PEDS Advance Access originally published online on December 3, 2004
Protein Engineering Design and Selection 2004 17(11):779-786; doi:10.1093/protein/gzh092
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Negatively charged purification tags for selective anion-exchange recovery
Department of Biotechnology, Royal Institute of Technology (KTH), AlbaNova University Center, Roslagstullsbacken 21, SE-106 91 Stockholm, Sweden
1 To whom correspondence should be addressed. E-mail: sophia.hober{at}biotech.kth.se
| Abstract |
|---|
|
|
|---|
A novel strategy for the highly selective purification of recombinant fusion proteins using negatively charged protein domains, which were constructed by protein design, is described. A triple
-helical domain of 58 amino acids was used as scaffold. Far-ultraviolet circular dichroism measurements showed that the designed domains had very low
-helicity in a low-conductivity environment in contrast to the scaffold. The secondary structure could be induced by adding salt, giving a structure comparable to the parental molecule. Further studies showed that the new domains were able to bind to an anion exchanger even at pH values down to 5 and 6. Gene fusions between one of the designed domains and different target proteins, such as green fluorescent protein (GFP), maltose binding protein (MBP) and firefly luciferase, were also constructed. These gene products could be efficiently purified from whole cell lysates at pH 6 using anion-exchange chromatography.
Keywords: ion-exchange chromatography/protein A/protein design/Z domain
| Introduction |
|---|
|
|
|---|
High-throughput purification of recombinant proteins on the laboratory and industrial scale requires a general approach that yields a predictable result. Recombinant DNA technology allows the fusion of purification tags to the target protein to alter the properties and generalize and facilitate the recovery process. Affinity tag purification of recombinant fusion proteins was described more than 20 years ago (Uhlen et al., 1983
Ion-exchange chromatography (IEC) is a widely used protein separation technique in both small laboratory-scale and large-scale purifications. IEC is cheap compared with other chromatographic methods and the resins are normally robust and can withstand the harsh CIP conditions. By improving the selectivity for IEC, this system can be an alternative to the traditional affinity systems. One way to improve the purification factor of a target protein is to change the charge distribution on the surface to allow for stronger adsorption to the ion exchanger and thus render washing under more stringent conditions possible. This strategy was used earlier by Egmond et al. (1994)
. A more attractive alternative, in order to avoid alterations of the target protein, is to fuse a charged moiety to the protein of interest. The first ion-exchange handle evaluated was a poly-Arg-tag consisting of six arginines fused to the C-terminal end of human urogastrone (Sassenfeld and Brewer, 1984
). Other positively and negatively charged tails composed of multiple arginines, glutamates or aspartic acids have also been constructed (Dalboge et al., 1987
; Zhao et al., 1990
).
By using a protein domain capable of independent folding for grafting of charges, the potential to achieve a proteolytic stable purification tag with stringent and selective adsorbtion to the matrix should be higher compared with the earlier published unstructured charged tails.
Here we have taken advantage of a stable three-helix bundle protein, Z, for the design of negatively charged purification handles. The Z domain is a compact 58 amino acid (7 kDa) three-helix bundle derived from the B domain of staphylococcal protein A (Nilsson et al., 1987
). It contains no cysteine and is highly soluble and stable against proteolysis in a number of different hosts (Stahl and Nygren, 1997
). In addition, this domain has earlier been shown to be highly permissive to mutations in helices 1 and 2 in studies where it was used as a scaffold for combinatorial mutagenesis to isolate variants with novel binding specificities using phage display selection technology (Nord et al., 1995
, 1997
). The Z domain has also been used successfully for the construction of positively charged purification tags. Despite the high concentration of positively charged amino acids, the newly designed proteins were able to adopt an
-helical fold (Graslund et al., 2000
).
In this work, we used the three-helix bundle domain Z as scaffold for the accommodation of negative charge to allow for anion-exchange chromatography at low pH values. The designed, constructed and produced proteins were thoroughly analysed regarding structure, behaviour and also functionality as purification tags.
| Materials and methods |
|---|
|
|
|---|
Escherichia coli strain RRIDM15 (Ruther, 1982
Assembly of Z variants
Recombinant DNA work was performed essentially as described by Sambrook et al. (1989)
. Oligonucleotides coding for helices 1 and 2 of the three Z variants were assembled in a stepwise fashion analogous to the Z-library constructed by Nord et al. (1995)
. The base compositions of the constructs were verified and the resulting vectors were labelled pKN1-Zacid1 and pKN1-Zacid2, encoding one Z variant each followed by a streptococcal protein G-derived albumin-binding domain (ABD) (Kraulis et al., 1996
).
Construction of expression vectors
The vectors pKN1-Zacid1 and pKN1-Zacid2 were used as templates in PCR {[96°C for 20 s; 55°C for 30 s; 72°C for 90 s (30 times)], 72°C for 7 min} using the primers Soho2, GAATGCGCAACACGATGAAGCCGTAGACAACAAATTCAACAAAGAA, and Grto36, CCGGCCGGCTGCAGTTAATGGTGATGGTGATGGTGCCATTTCGGCGCCTGAGCATCATTTAG. The PCR products were then restricted with FspI and PstI and the genes coding for the Z variants were isolated and ligated with pTrpABD (Kraulis et al., 1996
) that had been cut with the same enzymes. The resulting vectors each code for a Z variant including the trp-leader in the N-terminus followed by a His6-tag in the C-terminus. The expression cassette is under control of the trp-promoter. The different vectors were named pTrp-Zacid1 and pTrp-Zacid2.
For construction of the expression vectors, Zacid2 (without trp-leader and His6-tag) was fused into pET24a+ where the gene is under control of the T7-promotor. The Zacid2 gene was followed by a multi cloning sequence for insertion of different gene products. Zacid2 was PCR amplified from pTrp-Zacid2 using the primers Zau, ACACACTCTAGAAGGTATACATATGGTAGACAACAAATTCAACAAAGAACAGCAGAACGCTGAATACGAAATCGA, and Zan, ACACCAAGGGGCGCGCCGCCGGCGATATCGCATGCCTGCAGGCGGCCGCAAATTCGGTTTCGGCGCCTGAGCATCATTTAGCTTTTTAGCTTCTGCTAGCAAGTT. The resulting PCR product was restricted with XbaI and StyI and ligated with pET24a+ that had been cut with the same enzymes and this vector was named pT7Za2.
The gene encoding maltose binding protein was PCR amplified from pBV102 using the primers MBPU, ACACGCGGCCGCCTGCCAAAATCGAAGAAGGTAAAC, and MBPN, ACACCTGCAGCGAATTAGTCTGCGCGT-CTTTC, and restricted with NotI and PstI before ligated with pT7Za2 cut with the same enzymes. This vector was named pT7ZaMBP and base composition was verified by sequencing.
Construction of the vector encoding the Zacid-GFP fusion protein was performed by cleaving plasmid pEGFP (BD Biosciences Clontech, Palo Alto, CA) with NheI and NotI and ligating the fragment encoding GFP into pT7Za2 that had been digested with the same enzymes. The resulting vector was named pT7ZaGFP. This vector was further used as a template for PCR amplification using the primers ZaDGFPU, ACAGGATCCGGTAGACAACAAATTCAACAAAG, and ZaDGFPN, ACAGGTACCTTCGGCGCCTGAGCATCATT. The resulting PCR product was cleaved with KpnI and BamHI and ligated with pT7ZaGFP cut with the same enzymes. The resulting vector contained the gene coding for a Zadimer at the N-terminal end of GFP and was named pT7ZaZaGFP.
The gene encoding luciferase was PCR amplified from the pPWLTx4 vector using primers EHMA-SacI-24, AAAAAAAAAGAGCTCCATGGAAGACGCCAAAAACATAAAG, and EHMA-HindIII-9, TTGGCAAGCTTACATTTTACACTTTGGACTTTCCGC. The resulting PCR product was cleaved with SacI and HindIII and ligated with pT7Za2 cut with the same enzymes. The resulting vector, pT7ZaLuc, was then used as a template for PCR amplification using the primers ZaDLucU, ACAGAGCTCTGTAGACAACAAATTCAACAAAGA, and ZaDLucN, ACAGAGCTC GGTTTCGGCGCCTGAGCATCAT. The resulting PCR product was cleaved with SacI and ligated with pT7ZaLuc cut with the same enzyme, giving the vector pT7ZaZaLuc.
Production and purification of Zwt, Zacid1 and Zacid2
The pTrp-Z, pTrp-Zacid1 and pTrp-Zacid2 constructs were grown at 37°C for 25 h in 100 ml of TSB+YE medium [30 g/l tryptic soy broth (Lab M, Topley House), 5 g/l yeast extract (Difco), 50 mg/l kanamycin]. Z was purified using IgG affinity chromatography as described by Nilsson et al. (1987)
. Cell cultures containing Zacid1 or Zacid2 were centrifuged and the resulting pellet was resuspended in
20 ml of lysis buffer (6 M GuaHCl, pH 8.0) and kept at 37°C for 2 h prior to centrifugation at 10000 g for 20 min. The supernatants were filtered (0.45 µm) before loading on to a 5 ml TALON column (Clontech Laboratories, Palo Alto, CA) and purified essentially as suggested by the manufacturer.
Additional purification by RP-HPLC was done prior to the structure analysis. Samples were loaded on to a C-18 column (Grace Vydac, Hesperia, CA) at a flow rate of 1 ml/min. The column was previously equilibrated with 20% acetonitrile (AcN) supplemented with 0.25% pentafluoropropionic acid. The separation method included 10 min of isocratic elution with 20% AcN, a linear gradient from 20 to 60% AcN in 30 min followed by 10 min of isocratic elution with 100% AcN.
Circular dichroism measurements of Z, Zacid1 and Zacid2
Data were collected using a Jasco J-720 spectropolarimeter (Jasco, Tokyo, Japan) equipped with a thermostable water-bath for temperature control. The buffer used in all experiments was 10 mM phosphate supplemented with varying amount of KCl, pH 8.0. Data were collected between 190 and 250 nm at 25°C at a scanning speed of 50 nm/min and each spectrum is an average of three consecutive scans. The protein concentration was determined by amino acid analysis of two samples from each preparation.
Anion analysis of Z, Zacid1 and Zacid2
To investigate the behaviour of the Z variants, anion-exchange analysis was performed using the purified proteins. About 1 mg of each protein was loaded on to a 1 ml Resource Q column that had been equilibrated with 5 column volumes (CV) of running buffer (AIEX pH 59.5, 0.05 M 1-methylpiperazine, 0.05 M Bis-Tris, 0.025 M Tris). The column was washed with 1015 CV of running buffer, with subsequent elution with a linear gradient of 01 M NaCl. The length of the NaCl gradient was 20 CV in all experiments and the chromatograms were recorded as the absorbance at 280 nm.
Production of Zacid2 fusion proteins
A colony containing pT7ZaMBP, pT7ZaGFP, pT7ZaLuc, pT7ZaZaGFP or pT7ZaZaLuc was grown overnight in a shake flask at 37°C in tryptic soy broth (Difco, Detroit, MI) supplemented with 5 g/l yeast extract (Merck, Darmstadt, Germany) and 50 mg/l kanamycin. On the following morning, 100 ml of fresh medium were inoculated with 1 ml of the overnight culture. The cultures were incubated at 37°C until OD600 nm = 1, when isopropyl-ß-D-thiogalactopyranoside (IPTG) (Apollo Scientific, Whaley Bridge, UK) was added to a final concentration of 1 mM and the incubation was continued for 4 h. One variant of each of the cultivations was harvested by centrifugation at 6000 g for 10 min. The resulting pellets were resuspended in 30 ml of 20 mM Bis-Tris, pH 6.0 and frozen for later use. To measure proteolysis, double samples from the cultivations were incubated for an additional 60 min. Chloramphenicol (100 mg/l) was added to stop protein synthesis. Every tenth minute, aliquots of cell suspensions were taken out, boiled in SDS buffer and analysed by SDSPAGE.
Purification of Zacid2 fusion proteins
The cell cultures were thawed on ice and disrupted by sonication. Insoluble material was removed by centrifugation at 10 000 g for 10 min at 4°C, followed by filtration through a 0.45 µm filter. A 1 ml volume of the lysate was loaded on to a 1 ml Resource Q anion-exchange column previously equilibrated with 10 CV (10 ml) of running buffer (20 mM Bis-Tris, pH 6). After the loading step, unbound material was washed out with 10 CV (10 ml) of running buffer and weakly bound material was eluted with 150 mM NaCl. The target proteins were eluted using a linear gradient of NaCl from 150 mM to 1 M NaCl over 30 CVs (30 ml).
| Results |
|---|
|
|
|---|
Rationale for the design of Zacid variants
In this work we used the Z domain as a scaffold for designing highly charged protein domains. In order to create a negatively charged surface, appropriate amino acids in helices 1 and 2 were exchanged to negatively charged amino acids, glutamic acid or aspartic acid. The shorter carbon chain in aspartic acid makes it more susceptible to acid hydrolysis than glutamic acid, since it more easily forms a cyclic intermediate in the hydrolysis by binding to the backbone (Creighton, 1993
). Glutamic acid is also found to have a higher propensity to form
-helices than aspartic acid (O'Neil and DeGrado, 1990
). Although glutamic acid residues in proteins have slightly higher pKa values than aspartic acids (Forsyth et al., 2002
), glutamic acid was chosen to be used.
For possible charge substitution, 13 positions, distributed over the first two helices constituting the Fc binding surface of the Z domain and in earlier work shown to be highly permissive to mutations, were chosen.
Two basic amino acids on the surface of helix 2 were the first to be exchanged (R27, K35). Two amino acids in helix 1, that when exchanged were expected to give the largest patches of negative charge, were also exchanged to glutamic acid (F13, L17). This gave rise to Zacid1, a variant with four extra glutamic acids (Figure 1).
|
A second variant containing even more glutamic residues was also constructed. This variant was called Zacid2 and contains 10 extra glutamic acids compared with Z (Figure 1). Three of the 13 surface amino acids in Z were left unmodified: E24 and E25 since they already are glutamic acids and H18 as it is predicted to form the C-cap of helix 1 and thereby help in stabilizing the protein (Olszewski et al., 1996
The DNA sequences encoding the two mutated proteins, Zacid1 and Zacid2, were fitted with codons encoding a hexahistidyl tag in their C-terminal end in order to make it possible to purify them through immobilized metal affinity chromatography (IMAC) (Porath et al., 1975
).
Expression and purification of Z variants
Zacid1 and Zacid2 were successfully expressed as intracellular His-tagged fusion proteins in E.coli and purified to 85 and 70% purity, respectively, using IMAC (data not shown). The material from the initial purification of the two variants was further purified by RP-HPLC to >95% purity (data not shown).
Structural characterization of Z, Zacid1 and Zacid2
In order to characterize the secondary structure of the Z variants, their absorption of far-ultraviolet circular polarized light was measured between 190 and 250 nm. The CD spectra collected for Z, Zacid1 and Zacid2 are shown in Figure 2. The CD spectrum collected for Z reveals a molecule with an
-helical structure (Figure 2A). This is in accordance with the NMR stucture determined by Tashiro et al. (1997)
assigned to 65%
-helicity. The CD spectra collected for Zacid1 and Zacid2 (Figure 2B and C, Table II) in a low-conductivity solution resemble a random coil conformation. In an attempt to shield the charges and thereby stabilize the structure, increasing amounts of KCl were added to Zacid1 and Zacid2 and new CD spectra were collected.
|
|
In KCl of
3 M, the spectrum of Zacid1 is similar to that of the parental Z scaffold (Figure 2B, Table II). On adding KCl to Zacid2, the structure is also somewhat stabilized, but even at 4.5 M KCl the structure does not adopt the same degree of
-helicity as the parental Z (Figure 2C, Table II). Analyses of proteolytic degradation of the fusion proteins
To analyse the proteolytic stability of the Z variants, producing E.coli cells were incubated at 37°C. In order to inhibit further protein synthesis, chloramphenicol was added to the suspension. No proteolyses could be detected by SDSPAGE after 60 min of incubation at 37°C (data not shown).
Anion-exchange chromatographic characterization of the Z variants
The adsorption characteristics of the Zacid variants on an anion exchanger were investigated. At pH 7, Z and the acidic variants were quantitatively bound to the positively charged resin, as shown in Figure 3. Using linear NaCl gradient elution, Z was eluted at a conductivity of 8 mS/cm (Figure 3A), whereas Zacid1 was more tightly bound to the ion-exchanging groups and therefore eluted at an NaCl concentration corresponding to 34 mS/cm (Figure 3B). The most negatively charged variant, Zacid2, was eluted at 48 mS/cm (Figure 3C). At pH 6 the Z protein was only detected in the flow-through, whereas both Zacid1 and Zacid2 were quantitatively adsorbed. Both mutants were eluted at lower NaCl concentrations than at pH 7, corresponding to 23 and 40 mS/cm, respectively (Figure 3B and C). These ion-exchange results showed that Z was negatively charged at pH 7 but positively charged at pH 6. Zacid1 and Zacid2, on the other hand, were negatively charged both at pH 6 and 7. When the pH of the running buffer is lowered to 5, Zacid1 was not adsorbed, whereas Zacid2 was still bound to the matrix and eluted at a conductivity of 24 mS/cm. At pH 4 all three Z variants were detected in the flow-through (Figure 3AC).
|
Anion-exchange chromatographic characterization of Zacid fusion proteins
In order to evaluate the usefulness of the Zacid2 domain as a purification handle, fusion proteins consisting of Zacid2 as a genetic fusion to green fluorescent protein (GFP) (calculated pI = 5.59), firefly luciferase (Luc) (calculated pI = 6.0) and maltose binding protein (MBP) (calculated pI = 5.52), were also expressed and purified by anion-exchange chromatography (Table I). The influence of the conductivity in the washing steps was investigated by the addition of NaCl to the washing buffer while performing the purification. This led to the conclusion that a running pH of 6.0 and a conductivity of 18 mS/cm were conditions, very stringent and also mild, that could be used for the quantitative recovery of the fusion protein from the anion-exchange resin (Figure 4). By using a running buffer with high conductivity we were able to omit binding of undesired proteins to the matrix. Zacid2Luc and Zacid2MBP were eluted at about the same conductivity, 18.7 and 18.5 mS/cm, respectively (Table I). Zacid2GFP was eluted at a higher conductivity (20.5 mS/cm, Table I and Figure 4A).
|
|
In order to reveal if dimerization of the Zacid2 domain would improve the adsorption to the matrix, genetic constructs with two Zacid2 domains followed by the target molecule were constructed. Interestingly, all target proteins fused to a Zacid2 dimer were eluted at a significantly higher conductivity, Zacid2Zacid2 GFP at 28 mS/cm and Zacid2Zacid2Luc at 25.7 mS/cm (Table I and Figure 5A).
|
To analyse the purity of the eluted target proteins, samples from the purification were analysed by SDSPAGE together with the cell lysate and flow-through fractions (Figures 4B, 5B and 6). The eluted fractions were shown to contain a major protein band of the expected molecular size. By evaluating the SDSPAGE results with QuantityOne software we were able to conclude that >90% of the Zacid2 fusion protein was adsorbed on the column. Eluted material was shown to contain a protein band corresponding to Zacid2 fusion protein, of
90% purity. The eluted material was also analysed by agarose gel electrophoresis to detect co-eluted nucleic acids. As can be seen in Figures 4 and 5, the nucleic acids are eluted at a higher conductivity and thereby do not contaminate the target protein. Since the excitation wavelength of GFP is included in the UV light used when detecting nucleic acids, the fractions containing fusion proteins with GFP, ZacidGFP and ZacidZacid GFP, are also excited on the agarose gel (Figures 4 and 5).
|
| Discussion |
|---|
|
|
|---|
In this work, negative charge was introduced, by protein design, on to the surface of a highly ordered and stable three-helix bundle domain from the bacterial receptor protein A. The aim with this strategy was to create charged purification tags with strong adsorption on an ion-exchange resin for use in protein purification of recombinantly produced protein products.
The domain Z is normally slightly acidic (pI 5.16) but could be made more acidic by introducing negatively charged amino acids. The use of a charged Z domain as compared with charged peptides has several advantages. First, the Z domain is highly soluble and can increase the solubility of fusion proteins (Samuelsson et al., 1994
). Second, the introduction of charges into a highly ordered structure allows the charge to be distributed in a predicted way over a large surface, giving a well-defined patch for interaction with the matrix which will probably increase the strength of the interaction. Third, amino acids in ordered structures are poorly recognized by trypsin-like proteases (Wang et al., 1989
; Jonasson et al., 1996
).
Both new variants were successfully produced in E.coli without being subjected to measurable proteolysis, indicating that they were proteolytically stable despite their high content of negatively charged amino acids. However, far-ultraviolet CD measurements on the purified acidic mutants showed that their secondary structure was far more unstructured than that of their parental molecule Z. Interestingly, by adding salt to the buffer, the
-helicity of the Zacid variants could be partly recreated. It has been shown earlier that the Z domain is permissive to numerous changes in the amino acid content (Nord et al., 1995
). However, these data suggest that multiple negative charges on the surface of the molecule are more deleterious to the structure than positive charges (Graslund et al., 2000
). The highly charged and unstructured properties of the acidic variants are also reflected in the migration in the SDSPAGE analysis of the various variants (data not shown). The theoretical molecular weights differ from the apparent sizes, judged by the electrophoresis, increasingly with charge.
A comparison between the wild-type Z domain and the engineered variants in anion-exchange experiments demonstrated a dramatic difference in chromatographic performance. At pH 7 the acidic variants were eluted at much higher salt concentrations than the wild-type variant and at lower pH values only the engineered variants could be adsorbed on the chromatographic resin (Table I, Figure 3). These ion-exchange results showed that Z was negatively charged at pH 7 but positively charged at pH 6. The pH-dependent binding properties followed the expected differences in surface charge properties. Even though the highly charged mutants are unstructured in a low salt environment, they adsorb tightly on an anion-exchange resin and are easily eluted by merely increasing the salt concentration.
The high conductivity needed for elution of the domains indicates that the proteins are able to adopt an ordered structure, displaying a well-defined charged surface when binding to the matrix. This hypothesis was evaluated by eluting the protein in denaturating conditions using 8 M urea. In that experiment the domain was eluted at a conductivity below 10 mS/cm (data not shown). Additional support for the suggestion of an ordered structure is obtained from the CD data, indicating that a charged environment aids in accommodating an
-helical structure.
For further evaluation of the usefulness of negatively charged purification handles, we chose to work with the most negatively charged domain, Zacid2. Owing to the low
-helcity of the purification tags, high proteolysis could be expected. Therefore, proteolytic analyses of the different protein products were performed. Interestingly, no measurable degradation could be detected.
When fusing different target proteins to Zacid2, it was possible to perform the entire anion-exchange chromatographic purification procedure at pH 6.0 with a conductivity as high as 18 mS/cm in the washing buffer. These parameters resulted in an efficient adsorption of the protein on the anion-exchange column and allowed for effective washing without loss of material. Using a gradient elution (0.151 M, 30 CV), nucleic acids adsorbed on the anion-exchange resin could be quantitatively separated from the Zacid2 fusions (Figure 4).
The set of parameters optimized for Zacid2-GFP was also used for the purification of Zacid2-MBP and Zacid2-Luc fusion proteins. Zacid2-MBP and Zacid2-Luc were adsorbed equally strongly on the anion exchange resin even though their pI values differ by 0.4 units (Table I). This suggests that the N-terminal Zacid domain is the main factor responsible for the adsorption. Zacid2-GFP, however, which has a pI only 0.1 lower than Zacid-MBP, was adsorbed much more strongly. This might be because GFP has a compact structure shielded from the charged Zacid domain.
In an attempt to achieve stronger adsorption to the anion exchange resin, a Zacid2-dimer was fused to the target protein. The same purification parameters as for the monomers were used when purifying Zacid2Zacid2GFP (Figure 5) and Zacid2Zacid2Luc (data not shown). As expected, these proteins were eluted at a much higher conductivity.
Here we have designed and thoroughly characterized negatively charged protein domains intended for anion-exchange chromatography. These handles, despite their disordered structure in low salt solution, have been shown to adsorb efficiently on an anionic matrix and elute quantitatively with elevated conductivity. A number of different target proteins have been purified. The result suggests that it should be possible to utilize the same set of generic parameters with regard to conductivity and pH of the feed stream and also the running buffer in the purification of a wide range of Zacid2 fused target proteins.
| Acknowledgments |
|---|
The authors thank Dr N.Nourizad for kindly providing the vector and primers for the PCR cloning of luciferase. This work was financially supported by grants from the Swedish Centre for Bioprocess Technology (CBioPT) and the Knut and Alice Wallenberg Foundation.
| References |
|---|
|
|
|---|
Creighton,T.E. (ed.) (1993) Proteins: Structure and Molecular Properties. Freeman, New York.
Dalboge,H., Dahl,H.-H.M., Pedersen,J., Hansen,J.W. and Christensen,T. (1987) Bio/Technology, 5, 161164.[CrossRef]
Egmond,M.R., Antheunisse,W.P., van Bemmel,C.J., Ravenstein,P., de Vlieg,J., Peters,H. and Branner,S. (1994) Protein Eng., 7, 793800.
Ford,C.F., Suominen,I. and Glatz,C.E. (1991) Protein Expr. Purif., 2, 95107.[CrossRef][Medline]
Forsyth,W.R., Antosiewicz,J.M. and Robertson,A.D. (2002) Proteins, 48, 388403.[CrossRef][Web of Science][Medline]
Gilson,M.K. and Honig,B.H. (1987) Nature, 330, 8486.[CrossRef][Medline]
Graslund,T., Lundin,G., Uhlen,M., Nygren,P.A. and Hober,S. (2000) Protein Eng., 13, 703709.
Jonasson,P., Nilsson,J., Samuelsson,E., Moks,T., Stahl,S. and Uhlen,M. (1996) Eur. J. Biochem., 236, 656661.[Web of Science][Medline]
Kraulis,P.J., Jonasson,P., Nygren,P.A., Uhlen,M., Jendeberg,L., Nilsson,B. and Kordel,J. (1996) FEBS Lett., 378, 190194.[CrossRef][Web of Science][Medline]
Nicholls,A. and Honig,B. (1991) J. Comput. Chem., 12, 435445.[CrossRef]
Nicholls,A., Sharp,K.A. and Honig,B. (1991) Proteins, 11, 281296.[CrossRef][Web of Science][Medline]
Nilsson,B., Moks,T., Jansson,B., Abrahmsen,L., Elmblad,A., Holmgren,E., Henrichson,C., Jones,T.A. and Uhlen,M. (1987) Protein Eng., 1, 107113.
Nilsson,J., Stahl,S., Lundeberg,J., Uhlen,M. and Nygren,P.A. (1997) Protein Expr. Purif., 11, 116.[CrossRef][Web of Science][Medline]
Nord,K., Gunneriusson,E., Ringdahl,J., Stahl,S., Uhlen,M. and Nygren,P.A. (1997) Nat. Biotechnol., 15, 772777.[CrossRef][Web of Science][Medline]
Nord,K., Nilsson,J., Nilsson,B., Uhlen,M. and Nygren,P.A. (1995) Protein Eng., 8, 601608.
Olszewski,K.A., Kolinski,A. and Skolnick,J. (1996) Proteins, 25, 286299.[CrossRef][Web of Science][Medline]
O'Neil,K.T. and DeGrado,W.F. (1990) Science, 250, 646651.
Porath,J., Carlsson,J., Olsson,I. and Belfrage,G. (1975) Nature, 258, 598599.[CrossRef][Medline]
Ruther,U. (1982) Nucleic Acids Res., 10, 57655772.
Sambrook,J., Fritch,FE., Maniatis,T. (1989) Molecular Cloning. A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Samuelsson,E., Moks,T., Nilsson,B. and Uhlen,M. (1994) Biochemistry, 33, 42074211.[CrossRef][Medline]
Sassenfeld,H.M. and Brewer,S.J. (1984) Bio/Technology, 2, 7680.
Stahl,S. and Nygren,P.A. (1997) Pathol. Biol. (Paris), 45, 6676.[Medline]
Tashiro,M., Tejero,R., Zimmerman,D.E., Celda,B., Nilsson,B. and Montelione,G.T. (1997) J. Mol. Biol., 272, 573590.[CrossRef][Web of Science][Medline]
Terpe,K. (2003) Appl. Microbiol. Biotechnol., 60, 523533.[CrossRef][Web of Science][Medline]
Uhlen,M., Nilsson,B., Guss,B., Lindberg,M., Gatenbeck,S. and Philipson,L. (1983) Gene, 23, 369378.[CrossRef][Web of Science][Medline]
Wang,M., Scott,W.A., Rao,K.R., Udey,J., Conner,G.E. and Brew,K. (1989) J. Biol. Chem., 264, 2111621121.
Weiner,S.J., Kollman,P.A., Case,D.A., Singh,U.C., Ghio,C., Alagona,G., Profeta,S.J. and Weiner,P. (1984) J. Am. Chem. Soc., 106, 765784.[CrossRef]
Weiner,S.J., Kollman,P.A., Nguyen,D.T. and Case,D.A. (1986) J. Comput. Chem., 7, 230252.[CrossRef][Web of Science]
Zhao,J.Y., Ford,C.F., Glatz,C.E., Rougvie,M.A. and Gendel,S.M. (1990) J. Biotechnol., 14, 273283.[CrossRef][Web of Science][Medline]
Received July 6, 2004; revised November 1, 2004; accepted November 22, 2004.
Edited by Lars Baltzer
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


, 3.5, small diamonds, 4, , 4.5 M). Z gives a spectrum typical for helical conformation while the acidic variants resemble more of a random coil conformation in low-conductivity environment. The negative charges in the Zacid variants probably repel each other and destabilize the structure. The
222 nm) for the Z variants


