Skip Navigation


PEDS Advance Access originally published online on January 12, 2004
Protein Engineering Design and Selection 2004 17(2):113-117; doi:10.1093/protein/gzh016
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
17/2/113    most recent
gzh016v2
gzh016v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Viviani, V. R.
Right arrow Articles by Ohmiya, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Viviani, V. R.
Right arrow Articles by Ohmiya, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2004 Oxford University Press

The influence of the region between residues 220 and 344 and beyond in Phrixotrix railroad worm luciferases green and red bioluminescence

Vadim R. Viviani1,2,3, Antonio Joaquim da Silva Neto2 and Yoshihiro Ohmiya4

1Department of Molecular and Cellular Biology, Harvard University, Cambridge, MA, USA, 2Department of Biology, Instituto de Biociências, Universidade Estadual de São Paulo (UNESP), Rua 24 A, PO Box 199, Rio Claro, SP, Brazil and 4Cell Dynamics Research Group, Division of Human Life Technology, National Institute of Advanced Industrial Science and Technology, Osaka, Japan

3 To whom correspondence should be addressed at: Department of Biology, Instituto de Biociências, Universidade Estadual de São Paulo (UNESP), Rua 24 A, 1515, Bela Vista, Rio Claro, SP, 13506-900, Brazil e-mail: viviani{at}rc.unesp.br


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
To find the regions having a major influence on the bioluminescence spectra of railroad worm luciferases, we constructed new chimeric luciferases switching the fragments from residues 1–219 and from 220–545 between Phrixotrix viviani (PxvGR; {lambda}max = 548 nm) green light-emitting luciferase and Phrixothrix hirtus (PxhRE; {lambda}max = 623 nm) red light-emitting luciferases. The emission spectrum ({lambda}max = 571 nm) and KM for luciferin in the chimera PxRE220GR (1–219, PxhRE; 220–545, PxvGR) suggested that the region above residue 220 of PxvGR had a major effect on the active site. However, switching the sequence between the residues 220–344 from PxvGR luciferase into PxhRE (PxREGRRE) luciferase resulted in red light emission ({lambda}max = 603 nm), indicating that the region 220–344 by itself does not determine the emission spectrum. Furthermore, the sequence before residue 220 of the green-emitting luciferase is incompatible for light emission with the sequence above residue 220 of PxhRE. These results suggest that the fragments before and after residue 220, which correspond to distinct subdomains, may fold differently in the green- and red-emitting luciferases, affecting the active site conformation.

Keywords: bioluminescence/luciferases/Phrixotrix/railroad worms


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Beetle luciferases elicit a wide range of bioluminescence colors ranging from green to red using the same luciferin substrate (Viviani, 2002Go). Despite this variety, most studies aiming at understanding the relationship between structure and emission spectra have focused on the firefly luciferases that emit yellow–green light under physiological conditions (Kajiyama and Nakano, 1991Go; Mamaev et al., 1996Go; Ohmiya et al., 1996Go; Branchini et al., 2001Go; Willey et al., 2001Go) and four click beetle isoenzymes (Wood et al., 1989Go). The firefly luciferase crystal structure, solved in the absence of substrates, shows a main N-terminal (1–435) domain bound by a flexible loop (436–440) to a smaller C-terminal domain (441–550) (Conti et al., 1996Go). The facing surfaces of these domains contain many conserved residues among AMP/CoA-ligases, forming a cleft that was proposed to constitute the active site. The structure of firefly luciferase in the presence of bromoform and the three-dimensional structure of phenylalanine CoA synthetase in the presence of phenylalanine (Conti et al., 1997Go) provided a theoretical basis for two active site models (Branchini et al., 1998Go; Sandalova and Ugarova, 1999Go). Three mechanisms have been proposed to explain color differences in beetle luciferases: (i) non-specific interactions, especially the solvent effect (DeLuca, 1969Go) and the orientation polarizability of the active site microenvironment around the excited oxyluciferin (Ugarova and Brovko, 2002Go); (ii) specific interactions of luciferase residues with oxyluciferin, such as basic residues assisting the tautomerization between a keto (red emitter) and enol (green–yellow emitter) form of excited oxyluciferin (White and Branchini, 1975Go; Viviani and Bechara, 1995Go); however, recent studies using the 5,5-dimethyloxyluciferin analog showed that the keto form of oxyluciferin can emit either yellow–green or red light depending on the luciferase, making the tautomerization process no longer a necessary condition for red light emission (Branchini et al., 2002Go); and (iii) the conformation of the active site affecting the freedom of rotation of the oxyluciferin thiazolinic rings (McCapra et al., 1994Go).

Among all the beetle luciferases, the Phrixotrix railroad worm luciferases are the most spectacular because they are the only ones that naturally emit red light in addition to the usual yellow–green bioluminescence found in most beetle luciferases. They offer unique models to investigate the relationship between structure and bioluminescence colors, being potentially useful as reporter genes for biotechnological and biomedical purposes. To address the relationship between structure and bioluminescence color in beetle luciferases, we have cloned the cDNAs for Phrixotrix viviani green-emitting (PxvGR) and Phrixotrix hirtus red-emitting (PxhRE) railroad worm luciferases (Viviani et al., 1999aGo) in addition to other beetle luciferases (Viviani et al., 1999bGo; Ohmiya et al., 2000Go). Using site-directed mutagenesis and protein chimerization techniques, we found that the region before residue 344 determines the bioluminescence spectrum in railroad worm luciferases (Viviani and Ohmiya, 2000Go). We also found that the invariant residue R215 (Viviani and Ohmiya, 2000Go) and the conserved T226 in pH-insensitive luciferases (N229 in pH-sensitive luciferases) (Viviani et al., 2001Go) are key residues that may interact, keeping a proper active site conformation for green light emission (Viviani et al., 2002Go).

To narrow down the region of the luciferase structure determining the bioluminescence spectra, we constructed new luciferase chimeras by combining the fragments before and after residue 220 of P.viviani and P.hirtus railroad worm luciferases and analyzed their effect on the bioluminescence spectra and kinetic properties.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Reagents

Isopropyl-ß-D-thiogalactopyranoside (IPTG), dithiothreitol (DTT), guanidine chloride, ampicillin, Triton X-100, coenzyme-A (CoA) and adenosine triphosphate (ATP) were obtained from Sigma (St Louis, MO), D-luciferin (potassium salt) from Promega (Madison, WI), restriction enzymes and Taq polymerase from New England Biolabs (Cambridge, MA) and Sephacryl S-300 from Amersham (Amersham,UK).

cDNAs

The cDNAs for P.hirtus red-emitting luciferase (PxhRE) and P.vivianii green-emitting luciferase (PxvGR) were previously cloned in our laboratories (Viviani et al., 1999aGo,b). All cDNAs, with the exception of PxhRE, were in the pBluescript vector and propagated in Escherichia coli strain XL1-Blue. PxhRE cDNA was in the expression vector pTHis (Invitrogen) and was propagated in E.coli strain BL21.

Site-directed mutagenesis

Site-directed mutagenesis was performed using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). The plasmids containing the luciferase cDNAs were amplified using Pfu turbo polymerase and two complementary primers containing the desired mutation, using a thermal cycler (one cycle 95°C; 12 cycles 95°C, 30 s, 55°C, 1 min and 68°C, 12 min). After amplification, mutated plasmids containing staggered nicks were generated. The products were treated with DpnI in order to digest non-mutated parental plasmids and used directly to transform E.coli XL1-Blue cells. The primer PxhRE S220R and its reverse complement was used: 5' CGTCCATAGCAGAGATCCCATCTATGG 3'.

Chimeric luciferases

Luciferase chimeras were constructed according to Figure 1. A BamHI restriction site was inserted through site-directed mutagenesis in pBl-PxhRE to generate pBl-PxhRE-BamHI. The resulting substitution S220R in PxhRE luciferase had no effect on the bioluminescence spectrum. The plasmid pBl-PxvGR has a BamHI restriction site in the corresponding position. The plasmids pBl-PxvGR and pT-PxhRE-BamHI were digested with BamHI and the resulting fragments were ligated generating the chimeras PxRE220GR and PxGR220RE. In order to produce the chimera PxREGRRE, a PstI restriction site was introduced in PxRE220GR generating PxRE220GR-PstI. After digestion of PxhRE and PxRE220GR-PstI with PstI, the fragment of 1.1 kb of PxRE220GR was inserted in the linearized plasmid containing only the 3'-terminal portion of PxhRE.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1. Scheme for the construction of Phrixothrix railroad worm chimeric luciferases and western blot using polyclonal Photinus pyralis anti-luc showing the expression of wild-type and chimeric luciferases in bacterial extracts: A, P.pyralis luciferase, 15 ng; B, PxhRE; C, PxRE220GR; D, PxGR220RE; E, PxREGRRE; F, PxGRREGR.

 
Sequencing

The mutants and chimeras were sequenced by the dideoxy chain termination method (Sambrook et al., 1989Go) using an ABI PRISM dye terminator cycle sequencing kit (Applied Biosystems, Foster City, CA) specifically developed for the ABI PRISM 377 automatic sequencer (Perkin-Elmer, Norwalk, CT). Universal SK and KS primers and the following primers were designed to sequence the constructs and mutations: PxhRE, 5' CCATCTATGGTAATCGTATTGCTCC 3'; PxvGR, 5' CAAGTTTCAGTTAATCCATAT 3'.

Extraction and partial purification of luciferases

For luciferase preparations, 50–100 ml of LB culture were grown at 37°C up to OD600 = 0.3–0.5 and then induced with 1 mM IPTG until OD600 = 1.7–1.9 at 25°C. Cells were harvested by centrifugation at 5000 g for 15 min and resuspended in extraction buffer (0.1 M sodium phosphate buffer, 1 mM EDTA, 1 mM DTT and 1% Triton X-100, 10% glycerol and protease inhibitor cocktail, pH 7.5), sonicated six times with 10 s pulses and centrifuged at 15 000 g for 15 min at 4°C. The supernatant was precipitated with ammonium sulfate and the precipitate between 55 and 70% was resuspended in extraction buffer and stored at –20°C. PxhRE and PxvGR luciferases were further purified by gel filtration using a Sephacryl S-300 column. The bioluminescence spectra of crude preparations and partially purified luciferases were indistinguishable.

Measurement of luminescence intensities

Bioluminescence intensities were measured in a custom-made photometer (Mitchell and Hastings, 1971Go). The assays were performed by mixing 5 µl of 40 mM ATP–80 mM MgSO4 with a solution consisting of 10 µl of crude extract–luciferase and 85 µl of 0.5 mM luciferin in 0.1 M Tris–HCl, pH 8.0.

KM determination

For luciferin KM determination, 5 µl of 40 mM ATP–80 mM MgSO4 were mixed with a solution consisting of 10 µl of luciferase and 85 µl of 0.1 M Tris–HCl buffer, pH 8.0, containing luciferin at concentrations between 0.01 and 1 mM (final concentration). Each assay was performed in triplicate. The KM values were calculated from Lineweaver–Burk plots using peak initial intensity values (I0) as a measure of V. The half-life of luminescence is the time necessary for the decay of luminescence intensity from the peak to the half-value.

Bioluminescence spectra

Bioluminescence spectra were recorded using a Fluoromax Spex spectrofluorimeter according to Viviani et al. (1999aGo,b). The emission spectra were autocorrected for instrument photosensitivity. For the in vitro bioluminescence, 50–100 µl of crude extracts were mixed with 900–950 µl of assay solution (0.5 mM luciferin, 2 mM ATP, 4 mM MgSO4, 0.5 mM CoA and 1% Triton X-100 in 0.1 M Tris–HCl, pH 8.0).

Western blotting

In order to check the expression of wild-type and chimeric luciferases, SDS–PAGE followed by western blotting were performed. Crude extracts were filtered using Microcon 100 kDa molecular weight cut-off filters and concentrated using 50 kDa cut-off filters. The denatured samples were then applied to SDS gels and electroblotted on to nitrocellulose membranes. The membranes were first incubated with firefly luciferase polyclonal primary antibody (dilution: 1:3000) and then with anti-rabbit horeseradish peroxidase (HRP) labeled secondary antibody (dilution: 1:5000) and revealed by chemiluminescence using an ECL western blotting kit (Amersham) according to the manufacturer’s instructions.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Influence of the sequence between residues 220 and 344 on bioluminescence spectra

Previously, we found through the construction of the chimeras PxREGR and PxGRRE that the region before residue 344 determines the bioluminescence spectra in railroad worm luciferases (Viviani and Ohmiya, 2000Go). The KM for luciferin and the kinetic profiles of these chimeras, reported here, are closer to the values observed for the luciferase which contributed the region 1–344 (Table I), suggesting that the region before residue 344 also has a major influence on the structure of the active site and hence the bioluminescence color.


View this table:
[in this window]
[in a new window]
 
Table I.. Bioluminescence spectra and kinetic properties of wild-type and chimeric Phrixothrix luciferases
 
In order to delimit the region of the N-terminal sequence prior to residue 344, which determines the spectra of railroad worm luciferases, chimeric proteins using the fragment from residues 1–219 from the red-emitting luciferase and from residues 220–545 from the green-emitting luciferase (PxRE220GR) and vice versa (PxGR220RE) were constructed (Figure 1). The chimera PxRE220GR produced bioluminescence with a spectrum centered at 571 nm (Figure 2). This result shows that the region above residue 220 has a greater effect since the emission peak was energetically closer to the value of PxvGR luciferase than to PxhRE luciferase (Table I). Similarly, the KM value for luciferin and the half-life of luminescence were also closer to those reported for PxvGR luciferase than for PxhRE luciferase (Table I), suggesting that the affinity and therefore the general conformation of the active site for this chimera resemble those of PxvGR luciferase.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2. In vitro bioluminescence spectra of wild-type PxvGR and PxhRE luciferases and chimeras RE220GR and REGRRE. The spectra of PxvGR and PxhRE were extracted from Viviani and Ohmiya (2000Go). All spectra are auto-corrected for the equipment photosensitivity and normalized for intensity.

 
Therefore, to see if the region 220–344 was the main bioluminescence color determinant, we constructed chimeras replacing the sequence 220–344 from one luciferase into the other. To our surprise, the red-emitting luciferase containing the fragment from residues 220–344 of the green-emitting luciferase (PxREGRRE) emitted red light (Figure 2) instead of yellow–green light, showing that the primary sequence of this fragment by itself does not determine bioluminescence colors in railroad worm luciferases.

Impact of the fragments above residue 220 of PxhRE on the luciferase activity

It is noteworthy that the PxGR220RE and PxGRREGR chimeric luciferases were found to be inactive for light emission. Since the wild-type and chimeric luciferases expressed similar levels of protein, as can be seen by western blotting (Figure 1), these results suggest that the absence of bioluminescence is due to severe impairment of luciferase activity.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Red bioluminescence is unusual among beetle luciferases. In firefly luciferases, red light may result as a consequence of denaturation, for example, by changes of pH or temperature (Seliger and McElroy, 1964Go). On the other hand, red light emission in Phrixotrix luciferases is not merely the result of denaturation but rather the result of the evolutionary optimization of the active site for production of red bioluminescence. This is attested by its narrow spectrum and by the lack of temperature effects on the shape and position of the spectrum (results not shown). Moreover, in the yellow–green-emitting luciferases, there is a general trend for red shifts upon mutations. In contrast, in Phrixotrix red-emitting luciferase, no single substitution has ever resulted in a substantial change of color (>10 nm) of the bioluminescence, suggesting that the active site conformation for red light emission might be in the most relaxed conformation achievable by beetle luciferases (Viviani, 2002Go).

Considering that the region above residue 220 has a significant effect on the emission spectrum of PxRE220GR whereas the region beyond 344 has no effect on the emission spectra of railroad worm luciferases, it is remarkable that the region 220–344 does not have a major influence. Furthermore, the lack of activity of the chimeras containing the fragments above residue 220 of PxhRE luciferase is also noteworthy. These results suggest that there could be considerable differences in the relative conformation assumed by the fragments before and above residue 220 in the green- and red-emitting luciferases.

In the three-dimensional structure of firefly luciferase, the region corresponding to residues 221–352 of railroad worm luciferases corresponds to the sub-domain B (Conti et al., 1996Go). Many important residues affecting bioluminescence color and activity in firefly luciferases, including the putative luciferin binding peptide 244HHGF247 (Branchini et al., 1998Go), are found in this sub-domain. In click beetle luciferases, the sequence between residues 223 and 247 was found to be the main determinant of bioluminescence colors in those luciferases (Wood et al., 1990Go). Therefore, subdomain B could be considered as a surface containing important residues and motifs interacting with excited oxyluciferin. The regions corresponding to residues 70–220 and 355–436 correspond to subdomains A and C, respectively. Important residues are also found in the subdomains A, C, D and E of firefly luciferases. The luciferin binding site was suggested to be located in a depression formed by the packing of subdomain B against the subdomains A and C. The proper packing of these sub-domains must be critical for the active site formation, by positioning key residues and creating a favorable microenvironment for bioluminescence. In the green-emitting luciferase, the conformation assumed by the fragment 220–344 or some of its motifs in relation to other sub-domains could be considerably different from that of the red-emitting luciferase. In the chimera PxREGRRE the fragment 220–344 of the green-emitting luciferase evidently assumes a similar configuration to that found in the wild-type PxhRE red-emitting luciferase. However, in the chimeras PxGR220RE and PxGRREGR the fragments above residue 220 of the red-emitting luciferase could not be properly folding with the sub-domains of the green emitting luciferase, resulting in impairment of bioluminescent activity. Recently, Zako et al. (2003Go) showed that firefly luciferase retains a basal activity and emits red light on removal of the C-terminal domain, indicating that the C-terminal domain is somehow recruited for efficient green light emission. The three-dimensional structure of acetyl-CoA synthetase also suggests that the rotation of the C-terminal domain upon CoA binding might be an important step for the second half-reaction catalyzed by AMP-ligases, i.e. the oxidation step in beetle luciferases. Overall, these results are consistent with major structural rearrangements between the green- and red-emitting luciferases.


    Acknowledgements
 
We are grateful to Dr Thérèse Wilson and to Professor J.W.Hastings for discussions and suggestions. We also are grateful to Professor Craig Hunter (Harvard University) for the use of his CCD camera and to Michael Hamblin (Massachussets General Hospital, Boston, MA) for the use of his refrigerated CCD camera. This work was supported by grants from the US National Science Foundation (99-82880), the Japan Society for the Promotion of Science and the Fundação de Àmparo à Pesquisa do Estado de São Paulo (FAPESP).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Branchini,B.R., Magya,R.A., Murtishaw,M.H., Anderson,S.M. and Zimmer,M. (1998) Biochemistry, 37, 15311–15319.[CrossRef][Medline]

Branchini,B.R., Magyar,R.A., Murtishaw,M.H. and Portier,N.C. (2001) Biochemistry, 40, 2410–2418.[CrossRef][Medline]

Branchini,B.R., Murtiashaw,M.H., Magyar,R.A., Portier,N.C., Ruggiero,M.C. and Stroh,J.G. (2002) J. Am. Chem. Soc., 124, 2112–2113.[CrossRef][Web of Science][Medline]

Conti,E., Franks,N.P. and Brick,P. (1996) Structure, 4, 287–298.[Medline]

Conti,E., Stachelhaus,T., Marahiel,M.A. and Brick,P. (1997) EMBO J., 16, 4174–4183.[CrossRef][Web of Science][Medline]

DeLuca,M. (1969) Biochemistry, 8, 160–166.[CrossRef][Medline]

Kajiyama,N. and Nakano,E. (1991) Protein Eng., 4, 691–693.[Abstract/Free Full Text]

Mamaev,S.V., Laikhter,A.L., Arslan,T. and Hecht,S.M. (1996) J. Am. Chem. Soc., 118, 7243–7244.

McCapra,F., Gilfoyle,D.J., Young,D.W., Church,N.J. and Spencer,P. (1994) In Campbell,A.K., Kricka,L.J. and Stanley,P.E. (eds), Bioluminescence and Chemiluminescence: Fundamental and Applied Aspects. Wiley, Chichester, pp. 387–391.

Mitchell,G. and Hastings,J.W. (1971) Anal. Biochem., 39, 243–250.[CrossRef][Web of Science][Medline]

Ohmiya,Y, Hirano,T. and Ohashi,M. (1996) FEBS Lett., 384, 83–86.[CrossRef][Web of Science][Medline]

Ohmiya,Y., Mina,S., Viviani,V.R. and Ohba,N. (2000) Sci. Rep. Yokosuka City Mus., 47, 31–38.

Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning. A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Sandalova,T.P. and Ugarova,N.N. (1999) Biochemistry (Mosc.), 64, 962–967.[Medline]

Seliger,H.H. and McElroy,W.D. (1964) Proc. Natl Acad. Sci. USA, 52, 75–81.[Free Full Text]

Ugarova,N.N. and Brovko,L.Y. (2002) Luminescence, 17, 321–330.[CrossRef][Web of Science][Medline]

Viviani,V.R. (2002) Cell. Mol. Life Sci., 59, 1833–1850.[CrossRef][Web of Science][Medline]

Viviani,V.R. and Bechara,E.J.H. (1995) Photochem. Photobiol., 62, 490–495.

Viviani,V.R. and Ohmiya,Y. (2000) Photochem. Photobiol., 72, 267–271.[CrossRef][Web of Science][Medline]

Viviani,V.R., Bechara,E.J.H. and Ohmiya,Y. (1999a) Biochemistry, 38, 8271–8279.[CrossRef][Medline]

Viviani,V.R., Silva A.C.R., Perez G.L., Santelli,R.V., Bechara E.J.H. and Reinach F.C. (1999b) Photochem. Photobiol., 70, 254–260.[CrossRef][Web of Science][Medline]

Viviani,V.R., Uchida,A., Suenaga,N., Ryufuku,M. and Ohmiya,Y. (2001) Biochem. Biophys. Res. Commun., 280, 1286–1291.[CrossRef][Web of Science][Medline]

Viviani,V.R., Uchida,A., Viviani,W. and Ohmiya,Y. (2002) Photochem. Photobiol., 76, 538–544.[CrossRef][Web of Science][Medline]

White,E.H. and Branchini,B. (1975) J. Am. Chem. Soc., 97, 1243–1245.[CrossRef][Web of Science][Medline]

Willey,T.L., Squirrel,D.J. and White,P.J. (2001) In Case,J.F., Herring,P.J., Robinson,B.H., Haddock,S.D.H, Kricka,L.J. and Stanley,P.E. (eds), Bioluminescence and Chemiluminescence. Proceedings of the 11th International Symposium on Bioluminescence and Chemiluminescence. World Scientific, Singapore, pp. 201–204.

Wood,K.W. (1990) J. Biolum. Chemilum., 5, 107–114.

Wood,K.W., Lam,Y.A., Seliger,H.H. and McElroy,W.D. (1989) Science, 244, 700–702.[Abstract/Free Full Text]

Zako,T., Ayabe,K., Aburatani,T., Kamiya,N., Kitayama,A., Ueda,H. and Nagamune,T. (2003) Biochim. Biophys. Acta, 1649, 183–189.[Medline]

Received January 24, 2003; revised November 24, 2003; accepted November 28, 2003 Edited by Alan Fersht


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Protein Eng Des SelHome page
A. Riahi-Madvar and S. Hosseinkhani
Design and characterization of novel trypsin-resistant firefly luciferases by site-directed mutagenesis
Protein Eng. Des. Sel., November 1, 2009; 22(11): 655 - 663.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Kh. Tafreshi, S. Hosseinkhani, M. Sadeghizadeh, M. Sadeghi, B. Ranjbar, and H. Naderi-Manesh
The Influence of Insertion of a Critical Residue (Arg356) in Structure and Bioluminescence Spectra of Firefly Luciferase
J. Biol. Chem., March 23, 2007; 282(12): 8641 - 8647.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
V.R. Viviani, F.G.C. Arnoldi, B. Venkatesh, A.J.S. Neto, F.G.T. Ogawa, A.T.L. Oehlmeyer, and Y. Ohmiya
Active-Site Properties of Phrixotrix Railroad Worm Green and Red Bioluminescence-Eliciting Luciferases
J. Biochem., October 1, 2006; 140(4): 467 - 474.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
17/2/113    most recent
gzh016v2
gzh016v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Viviani, V. R.
Right arrow Articles by Ohmiya, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Viviani, V. R.
Right arrow Articles by Ohmiya, Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?