PEDS Advance Access originally published online on January 12, 2004
Protein Engineering Design and Selection 2004 17(2):119-126; doi:10.1093/protein/gzh015
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2004 Oxford University Press
Transglutaminase-mediated N- and C-terminal fluorescein labeling of a protein can support the native activity of the modified protein
1Department of Chemistry and Biotechnology, Graduate School of Engineering, University of Tokyo, Hongo, Tokyo 113-8656, 2Gene Function Research Center, National Institute of Advanced Industrial Science and Technology (AIST), Central 4, 1-1-1 Higashi, Tsukuba Science City 305-8562 and 3Department of Bioscience and Biotechnology, Faculty of Engineering, Okayama University, 3-1-1 Tsushimanaka, Okayama 700-8530, Japan
4 To whom correspondence should be addressed. e-mail: taira{at}chembio.t.u-tokyo.ac.jpM.Taki and M.Shiota contributed equally to this work
| Abstract |
|---|
|
|
|---|
Fluorescein and its analogs are among the best fluorophores to label proteins and the labeling generally involves chemical modification of a translated protein. Using this methodology, labeling at a specific position remains difficult. It is known that the guinea pig liver transglutaminase (TGase)-catalyzed enzymatic modification method can allow terminal-specific fluorophore labeling of a protein by monodansylcadaverine. However, native activity of the fluorescent protein has not been investigated so far, nor has direct comparison between the chemical modification and the TGase-catalyzed modification been attempted. Therefore, we compared the possibility of fluorescein labeling via chemical labeling and via TGase-catalyzed modification. The latter method was found to be very practical and overcame some of the problems associated with the specificity of the former; fluorescein was covalently attached only to the N- or C-terminal site of glutathione S-transferase when the reaction was catalyzed by TGase and the resulting labeled protein completely retained its native activity. The TGase-mediated labeling occurred not only at room temperature but also at 4°C to the same extent, which is more desirable for preventing the inactivation of proteins.
Keywords: chemical modification/enzymatic modification/native activity/terminal-specific labeling/transglutaminase
| Introduction |
|---|
|
|
|---|
Fluorescein and its derivatives have been the most popular fluorescent derivatization reagents for covalently labeling proteins because of their relatively high absorptivities, excellent fluorescence quantum yields and high water solubilities. In addition, fluoresceinprotein conjugates are usually not susceptible to precipitation. Fluorescein has an excitation maximum that closely matches the 488 nm spectral line of the argon ion laser, making it the predominant fluorophore for confocal laser scanning microscopy and flow cytometry applications. Many widespread optical filter sets are designed to excite efficiently and detect fluoresceins fluorescence. Fluorescein can most commonly be introduced into a protein through in vitro modifications with suitable amine-reactive reagents such as N-hydroxysuccinimidylfluorescein (fluorescein-NHS ester) (Holmes and Lantz, 2001
Compared with random and/or inner labeling, terminal-specific single modification is effective for obtaining an active protein (Gite et al., 2000
; Taki et al., 2001a
). Recent papers have shown that various fluorophores are site-specifically incorporated into proteins through an in vitro biosynthesizing system (Hohsaka et al., 1996
; Taki et al., 2002
). However, the incorporation efficiencies of large fluorophores such as dansyl (Cornish et al., 1994
; Steward et al., 1997
), BODIPY (Gite et al., 2000
) and pyrenyl groups (Sisido and Hohsaka, 1999
) are usually very low, mainly owing to their bulky side groups. Such large fluorophores can hardly be recognized by a ribosome for accurate translation. Without using ribosome-mediated biosynthesis, terminal-specific labeling protocols for fluorescein are desirable.
The enzymatic modification of proteins is another alternative approach. For example, transglutaminase (TGase)-catalyzed reactions offer a potential method for the introduction of fluorescent groups into proteins under mild conditions. TGase can catalyze acyl transfer reactions between the
-carboxyamide group of glutamine (Gln) residues and various primary amines. Sato et al. developed a sophisticated method to label proteins at a terminal site using this enzyme. They introduced a very short substrate sequence for TGase at the N-terminus of a target protein. The expressed chimeric protein was then enzymatically labeled with a fluorescent dansylcadaverine only at a Gln site in the appended N-terminal sequence (Sato et al., 1996
). However, the activity of the fluorescent protein has not been investigated so far. Moreover, the enzymatic labeling reaction was carried out at room temperature and some sensitive proteins might be inactivated under these conditions.
In this study, we have clarified the feasibility that the TGase-mediated terminal-specific labeling method is applicable in practice for retaining the original biological activity of a fluorescein-labeled protein. We compared the activity of the fluorescein-labeled protein via common chemical labeling and via TGase-mediated terminal-specific labeling under various reaction conditions and found that the latter is superior to the former.
| Materials and methods |
|---|
|
|
|---|
General
All solvents and reagents were commercially available and used without further purification. All assays were repeated at least three times; the experimental errors represent the standard deviations from these independent experiments.
Plasmid construction and expression of GST proteins
Plasmid vectors pGST-N and pGST-C, which express glutathione S-transferase (GST) from Schistosoma japonica (GST) chimeric proteins with a short TGase substrate (ProLysProGlnGlnPheMet; TG1 sequence) at the N- and the C-terminus, respectively, were constructed as follows. The vectors contain a sequence coding for the thrombin protease cleavage site between the TG1 coding sequence and the GST coding sequence.
pGST-N
A 1 µmol amount of each synthetic DNA primer was mixed with the GST gene cloned in a commercial GST expression vector pGEX-4T-3 (Amersham, Uppsala, Sweden), then PCRs were carried out with Ex Taq DNA polymerase (Takara, Shiga, Japan). The sequences of the sense and antisense primers were 5'-CCAGTCCGCATATGCCAAAA CCTCAGCAGTTTATGCTGGTTCCGCGTGGCTCCATGTCCCCTATACTAGGTTATTG-3' and 5'-CGCGGATCCTT ATTACAGATCCGATTTTGGAGGATG-3', respectively. The sense primer contains the TG1 sequence (underlined). The PCR product was isolated by 4% polyacrylamide gel electrophoresis (PAGE) and digested with NdeI and BamHI. The digested product was purified by phenolchloroform extraction and precipitated with ethanol. The precipitated DNA fragment was cloned into NdeI and BamHI sites of pET30(a) (Takara) by a DNA ligation kit (Takara), to generate pGST-N.
pGST-C
To generate pGST-C, we added the TG1 sequence (underlined) to pGEX-4T-3, by using the following oligonucleotide primers: forward, 5'-CACGGAATTCCCCAAAACCTCAGCAGTTT ATGTAATAACTCGAGCGTGG-3'; reverse, 5'-CCACGCT CGAGTTATTACATAAACTGCTGAGGTTTTGGGGAATTCCGTG-3'. The annealed oligonucleotide was digested with EcoRI and XhoI and cloned into EcoRI and XhoI sites of pGEX-4T-3 vector; the resulting plasmid was named pGST-C.
We independently used Escherichia coli strains MV1184 (Takara) and JM109 (Toyobo, Osaka, Japan) for multiplication of plasmids, pGST-N and pGST-C, respectively. We transformed each E.coli strain with the appropriate plasmid and plated the bacteria on LB containing kanamycin for pGST-N or ampicillin for pGST-C. JM109 bacteria transformed with pristine pGEX-4T-3 was used for the expression of wild-type GST. Single colonies were cultured in 3 ml of YT medium and the plasmids were isolated by a plasmid miniprep kit (Qiagen, Hilden, Germany). The sequences of the plasmids were confirmed by DNA sequencing. The E.coli strain MV1184 was used only for the multiplication of plasmids, not for the expression of proteins. Bacterial expression host BL21(DE3) (Novagen, Milwaukee, WI) competent cells were transformed with pGST-N. BL21(DE3) and JM109 cells transformed with the expression vectors were grown in 5 ml of YT medium at 37°C with 10 µg/ml kanamycin for BL21(DE3) or 20 µg/ml ampicillin for JM109 until the turbidity at 600 nm (A600) reached 0.6. Induction was performed by adding isopropyl-ß-D-thiogalactopyranoside (IPTG, final 0.5 mM) and the bacteria were cultured for an additional 2 h at 37°C, then harvested by centrifugation at 4000 g for 10 min. The bacterial pellet was resuspended in 1 ml of PBS buffer (pH 7.4) containing 0.1% (v/v) Triton X-100 and sonicated on ice (50 W for 15 s, five times). The lysate was centrifuged at 12 000 g for 1 min and the GST protein in the supernatant was then purified as described below.
Detection of GST proteins
GST proteins were confirmed by SDSPAGE and western blotting analysis using standard methods. The proteins were fractionated on sodium dodecyl sulfate (SDS) polyacrylamide (15%) gels and electrotransblotted on to poly(vinylidene difluoride) (PVDF) membranes. The membranes were blocked for 1 h at 37°C with 3% BSA in Tris-buffered saline containing 20 mM TrisHCl (pH 7.5), 150 mM NaCl and 0.1% Tween-20 and incubated with a 1:1000 dilution of anti-GST primary antibody (Amersham) in the same buffer. After washing, the blots were incubated for 1 h with a 1:5000 dilution of alkali phosphatase-conjugated anti-goat IgG (Sigma, St Louis, MO) secondary antibody and visualized using Western Blue substrates (Promega, Madison, WI).
Purification of GST proteins
Purification of GST proteins was performed at 4°C. The supernatant containing GST proteins was loaded on to a GST affinity gel column (Microspin GST Purification Module; Amersham). The adsorbed GST proteins were washed with 1 ml of PBS buffer and eluted with 120 µl of 50 mM TrisHCl (pH 8.0) containing 10 mM glutathione. For desalting and buffer exchange into PBS buffer (pH 7.5), the eluate was further purified by a gel filtration column (HiTrap Desalting; Amersham).
TGase-mediated modification of GST proteins by fluorescein
GST protein (10 µM) in 100 µl of 100 mM TrisHCl buffer (pH 7.5) solution containing 1 mM fluoresceincadaverine (Molecular Probes, Eugene, OR), 10 mM CaCl2 and 0.05 units of guinea pig liver transglutaminase (TGase; Sigma) was incubated at room temperature overnight to allow labeling.
Chemical modification of GST proteins by fluorescein
For chemical modification of GST proteins, we used a Fluorescein Amine Labeling Kit (Panvera, Madison, WI). GST protein (10 µM) in 100 µl of 100 mM phosphate buffer (pH 7.0) solution containing 1 mM succinimide ester of fluorescein was incubated at room temperature overnight. After the incubation, the reaction was stopped by adding 100 mM TrisHCl buffer (pH 8.0) and the resulting solution was incubated at room temperature for an additional 30 min.
Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) analysis of TGase-mediated labeled GST proteins
TG1-fused GST proteins contain a single thrombin protease cleavage site between the terminal TG1 peptide domain and the GST domain. Site-specific proteolysis of the TGase-mediated labeled GST protein, which was purified with the above gel filtration column, was performed using thrombin protease (Amersham) according to the instruction manual, to obtain the fluorescein-labeled terminal TG1 peptide. The digested reaction mixture was applied to 20% SDSPAGE. After electrophoresis, fluorescence imaging of the gels was performed using a FluorImager 595 (Molecular Dynamics, Uppsala, Sweden), which was equipped with an argon ion laser (488 nm) as an excitation source and an emission filter (around 530 nm), to detect the fluoresceins fluorescence (
max = 492 nm). The digested fluorescent molecule was desalted, concentrated and purified using ZipTipC18 silica resin (Millipore, Bedford, MA) according to the given procedure. It was eluted directly on to the MALDI target (Taki et al., 2001b
). MALDI-TOF mass spectra were taken on a Voyager DE Pro instrument.
-Cyano-4-hydroxycinnamic acid (
-CHCA) was used as a matrix at a concentration 10 mg/ml in acetonitrilewater.
Fractionation of modified GST proteins
The reaction mixture containing fluorescein-labeled proteins was purified by GST affinity column chromatography as described above. At this stage, the total reaction mixture was loaded on to the GST column, the breakthrough was re-loaded on the column eight times and the final breakthrough was collected (fraction No. 1; flow-through). The column was washed with PBS buffer (pH 7.4) and the eluate was collected and concentrated by ultrafiltration (fraction No. 2; wash). The adsorbed GST protein on the column was eluted with 120 µl of 50 mM TrisHCl buffer (pH 8.0) containing 10 mM glutathione and the eluate was collected (fraction No. 3; bound). The total volume of each fraction was equalized.
To estimate the amount of GST chimeric proteins in each fraction and the fluorescein labeling efficiency, we carried out densitometric analysis of western blotting using both anti-GST antibody and anti-FITC antibody (Neomarkers, Westinghouse, CA) and a fluorescence imaging assay. An aliquot (1 µl) from each fraction was electrophoresed on SDS polyacrylamide (15%) gels and the gels were analyzed using a FluorImager 595 as described above. Western blotting analysis was then performed with the same gels. The amounts of the GST proteins and the attached fluorescein were quantified by densitometry of bands by using an NIH Image program (Taki et al., 2001a
) and an ImageQuant program (Molecular Dynamics), respectively. Each band intensity from the western blot and the fluorescence image was evaluated quantitatively from a calibration curve.
Estimation of the amount of TGase-mediated labeled GST from UVvisible spectra
TGase-mediated labeling of GST-N or GST-C was performed as described before and the reaction mixture was diluted with three volumes of 8 M guanidine hydrochloride. For desalting and buffer exchange into PBS buffer (pH 7.5), it was purified with a gel filtration column (HiTrap). The amount of the fluorescein incorporated into the protein was estimated by measuring the absorbance ratio on a UVvisible spectrophotometer. Molar extinction coefficients of 57 000 at 494 nm for fluoresceincadaverine (Wolff and Lai, 1988
) and 40 920 at 280 nm for GST (Bauer et al., 2000
) were used. At this stage, the purified fraction contained both labeled GST and an unfavorable small amount of TGase. Therefore, it was necessary to subtract the contribution of TGase from the measured absorbance as follows.
TGase-mediated mock labeling was also performed in the same buffer solution containing the same amounts of fluoresceincadaverine, CaCl2 and TGase. A mock reaction mixture without GST was purified in the same way and the UVvisible spectrum was taken. The mock spectrum obtained was used for the subtraction.
Enzymatic activity assay
The enzymatic activity of modified or unmodified GST proteins was measured according to the instruction manual (GST Detection Module; Amersham). Briefly, the GST enzyme catalyzes conjugation of 1-chloro-2,4-dinitrobenzene (CDNB) with glutathione and the resulting reaction product has a molar absorption at 340 nm (Habig et al., 1974
). The specific enzymatic activity was determined by monitoring the change in the absorbance at 340 nm in a UVvisible spectrophotometer.
| Results |
|---|
|
|
|---|
Fluorescein modification of GST proteins
GST-N, GST-C and wild-type GST were expressed and modified with fluorescein by the two different methods according to Materials and methods. The modified GST proteins with fluorescein were purified using GST affinity columns; they were divided into the flow-through fraction, the wash fraction and the bound fraction. SDSPAGE and western blotting were performed for each fraction as described above. Western blotting analysis indicated that bands representing full-length GST (
27 kDa) were detected only in the flow-through and the bound fractions (data not shown). Therefore, the glutathione binding ability of the modified GST proteins can be estimated by densitometric analysis of these bands using the NIH image program.
Figure 1 compares results of fluorescein modification for the GST proteins via TGase and chemical modification. Immunoblotting with an anti-GST antibody displayed protein bands corresponding to GST (Figure 1B). Figure 1A shows the fluorescence of fluorescein that covalently bound to the GST chimeric proteins. The amounts of GST chimeric proteins could be estimated from the densitometric analysis of the western blot (Figure 1B). The fluorescence imaging assay indicated that the fluorescent band representing full-length GST was detected only when the TGase reaction was performed in the presence of the short TGase substrate. These results clearly indicate that fluorescein was covalently bound only to the terminal TGase substrate under the enzymatic reaction conditions. On the other hand, fluorescein molecules were covalently bound to every GST protein via chemical modification, regardless of the existence of the TGase substrate (Figure 1C). It is also noteworthy that GST with the chemical modification was predominantly found in the flow-through fraction, whereas the corresponding TGase-modified GST was found in the bound fraction, supporting the native structure of the latter.
|
Calculation of the amount of modified GST proteins that retain glutathione-binding abilities
As described above, modified GST proteins could be divided into folded proteins and unfolded proteins, which were contained in each bound fraction and flow-through fraction, respectively. The glutathione-binding abilities were estimated from the proportion of the amount of the bound fraction to that of the whole fraction. Figure 2 shows percentages of the modified GST proteins that retain glutathione-binding abilities. In the TGase-catalyzed modification, almost all of the protein retains the ability, so most of the modified protein has the folded structure. In contrast, in chemical modification, the percentage of the folded protein was
10%.
|
MALDI-TOF-MS analysis of TGase-mediated labeled protein
To confirm evidence that the resulting protein is labeled only by a single fluorescein molecule via TGase modification, mass spectrometric analysis was performed. The modified protein with fluorescein has a single thrombin protease recognition site near the terminus. It was digested by thrombin protease and the digested crude mixture was directly analyzed by SDSPAGE followed by a fluorescence imaging assay. As shown in the inset of Figure 3, a single fluorescent band can be seen after the digestion and it migrated much faster than a fluorescent band before the proteolysis. Except for the peptide band, no fluorescent band can be seen in the same lane. The fluorescent peptide fragment was then analyzed by MALDI-TOF-MS. It showed a corresponding peak for the fluorescein-labeled terminal peptide fragment containing the TG1 sequence. GSPNSPKPQQFM(-fluorescein): m/z found, 1792.88; calculated for [M + H]+, 1792.04 (Figure 3A). When the unlabeled protein was digested in a similar manner, the mass spectrum showed corresponding peaks for the unlabeled fragment. GSPNSPKPQQFM: m/z found, 1319.47 and 1341.6; calculated for [M + H]+, 1318.49 and [M + Na]+, 1340.48 (Figure 3B). These results explicitly prove that the labeling occurred specifically at the terminus of the target protein.
|
Enzymatic activity assay
GST is a metabolizing enzyme that catalyzes the conjugation of glutathione to electrophilic substrates (Habig et al., 1974
). To evaluate the effects of fluorescein modification on the enzymatic activity, we performed the enzymatic activity assay based on absorption changes of the CDNB substrate during the GST-catalyzed reaction as described in Materials and methods. The specific enzymatic activity of the modified GST chimeric protein using TGase was much higher than that of the chemically modified protein (Figure 4). In other words, the protein modified via the TGase method retained native GST activity, whereas the chemically modified protein was remarkably inactivated. In most cases, the activity estimated from this enzymatic assay (Figure 4) was in good agreement with the ability estimated from the glutathione-binding assay (Figure 2).
|
Estimation of molar ratio of fluorescein to one GST molecule
We estimated the amount of fluorescein bound to 1 mol of GST protein [fluorophore:protein (F/P) ratio] by quantitation of the densitometry of each band using anti-FITC antibody shown in Figure 5. In the TGase-catalyzed modification, an average of 0.97 and 0.93 mol of the fluorescein derivative was incorporated per GST-C and GST-N, respectively. Standard deviations of the experimental error were low and the labeling occurred in a highly specific manner. Moreover, we independently estimated the amount of labeled GST using absorbance spectroscopy. Incorporation of the fluorescein into both GST-C and GST-N to 1.0 ± 0.1 mol/mol was observed. The quantification from UVvisible spectroscopy was in good agreement with those estimated from the fluorescence imaging assay and western blotting using anti-FITC antibody.
|
On the other hand, in the chemical modification, each band intensity from the fluorescence imaging was much lower than the corresponding band intensity from western blotting using anti-FITC antibody. This probably means that concentration quenching occurred when GST was multiply labeled with fluorescein molecules (Bertram et al., 1991
Modification of proteins using TGase in mild conditions
To prevent inactivation of proteins, it is better to perform the enzymatic modification reaction at a lower temperature. It has been reported that the TGase-catalyzed reaction occurred not only at room temperature but also at 4°C in the presence of both DTT and ATP (Takashi, 1988
). Therefore, we compared the fluorescein labeling efficiency at room temperature with that at 4°C to pursue the possibility of performing the TGase reaction at milder conditions.
GST-C was modified independently both at room temperature and at 4°C according to Materials and methods. An equal amount of each reaction mixture was separated and analyzed by SDSPAGE and quantitated by fluorescence imaging assay. Modification in the presence of 1 mM DTT and 0.4 mM ATP was also performed at 4°C. Figure 6 shows the results of the fluorescence imaging assay. The labeling efficiency at 4°C was lower in comparison with that conducted at room temperature in the absence of DTT and ATP. However, in the presence of DTT and ATP, the modification efficiency was increased; the labeling efficiency at 4°C was about the same as or higher than that conducted at room temperature.
|
| Discussion |
|---|
|
|
|---|
Coupling of fluorescent molecules to active proteins
Coupling of fluorescent molecules to proteins is one of the major fields of bioconjugation chemistry. The aim of this study was to compare the capability of terminal-specific protein labeling via the TGase method and of random labeling via the conventional chemical method by fluorescein, which is one of the most common fluorophores. Another way to label proteins specifically at the N-terminus is to synthesize the protein chemically on a solid support and perform the labeling during the solid phase peptide synthesis. This solid phase labeling is mainly applicable to short proteins and it is difficult to apply it to longer proteins.
We chose GST as an ideal (longer) model protein for the following reasons. (i) GST is easy to express using E.coli and it can be detected by western blotting analysis using a commercially available GST-specific antibody. (ii) GST is known to bind glutathione and it can be purified by a commercially available glutathioneagarose affinity chromatographic method. We can quantitate the glutathione-binding ability of the labeled GST protein by comparing the amounts in flow-through and bound fractions. (iii) The activity of GST can be estimated from an enzymatic assay by using a commercially available CDNB substrate kit (Graminski et al., 1989
). The enzymatic reaction product has a strong molar absorbance, so the activity can be easily determined by initial reaction rates under the same reaction conditions.
TGase-mediated site-specific fluorescein labeling of a protein
For the enzymatic modification using TGase, we prepared chimeric GST proteins (i.e. GST-N and GST-C) with a short substrate-recognition sequence at the N- or C-terminus. This seven-peptide terminal sequence is PKPQQFM derived from substance P, which is known to be a very good substrate in vitro for TGase (Sato et al., 1996
). According to a quantification by absorbance spectroscopy or a combination analysis of the fluorescence imaging assay and western blotting,
1:1 stoichiometric F/P labeling was attained via the TGase method for both GST-N and GST-C chimeric proteins. Moreover, with a combination analysis using MS and fluorescence imaging assay after site-specific proteolysis, the resulting protein was found to be labeled by a single fluorescein molecule at the terminus. Such enzymatic labeling seldom occurred when wild-type GST protein, which lacks the seven-peptide substrate sequence, was used. It is known that the wild-type GST has five glutamine residues (McTigue et al., 1995
). These glutamine residues were not found to be labeled with fluoresceincadaverine, even when a 100-fold molar excess of the labeling reagent to one GST molecule was used. This means that these Gln residues are not in the exposed region and/or not within an acceptable sequence for the TGase-catalyzed transamidation reaction. These results also suggest that fluorescein is site-specifically labeled only at the terminus of the GST chimeric proteins. In this respect, the TGase method can easily adjust the final F/P ratio stringently, even if large excess amounts of fluorescein molecules exist in the reaction system. It is noteworthy that the addition of both the fluorescein moiety and the short sequence to the N-terminal region of GST did not affect the biological activity or the original structure of GST. In contrast, GST-C exhibits lower enzymatic activity than that of GST-N after TGase-catalyzed modification. A close look at a detailed X-ray structure of the native GST (McTigue et al., 1995
) gives a plausible reason for this phenomenon. The fluorescein in the appended N-terminal TG1 sequence could be located far away from the GST catalytic center, whereas that in the C-terminal sequence could be somewhat close to the core (Figure 7). We cannot exclude the possibility that the steric hindrance of the bulky fluorescein at the C-terminal site slightly influenced the catalytic region. Not only for GST but also for other proteins, it seems important to obtain guidelines from reported structures which terminus is more feasible to incorporate the TGase substrate.
|
Conventional chemical fluorescein labeling of a protein
The most commonly used method of fluorescent labeling of proteins involves coupling through the aliphatic amines, the N-terminal
-amines and the
-amino group of lysine, with N-hydroxysuccinimide esters of fluorescein and its derivatives; these succinimide esters allow the formation of stable amide bonds. We performed this standard chemical modification and compared the above enzymatic modification to assess the native activity of the proten. The final F/P ratios were fairly varied and depended on many factors: pH, protein concentration, fluorophore concentration, reaction time and reaction temperature (data not shown). It should be noted that, by the chemical modification, exclusive labeling to a particular amino acid group was not possible. It is known that the reaction rate and degree of substitution of the coupling reaction are sensitively dependent on the concentration of the protein and/or pH (Holmes and Lantz, 2001
). This is primarily due to hydrolysis of the succinimide esters, because water competes as a nucleophile with the amino acid side chains at alkaline pH and such hydrolysis rates increase with increasing pH. Even when these reaction conditions were strictly regulated, we suspect that the pools contain a wider range of modifications. The almost total loss of enzymatic activity via chemical modification is probably due to the non-specific modification of critical lysine moieties around active sites by the bulky fluorescein molecules. It is tedious and time consuming to optimize these reaction conditions to obtain active proteins via chemical labeling.
Site-specific fluorescein labeling at a lower temperature
Although fluorescein-labeled GST retains its native activity via the TGase method, it is noticeable that some proteins tend to become inactivated during the reaction at room temperature. Site-specific fluorescein modification at a lower temperature via TGase-catalyzed reaction appears to be favorable. We improved the reaction conditions and revealed that the activity of TGase at 4°C was enhanced compared with that at room temperature by >35% in the presence of ATP and DTT, in agreement with the previously demonstrated improvement of TGase-mediated transamidation. Such an increase in enzymatic activity could be achieved by increasing the reduced form of cysteine within the catalytic core by the addition of DTT. In general, it is known that TGase binds nucleotides and that the transamidation activity of TGase is negatively regulated by the nucleotides (Murthy et al., 1999
). However, important details of the allosteric communication between the nucleotide binding sites of TGase and the catalytic center required for transamidation are not well known (Murthy et al., 1999
). Our results were the opposite to what would be expected from the effect of nucleotides on the enzymatic activity. The transamidation activity of TGase seems to be positively regulated by ATP at 4°C, because the allosteric communication of this enzyme might be changeable with temperature.
Conclusions
Although the current study was focused on GST, these observations may also be applicable to other proteins. Recently, Kraynov and co-workers succeeded in visualizing proteinprotein interactions in living cells by using the fluorescence-resonance energy transfer (FRET) technique between a protein labeled by a fluorescein analog and a green fluorescent protein (GFP) fusion protein. However, they failed to visualize the interaction by FRET between two different GFP-variant fusion proteins (ECFP and EYFP) (Kraynov et al., 2000
). Sometimes using low molecular weight and bright fluorophores seems to be better than using GFP and its variants to investigate a broad range of biological events in vitro and in vivo. Because many proteins are already oligomeric, fusion to GFP or its variants could cause either clashes of stoichiometry, steric hindrance of quaternary structures or cross-linking into massive aggregations (Bauer et al., 2000
). Slow maturation of the chromophore of such fluorescent proteins is another common problem (Baird et al., 2000
). Fluoresceincadaverine is not toxic to some cells (Johnson et al., 1998
; Verderio et al., 1998
) and derivatized proteins may be transfected into cells by several methods (Schwarze et al., 2000
). Site-specific labeling of proteins by fluoresceincadaverine or its analogs may be applicable to detect molecular associations of labeled proteins with different fluorescent molecules by FRET in cells (Root, 1997
). Such attempts are under way in our laboratory.
In conclusion, two different fluorescein labeling methods were investigated and compared. A major disadvantage of chemical labeling is that it generates a number of mixed species during the reaction and the enzymatic and substrate-binding activities of the resulting proteins were almost lost, at least in the case of GST. Depending on the number of reactive amino groups on the protein, the resulting fluoresceinprotein conjugates represent heterogeneous molecular species due to the uncontrollable and unpredictable attachment of the fluorescein succinimide ester. It is also difficult to separate unlabeled, singly and multiply labeled proteins. With chemical labeling, assays must be done using these mixed species. The fluorescence intensity of the labeled protein decreases owing to fluorescence quenching effects of multiple labeling. Hence we cannot estimate the F/P ratio of these labeled proteins from the simple fluorescence imaging assay. The use of TGase was found to resolve these problems; the modification by fluorescein occurred at a 1:1 F/P ratio and it did not result in significant loss of enzyme activity and glutathione-binding ability. Various fluoresceincadaverine analogs, such as tetramethylrhodaminecadaverine, Texas Redcadaverine and Alexa Fluorcadaverine, are commercially available. These possess different fluorescent properties and they have been successfully introduced at the terminus of chimeric GSTs via the TGase method. These labeled GST derivatives showed different fluorescent properties and retained their activities (Taki and Taira, 2004
). Many other colored variants of succinimide esters of fluorescein analogs are also commercially available and some of their photostabilities are known to be excellent (Haugland, 1996
). Their transformation using cadaverine is fairly easy, so that TGase can recognize these various fluorophores (Taki and Taira, 2004
). Since the recognition of TGase for cadaverine substrates is fairly loose, other different types of commericial fluorophores, such as BODIPY TRcadaverine and Lucifer Yellowcadaverine, would be incorporated into the terminal site of proteins.
| Acknowledgements |
|---|
M.T. is grateful to the Japan Society for the Promotion of Science (JSPS) for grants as research fellowships. We thank Dr Laura Nelson for careful reading of the manuscipt and for critical comments. The authors are also grateful to Professor Dr Masahiko Sisido (Okayama University) for obtaining mass spectra. This work was partially supported by a Grant-in-Aid for the Program for Promotion of Basic Research Activities for Innovative Biosciences.
| References |
|---|
|
|
|---|
Baird,G.S., Zacharias,D.A. and Tsien,R.Y. (2000) Proc. Natl Acad. Sci. USA, 97, 1198411989.
Bauer,K., Kratzer,M., Otte,M., Quintana,K.L., Hagmann,J., Arnold,G.J., Eckerskorn,C., Lottspeich,F. and Siess,W. (2000) Blood, 96, 42364245.
Bertram,V.M., Bailey,M.P. and Rocks,B.F. (1991) Ann. Clin. Biochem., 28, 487491.
Cornish,V.W., Benson,D.R., Altenbach,C.A., Hideg,K., Hubbel,W.L. and Schultz,P.G. (1994) Proc. Natl Acad. Sci. USA, 91, 29102914.
Gite,S., Mamaev,S., Olejnik,J. and Rothschild,K. (2000) Anal. Biochem., 279, 218225.[CrossRef][Web of Science][Medline]
Graminski,G.F., Kubo,Y. and Armstrong,R.N. (1989) Biochemistry, 28, 35623568.[CrossRef][Medline]
Habig,W.H., Pabst,M.J. and Jakoby,W.B. (1974) J. Biol. Chem., 249, 71307139.
Haugland,R.P. (1996) Handbook of Fluorescent Probes and Research Chemicals. Molecular Probes, Eugene, OR.
Hohsaka,T., Ashizuka,Y., Murakami,H. and Sisido,M. (1996) J. Am. Chem. Soc., 118, 97789779.[CrossRef]
Holmes,K.L. and Lantz,L.M. (2001) Methods Cell Biol., 63, 185204.[Web of Science][Medline]
Hu,L. and Colman,R.F. (1997) Biochemistry, 36, 16351645.[CrossRef][Medline]
Johnson,T.S., Scholfield,C.I., Parry,J. and Griffin,M. (1998) Biochem. J., 331, 105112.
Kraynov,V.S., Chamberlain,C., Bokoch,G.M., Schwartz,M.A., Slabaugh,S. and Hahn,K.M. (2000) Science, 290, 333337.
McTigue,M.A., Williams,D.R. and Tainer,J.A. (1995) J. Mol. Biol., 246, 2127.[CrossRef][Web of Science][Medline]
Murthy,S.N.P., Lomasney,J.W., Mak,E.C. and Lorand,L. (1999) Proc. Natl Acad. Sci. USA, 96, 1181511819.
Root,D.D. (1997) Proc. Natl Acad. Sci. USA, 94, 56855690.
Sato,H., Ikeda,M., Suzuki,K. and Hirayama,K. (1996) Biochemistry, 35, 1307213080.[CrossRef][Medline]
Schwarze,S.R., Hruska,K.A. and Dowdy,S.F. (2000) Trends Cell Biol., 10, 290295.[CrossRef][Web of Science][Medline]
Sippel,T.O. (1981) J. Histochem. Cytochem., 29, 13771381.[Abstract]
Sisido,M. and Hohsaka,T. (1999) Bull. Chem. Soc. Jpn, 72, 14091425.[CrossRef]
Steward,L.E., Collins,C.S., Gilmore,M.A., Carlson,J.E., Ross,J.B.A. and Chamberlin,A.R. (1997) J. Am. Chem. Soc., 119, 611.[CrossRef]
Takashi,R. (1988) Biochemistry, 27, 938943.[CrossRef][Medline]
Taki,M., Sawata,S.Y. and Taira,K. (2001a) J. Biosci. Bioeng., 92, 149153.
Taki,M., Hohsaka,T., Murakami,H., Taira,K. and Sisido,M. (2001b) FEBS Lett., 507, 3538.[CrossRef][Web of Science][Medline]
Taki,M., Hohsaka,T., Murakami,H., Taira,K. and Sisido,M. (2002) J. Am. Chem. Soc., 124, 1458614590.[CrossRef][Web of Science][Medline]
Taki,M. and Taira,K. (2004) Chem. Lett., in press.
Verderio,E., B,B.N., Gross,S. and Griffin,M. (1998) Exp. Cell Res., 239, 119138.[CrossRef][Web of Science][Medline]
Wolff,C. and Lai,C.S. (1988) Biochemistry, 27, 34833487.[CrossRef][Medline]
Wolff,C. and Lai,C.S. (1989) Arch. Biochem. Biophys., 268, 536545.[CrossRef][Web of Science][Medline]
Received August 26, 2003; revised November 24, 2003; accepted November 24, 2003 Edited by Alan Fersht
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
O. Delelis, K. Carayon, E. Guiot, H. Leh, P. Tauc, J.-C. Brochon, J.-F. Mouscadet, and E. Deprez Insight into the Integrase-DNA Recognition Mechanism: A SPECIFIC DNA-BINDING MODE REVEALED BY AN ENZYMATICALLY LABELED INTEGRASE J. Biol. Chem., October 10, 2008; 283(41): 27838 - 27849. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Nieminen, A. Kuno, J. Hirabayashi, and S. Sato Visualization of Galectin-3 Oligomerization on the Surface of Neutrophils and Endothelial Cells Using Fluorescence Resonance Energy Transfer J. Biol. Chem., January 12, 2007; 282(2): 1374 - 1383. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Tong, Z. Chen, C. S. De Paiva, R. Beuerman, D.-Q. Li, and S. C. Pflugfelder Transglutaminase Participates in UVB-Induced Cell Death Pathways in Human Corneal Epithelial Cells. Invest. Ophthalmol. Vis. Sci., October 1, 2006; 47(10): 4295 - 4301. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








