Protein Engineering vol. 16 no. 6 pp. 423-428, 2003
© 2003 Oxford University Press
Improvement of H2O2 stability of manganese peroxidase by combinatorial mutagenesis and high-throughput screening using in vitro expression with protein disulfide isomerase
Toyota Central R&D Laboratories, Inc., 411, Yokomichi, Nagakute, Aichi 480-1192 and 1Laboratory of Molecular Biotechnology, Graduate School of Biological and Agricultural Sciences, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601, Japan
2 To whom correspondence should be addressed. e-mail: e1092{at}mosk.tytlabs.co.jp
| Abstract |
|---|
|
|
|---|
A functional expression system for a heme protein of Phanerochaete chrysosporium, manganese peroxidase (MnP), was developed using the Escherichia coli in vitro coupled transcription/translation system in the presence of hemin and fungal protein disulfide isomerase. This system has allowed the high-throughput construction and screening of a large diversity of mutant heme enzymes and has made it possible to improve the enzymatic function efficiently. Here we increased the H2O2 stability of MnP using this system; a mutant MnP library containing three randomized amino acid residues located in the H2O2-binding pocket of MnP was designed and constructed on a 384-well plate using SIMPLEX (single-molecule-PCR-linked in vitro expression). The screening of 104 samples independently expressed for improved H2O2 stability led to four positive mutants, the H2O2 stability of which was nine times higher than that of the wild-type.
Keywords: cell-free protein synthesis/high-throughput screening/hydrogen peroxide/manganese peroxidase/protein disulfide isomerase
| Introduction |
|---|
|
|
|---|
Manganese peroxidase (MnP) produced by Phanerochaete chrysosporium, which catalyzes the oxidation of Mn2+ to Mn3+, is easily inactivated by H2O2 present in the reaction. However, this powerful oxidant (Glenn et al., 1986
Possibly owing to the complicated structure of MnP [Protein Data Bank (PDB): 1MNP], including five disulfide bonds, Mn2+, Ca2+ and heme as the catalytic center, insoluble inclusion bodies were formed in Escherichia coli in vivo expression and time-consuming solubilization and refolding steps were required to obtain active enzyme (Miyazaki and Takahashi, 2001
; Whitwam et al., 1995
). A rapid and functional expression system for heme proteins, therefore, is desirable.
Cell-free protein synthesis systems allow the rapid production of proteins directly from plasmid or polymerase chain reaction (PCR)-amplified DNA templates. Another striking advantage of the system is easy modification of the composition of reaction mixtures according to the requirements for the synthesis of each protein. Lipase (Yang et al., 2000
), phospholipase D (Iwasaki et al., 2000
), a single-chain antibody (Ryabova et al., 1997
) and a Fab antibody (Jiang et al., 2002
), all of which have disulfide bonds in their structures, have been functionally expressed by an E.coli S30 extract without a reducing agent. However, heme-containing proteins have not been successful in functional expression.
In this study, we first attempted to synthesize a functional MnP using a modified E.coli in vitro protein synthesis system. Hemin was added to the system because it was known that heme was essential in the refolding step in the case of another heme protein, cytochrome c peroxidase (Elove et al., 1994
). The effect of the addition of various disulfide-forming catalysts and chaperones on the activity of MnP was investigated. Protein disulfide isomerase (PDI) is a physiological catalyst for the formation of native disulfide bonds of nascent peptides in cells. PDI has both isomerase and chaperone activities (Wang, 2002
) and it assists the folding of denatured and reduced disulfide-containing proteins. Addition of thermostable PDI especially from the thermophilic fungus Humicola insolens, obtained in our previous study (Kajino et al., 1994
, 1998), increased the synthesis of functional MnP greatly.
Recently, Nakano et al. (Nakano et al., 2000
; Nakano, 2003
) developed single-step single-molecule PCR (SM-PCR) with a homo-primer for amplification from a single-molecule DNA template and proposed a novel protein library construction system named SIMPLEX (single-molecule-PCR-linked in vitro expression). Correspondence of a genotype (SM-PCR product) with a phenotype (in vitro synthesized protein) has made it possible to screen a large diversity of mutant enzymes and to increase the enzymatic function efficiently. Here we aimed to increase the H2O2 stability by applying this technology exclusively on 384-well plates. The whole process takes only
8 h from the beginning of the SM-PCR to the end of the screening and only a few days were required to screen 104 independent clones. The high-throughput construction of mutant MnPs and screening in the presence of H2O2 resulted in the finding of mutants with improved stability against H2O2.
| Materials and methods |
|---|
|
|
|---|
Decreasing the GC content of mnp
MnP gene (mnp) was cloned from Phanerochaete chrysosporium (Miyazaki and Takahashi, 2001
). Since the efficiency of SM-PCR amplification of native MnP was very low, possibly owing to the high GC content of mnp, the GC content of the 337 bases of the C-terminal region was decreased as follows. In the chemical synthesis of 337 bases of the C-terminal region of mnp, the third codon of guanine and cytosine was changed to adenine or thymine, following the codon usage of E.coli, with the result that the GC content of the C-terminal region was reduced to 55.68% from 67.25%. Then the full-length DNA fragment generated by the overlapping PCR method was cloned into NdeIHindIII sites of pET23b(+) (Novagen), which possesses T7 promoter, ribosome-binding site, a C-terminal six-His tag and T7 terminator, designated pET23b/gcmnp. The DNA sequence of the 337 bases of the C-terminal region of gcmnp is as follows: ACGTGACGAACGTACTGCATG CTTTTGGCAGTCTTTTGTGAATGAACAGGAATTTATGGCAGCATCTTTTAAAGCAGCAATGGCAAAACTGGCAATTCTGGGTCATTCTCGTTCTTCTCTGATTGACTGCTCTGACGTGGTGCCAGTGCCAAAACCAGCAGTGAATAAACCAGCAACTTTTCCAGCAACTAAAGGTCCAAAAGACCTGGACACTCTGACTTGCAAAGCACTGAAATTTCCAACTCTGACTTCTGACCCAGGTGCAACTGAAACTCTGATTCCACATTGCTCTAATGGTGGTATGTCTTGCCCAGGTGTGCAGTTTGACGGTCCAGCA.
In vitro coupled transcription/translation
The E.coli S30 extract without a reducing agent used for the cell-free protein synthesis was prepared as reported (Jiang et al., 2002
). The plasmid, pET23b/gcmnp, was amplified from the T7 promoter to the T7 terminator and used as cell-free expression template at a final concentration of 50 µg/ml. Then, 10 µM hemin was added to a 40 µl transcription/translation reaction mixture [56.4 mM Trisacetate, pH 7.4, 1.2 mM ATP, 1 mM each GTP, CTP and UTP, 40 mM creatine phosphate, 0.7 mM each of 20 kinds of amino acids, 4.1% (w/w) polyethylene glycol 6000, 35 µg/ml folinic acid, 0.2 mg/ml E.coli tRNAs, 36 mM ammonium acetate, 10 mM Mg(OAc)2, 100 mM KOAc, 0.15 mg/ml creatine kinase, 10 µg/ml rifampicin, 25 units T7 RNA polymerase (TaKaRa, Japan), 10 µM hemin and 28.3% (v/v) S30 extract], followed by incubation at 25°C for 180 min. According to need, the molecular chaperones and PDIs were added at the following concentrations: DnaK (Calbiochem, Germany) 1.0 µM, DnaJ (StressGen Biotechnologies, Canada) 0.4 µM, GroE (TaKaRa, Japan) 1.25 µM, GrpE (kindly provided by Mr M.Sakurai of Nagoya University) 0.4 µM, GSH 1.0 mM, GSSG 0.1 mM, fungal PDI 0.5 µM and bovine liver PDI (TaKaRa, Japan) 0.5 µM. Fungal PDI from Humicola insolens KASI was expressed in a heterologous protein production system using Bacillus brevis 31-0K as a host and the recombinant PDI secreted into the culture supernatant was purified to homogeneity by a two-step procedure, i.e. anion-exchange chromatography and hydrophobic interaction chromatography (Kajino et al., 1994
, 1998). 14C-labeled leucine (Amersham) was added to the reaction system at a concentration of 17 µM for autoradiography. Rainbow 14C-labeled protein marker (Amersham) was used for molecular mass standards.
Screening of the library for H2O2-resistant activity of MnP
NNS (N = A, T, C or G and S = C or G) mutations were introduced into A79, N81 and I83 of gcmnp by overlapping PCR. The pool of mutated gcmnp was amplified with the F1E1 (GGTTTGGGCTAAATCACGCTGTGTATCTCGATC CCGCGAAATTAATACG) and R1E1 (GGTTTGGGCTA AATCACGCTGTGTTCCGATATAGTTCCTCCTTTCAG) primers, both of which contained a 5' homo-tail sequence (in bold face) of 20 bases. Homo-tailed PCR products were precipitated with ethanol and used for the SM-PCR. SM-PCR was performed essentially as described previously (Nakano et al., 2000
; Rungpragayphan et al., 2002
, 2003). A single primer (GGTTTGGGCTAAATCACGCT) was used to avoid formation of primerdimers (Brownie et al., 1997
; Nakano et al., 2000
). The homo-tailed templates were diluted to one molecule/µl in 0.1% blue dextran 2000/TE buffer. The mixture for SM-PCR was comprised of one molecule of template, 0.02 units of LA Taq polymerase (TaKaRa, Japan), 0.2 mM each dNTP and 0.5 µM of the primer at 7 µl/well in a 384-well plate. The reaction was allowed to proceed at 94°C for 2 min, followed by 65 cycles of 96°C for 10 s, 62°C for 5 s and 72°C for 100 s. A 3 µl portion of the amplified SM-PCR product (containing
500 ng) was directly transferred to 37 µl of the transcription/translation reaction mixture, followed by incubation for 3 h at 25°C. A 1.5 µl volume of the synthesized reaction mixture was added to 100 µl of MnP assay buffer comprising 5 mM ABTS [2,2'-azinobis(3-ethylbenzthiazoline-6-sulfonic acid); Sigma, USA] (Johannes et al., 1996
), 2 mM oxalate, 0.1 mM MnSO4, 50 mM sodium succinate, pH 4.5 and 1.0 mM H2O2 and the absorbance was measured at 415 nm after 10 min. All screening steps were carried out in 384-well plates.
H2O2 stability studies
MnP solutions were incubated in the presence of 0.1, 0.5 and 1.0 mM H2O2 at 30°C for different times and then diluted to 0.1 mM H2O2. MnP activity was measured as described above.
| Results |
|---|
|
|
|---|
MnP synthesis by an E.coli cell-free protein synthesis system
In the preparation of the E.coli S30 extract for MnP synthesis, a reducing agent, dithiothreitol (DTT), was omitted to maintain oxidizing conditions for the formation of the disulfide bridges of the protein, because functional MnP was not formed in the presence of a strong reducing agent, 1.7 mM DTT (data not shown). Also, hemin was added to the E.coli in vitro coupled transcription/translation system to supply heme for MnP. To improve the MnP production system, the conditions for the reaction were optimized. The amounts of expressed MnP at different incubation temperatures were measured by autoradiography of the SDSPAGE gel (Figure 1). On incubation at 37°C, 72.9% of the products were insoluble, whereas on incubation at 25°C, 78.4% were soluble.Hence low-temperature expression greatly increased the yield of the soluble fraction. The synthesized MnP was concentrated by absorption on His-tagged beads (Qiagen) and then the MnP activity on the beads was measured. Only in the case of incubation at 25°C was MnP activity detected (data not shown).
|
The hemin concentration and template concentration were also optimized. The optimum concentration of hemin was 10 µM (Figure 2). In the case of refolding inclusion bodies of MnP, the optimum concentration of hemin was equimolar with that of the MnP peptide (Whitwam and Tien, 1996
|
Effects of PDIs and chaperones on MnP expression
To enhance the yield of functional MnP, reduced and oxidized glutathione (GSH and GSSG), PDIs and chaperones were added to the in vitro expression mixture (Figure 3a). PDI was added with GSH/GSSG to activate its own active site. The addition of only chaperones (DnaK/J, GroES/EL and GrpE) hardly changed the MnP activity. When fungal PDI was present in the reaction mixture, the MnP activity increased up to 4-fold compared with the case of a control mixture without PDI or chaperones, but interestingly bovine PDI had no such effect. Although MnP activity was high when both chaperones and fungal PDI were added, it was suggested that this was mainly an effect of fungal PDI. Although an E.coli disulfide-forming catalyst, DsbA (Darby and Creighton, 1995
), might be included in the S30 extract, it dose not seem effective in producing active MnP. The fungal PDI catalyzed much more efficient disulfide isomerization. Fungal PDI increased the active form of MnP greatly, but not the amount of translated MnP (Figure 3b). In addition, the yield of synthesized MnP had already reached a plateau after incubation for 60 min (Figure 4b), whereas MnP activity reached a plateau after incubation for 150 min (Figure 4a). This is possibly due to a time delay between the peptide synthesis and folding of the MnP protein. It is considered that fungal PDI, which has both isomerase and chaperone activities (Wang, 2002
) and facilitates the folding of denatured and reduced SH-proteins, played an important role in MnP folding to the native form with the correct disulfide formation in this cell-free system.
|
|
Design of mutant MnP library
The three-dimensional structure of MnP isozyme 1 (PDB: 1MNP) has been well characterized by X-ray crystallography (Sundaramoorthy et al., 1994
). In previous work, we constructed a model of MnP isozyme 2 by the homology modeling method using 1MNP as the backbone for the starting structure (Miyazaki and Takahashi, 2001
). A structural model of the H2O2-binding pocket of MnP is shown in Figure 5. Amino acid residues located near His46 and Arg42, which are conserved in H2O2-binding residues (Sundaramoorthy et al., 1994
), were picked as candidates for substitution for the library. Conserved amino acid residues in various peroxidases were excluded as candidates for substitution. To bring about a minute conformational change around the entry site of the H2O2-binding pocket, three amino acid residues, i.e. A79, N81 and I83, were selected for replacement with all kinds of amino acid residues (A79X, N81X and I83X). The theoretical number of mutated MnP with different sequences was 8000.
|
Screening of the MnP library
We aimed to establish a rapid and efficient screening system involving SIMPLEX that is a combination of SM-PCR, cell-free expression and high-throughput screening. It was assumed that the low efficiency of SM-PCR amplification of native MnP was due to the high GC content of mnp. The GC content of the codon of Phanerochaete chrysosporium, which is the origin of mnp, is 60.83%, whereas that of E.coli, which is the origin of the extract used for cell-free protein synthesis, is 51.83%. According to the GC content of each codon of Phanerochaete chrysosporium (first:second:third = 59%:47%:77%), the GC content in the third codon is especially high. Moreover, the GC content of 337 bases of the C-terminal region of mnp is 67.25%, those of the remaining 737 bases of the N-terminal region and full-length mnp (1074 bases) being 60 and 60.83%, respectively. We decreased the GC content of the 337 bases of the C-terminal region, and finally the GC content of the C-terminal 337 bases was 55.68% and that of the full length 46.49% (gcmnp). Using gcmnp as a template, SM-PCR was successfully amplified. Also, regarding cell-free expression, the two MnPs showed almost the same activities (data not shown).
The MnP activity with the SM-PCR product as templates for cell-free synthesis was 2030% lower than that of the purified PCR product. It was presumed that a component of the PCR mixture, such as DNA polymerase, dNTPs and metal ions, would inhibit the in vitro transcription/translation. An amount of 510% (v/v) of the PCR product was found to be suitable for the cell-free synthesis reaction mixture (data not shown).
We have thus constructed a mutant MnP library containing randomized A79, N81 and I83 by SIMPLEX and screened more than 104 wells by measuring MnP activity in the presence of 1.0 mM H2O2, where the wild-type gave no detectable signal. The whole process is illustrated in Figure 6. Twelve samples were selected as having improved activities compared with the wild-type and the MnP activities of these positive wells are summarized in Figure 7. The SM-PCR products in the 12 positive wells were directly cloned into the pT7Blue3 blunt vector (Novagen) and each clone was amplified in triplicate again to prepare individual templates for cell-free synthesis. H2O2 stability studies were carried out for the 36 clones. Among them, 15 clones showed improved H2O2 stability and their whole sequences were confirmed. The clones were classified into four types of sequences according to amino acid substitution. The amino acid substitutions and the H2O2 stability of the four types of clones are shown in Table I. In the presence of 0.1 mM H2O2, the half-life of type 1 clone was nine times higher than that of the wild-type. Also other clones were five times more stable than the wild-type. Furthermore, even in the presence of higher concentrations of H2O2 of 0.5 and 1.0 mM, all of the four types of clones showed significantly higher stability than the wild-type.
|
|
|
These four clones have a common substitution of I83L. In addition, A79 was changed for either E or S and N81 for S or L. Since these three amino acid residues were converged from a large variety in the library as a result of selection, this high-throughput screening system is likely to work well. Fine tuning of the local arrangement in the H2O2-binding pocket seems to be effective for improving the H2O2 stability of MnP.
| Discussion |
|---|
|
|
|---|
This is the first report concerning the in vitro protein synthesis of a functional heme protein. A fungal manganese peroxidase, a heme protein, was produced as the active form using an E.coli cell-free protein synthesis system that was extensively tuned by optimizing the temperature and the oxidation conditions and by adding both heme and fungal PDI. Especially fungal PDI had a remarkable effect on the functional expression of MnP, whereas bovine PDI did not. Comparing the properties of fungal and bovine PDI, the former is considerably heat stable (Kajino et al., 1998
During the experiments, we found that the yield of the soluble fraction was increased on lowering the incubation temperature from 37 to 25°C. The amount of functional MnP, however, was not increased significantly. In conclusion, a lower temperature in the folding process repressed the aggregation of MnP; furthermore, the additional PDI would help the correct formation of disulfide bonds, resulting in a high MnP activity. Eventually the enzymatic activity of MnP produced in the reaction mixture was increased sufficiently to be measured directly without concentration using His-tagged beads. This rapid functional expression system made it possible to screen a large number of mutant heme proteins in a high-throughput manner.
The capability to modify the composition of the reaction mixture according to different cases was one of the benefits for cell-free protein synthesis. It has been reported that primary bound hemin and histidine of cytochrome c peroxidase (CCP) triggers the start of protein folding (Elove et al., 1994
). We postulated that approximately the same folding order would occur for other heme proteins, including MnP. Actually the hemin should be added at the beginning of the in vitro transcription/translation reaction.
To construct a mutant MnP library, SIMPLEX, which includes single-molecule PCR followed by cell-free protein synthesis, was used. Compared with conventional in vivo colony-based methods (Cherry et al., 1999
; Lin et al., 1999
; Iffland et al., 2000
), this system is extremely rapid and efficient. For example, neither a transformation nor a cultivation step is necessary, and therefore replica plates, which are essential in cell-based screening for linking a genotype with a phenotype, also are not necessary. Instead, after using a portion of the SM-PCR product for protein synthesis, the remainder on a 384-well PCR plate was frozen for long-term storage in a stable state. More importantly, the total time required for protein expression and screening was short,
8 h: 4 h for SM-PCR, 3 h for cell-free protein synthesis and 1 h for the screening of the protein library.
Our cell-free system involving fungal PDI would be applicable to the screening of other heme-containing proteins. Furthermore, the system can be widely applied for various kinds of screening of proteins with desired properties. In the near future, scaling down of the reaction volume of screening would be possible by using high-density plates having e.g. 1536 wells or more, which will allow the rapid handling of a larger and more diversified library and efficient screening.
The inactivation pathway of MnP by excess H2O2 has already been studied, suggesting that compound III formed in heme bleaching causes irreversible MnP inactivation (Wariishi and Gold, 1990
; Timofeevski et al., 1998
). However, our results suggest that MnP instability against small amounts of H2O2 is closely related to the susceptibility to a conformational change around the active site, which eventually causes subsequent inactivation or denaturation. Furthermore, in our previous study (Miyazaki and Takahashi, 2001
), the H2O2 stability was improved by site-directed substitution of oxidizable, solvent-accessible or conformationally unstable amino acid residues around the H2O2-binding region by stable amino acid residues. One such mutant was N81S. In this study, the mutants having the same substitution were also isolated, such as clone 1 (A89E, N81S, I83L) and clone 6 (A89S, N81S, I83L). The H2O2 stability of clone 1 was four times higher than that of the mutant N81S (Table I). The result suggests that SIMPLEX is very useful for the fine tuning of the substrate-binding pocket of enzymes.
| Acknowledgements |
|---|
This work was financially supported in part by a grant from the New Energy and Industrial Technology Development Organization, Japan (NEDO) and the Ministry of Economy, Trade and Industry, Japan (METI).
| References |
|---|
|
|
|---|
Brownie,J., Shawcross,S., Theaker,J., Whitcombe,D., Ferrie,R., Newton,C. and Little,S. (1997) Nucleic Acids Res., 25, 32353241.
Cherry,J.R., Lamsa,M.H., Schneider,P., Vind,J., Svendsen,A., Jones,A. and Pedersen,A.H. (1999) Nat. Biotechnol., 17, 379384.[CrossRef][Web of Science][Medline]
Darby,N.J. and Creighton,T.E. (1995) Biochemistry, 34, 35763587.[CrossRef][Medline]
Elove,G.A., Bhuyan,A.K. and Roder,H. (1994) Biochemistry, 33, 69256935.[CrossRef][Medline]
Glenn,J.K., Akileswaran,L. and Gold,M.H. (1986) Arch. Biochem. Biophys., 251, 688696.[CrossRef][Medline]
Hammel,K.E., Tardone,P.J., Moen,M.A. and Price,L.A. (1989) Arch. Biochem. Biophys., 270, 404409.[CrossRef][Medline]
Iffland,A., Tafelmeyer,P., Saudan,C. and Johnsson,K. (2000) Biochemistry, 39, 1079010798.[CrossRef][Medline]
Iwasaki,Y., Nishiyama,T., Kawarazaki,Y., Nakano,H. and Yamane,T. (2000) J. Biosci. Bioeng., 89, 506508.[CrossRef][Web of Science][Medline]
Jiang,X., Ookubo,Y., Fujii,I., Nakano,H. and Yamane,T. (2002) FEBS Lett., 514, 290294.[Medline]
Johannes,C., Majcherczyk,A. and Huttermann,A. (1996) Appl. Microbiol. Biotechnol., 46, 313317.[CrossRef][Web of Science][Medline]
Kajino,T., Sarai,K., Imaeda,T., Idekoba,C., Asami,O., Yamada,Y., Hirai,M. and Udaka,S. (1994) Biosci. Biotechnol. Biochem., 58, 14241429.[Medline]
Kajino,T., Miyazaki,C., Asami,O., Hirai,M., Yamada,Y. and Udaka,S. (1998) Methods Enzymol., 290, 5059.[Medline]
Lin,Z., Thorsen,T. and Arnold,F.H. (1999) Biotechnol. Prog., 15, 467471.[CrossRef][Medline]
Miyazaki,C. and Takahashi,H. (2001) FEBS Lett., 509, 111114.[CrossRef][Web of Science][Medline]
Nakano,H., (2003) Seibutsu-kogaku Kaishi, 81, 7176 (in Japanese).
Nakano,H., Kobayashi,K., Ohuchi,S., Sekiguchi,S. and Yamane,T. (2000) J. Biosci. Bioeng., 90, 456458.[CrossRef][Medline]
Popp,J.L. and Kirk,T.K (1991) Arch. Biochem. Biophys., 288, 145148.[Medline]
Rungpragayphan,S., Kawarazaki,Y., Imaeda,T., Kohda,K., Nakano,H. and Yamane,T. (2002) J. Mol. Biol., 318, 395405.[CrossRef][Web of Science][Medline]
Rungpragayphan,S., Nakano,H. and Yamane,T. (2003) FEBS Lett., 540, 147150.[CrossRef][Web of Science][Medline]
Ryabova,L.A., Desplancq,D., Spirin,S. and Pluckthun,A. (1997) Nat. Biotechnol. 15, 7984.[CrossRef][Medline]
Sasaki,T., Kajino,T., Bo,L., Sugiyama,H. and Takahashi,H. (2001) Appl. Environ. Microbiol., 67, 22082212.
Sundaramoorthy,M., Kishi,K., Gold,M.H. and Poulos,T.L. (1994) J. Mol. Biol., 238, 845848.[CrossRef][Medline]
Timofeevski,L., Reading,R.S. and Aust,S.D. (1998) Arch. Biochem. Biophys., 356, 287295.[CrossRef][Medline]
Wang,C.C. (2002) Methods Enzymol., 348, 6675.[CrossRef][Web of Science][Medline]
Wariishi,H. and Gold,M.H. (1990) J. Biol. Chem., 265, 20702077.
Whitwam,R.E. and Tien,M. (1996) Arch. Biochem. Biophys., 333, 439446.[CrossRef][Medline]
Whitwam,R.E., Gazarian,I.G. and Tien,M. (1995) Biochem. Biophys. Res. Commun., 216, 10131017.[Medline]
Yang,J., Kobayashi,K., Iwasaki,Y., Nakano,H. and Yamane,T. (2000) J. Bacteriol., 182, 295302.
Received March 3, 2003; revised May 1, 2003; accepted May 7, 2003.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
F. J. Ruiz-Duenas, M. Morales, E. Garcia, Y. Miki, M. J. Martinez, and A. T. Martinez Substrate oxidation sites in versatile peroxidase and other basidiomycete peroxidases J. Exp. Bot., February 1, 2009; 60(2): 441 - 452. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Valderrama, H. Garcia-Arellano, S. Giansanti, M. C. Baratto, R. Pogni, and R. Vazquez-Duhalt Oxidative stabilization of iso-1-cytochrome c by redox-inspired protein engineering FASEB J, June 1, 2006; 20(8): 1233 - 1235. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








