.W., Lee,J.Y., Ptak,M. and Vovelle,F. (1999) Eur. J. Biochem., 259, 692–708.[Web of Science][Medline]

Samuel,D., Liu,Y.J., Cheng,C.S. and Lyu,P.C. (2002) J. Biol. Chem., 277, 35267–35273.[Abstract/Free Full Text]

Tassin-Moindrot,S., Caille,A., Douliez,J.P., Marion,D. and Vovelle,F. (2000) Eur. J. Biochem., 267, 1117–1124.[Web of Science][Medline]

Terras,F.R.G., Goderis,I.J., Van Leuven,F., Vanderleyden,J., Cammue,B.P.A. and Broekaert,W.F. (1992) Plant Physiol., 100, 1055–1058.[Abstract/Free Full Text]

Thoma,S., Kaneko,Y. and Somerville,C. (1993) Plant J., 3, 427–436.[CrossRef][Web of Science][Medline]

Zachowski,A., Guerbette,F., Grosbois,M., Jolliot-Croquin,A. and Kader,J.C. (1998) Eur. J. Biochem., 257, 443–448.[Web of Science][Medline]

Zhan,S.X., Ge,X.C., Li,G., Cao,K.M. and Sun,C.R. (1997) Acta Bot. Sin., 39, 701–706.

Received August 23, 2002; revised April 16, 2003; accepted May 20, 2003.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
BioinformaticsHome page
C. Deutsch and B. Krishnamoorthy
Four-Body Scoring Function for Mutagenesis
Bioinformatics, November 15, 2007; 23(22): 3009 - 3015.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Extract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Ge, X.
Right arrow Articles by Cao, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ge, X.
Right arrow Articles by Cao, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?