Skip Navigation


PEDS Advance Access originally published online on January 12, 2004
Protein Engineering Design and Selection 2004 17(2):141-148; doi:10.1093/protein/gzh018
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
17/2/141    most recent
gzh018v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wilkinson, D.
Right arrow Articles by McPherson, M.J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilkinson, D.
Right arrow Articles by McPherson, M.J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 2004 Oxford University Press

Structural and kinetic studies of a series of mutants of galactose oxidase identified by directed evolution

D. Wilkinson1, N. Akumanyi, R. Hurtado-Guerrero, H. Dawkes2, P.F. Knowles, S.E.V. Phillips and M.J. McPherson3

Astbury Centre for Structural Molecular Biology, University of Leeds, Leeds LS2 9JT, UK 1Present address: Delta Biotechnology Ltd, Castle Court, 59 Castle Boulevard, Nottingham NG7 1FD, UK 2Present address: Biologics SRC, Pfizer Ltd, Sittingbourne, Kent ME9 8AG, UK

3 To whom correspondence should be addressed. e-mail: m.j.mcpherson{at}leeds.ac.uk


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Galactose oxidase (GO; E.C. 1.1.3.9) is a copper- containing enzyme that oxidizes a range of primary alcohols to aldehydes. This broad substrate specificity is reflected in a high KM for substrates. Directed evolution has previously been used to select variants of GO that exhibit enhanced expression and kinetic properties. In assays using unpurified enzyme samples, the variant C383S displayed a 5-fold lower KM than wild-type GO. In the present study, we have constructed, expressed, purified and characterized a number of single, double and triple mutants at residues Cys383, Tyr436 and Val494, identified in one of the directed evolution studies, to examine their relative contributions to improved catalytic activity of GO. We report kinetic studies on the various mutant enzymes. In addition, we have determined the three-dimensional structure of the C383S variant. As with many mutations identified in directed evolution experiments, the availability of structural information does not provide a definitive answer to the reason for the improved KM in the C383S variant protein.

Keywords: copper oxidase/directed evolution/galactose oxidase/guar gum/substrate binding


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Galactose oxidase (GO; E.C. 1.1.3.9), a 68 kDa mononuclear copper-containing enzyme from Fusarium graminearum, oxidizes primary alcohols to the corresponding aldehyde with coupled reduction of molecular oxygen to hydrogen peroxide (Kosman et al., 1974Go) according to the reaction scheme:

RCH2OH + O2 -> RCHO + H2O2

The biologically relevant substrate of GO is not known as the enzyme exhibits broad substrate specificity from small alcohols through sugars to oligo- and polysaccaharides (Avigad et al., 1962Go; Maradufu et al., 1971Go; Maradufu and Perlin, 1974Go; Mendonca and Zancan, 1987Go).

The crystal structure of GO has been determined to 1.7 Å resolution, and the protein is predominantly ß-structure with three domains (Ito et al., 1991Go, 1994Go). The copper at the active site is coordinated by His496, His581, Tyr272 and a solvent molecule as equatorial ligands, with Tyr495 as an axial ligand at a distance of 2.69 Å from the copper. One of the copper ligands, Tyr272, is covalently bonded through C{epsilon} to the sulphur of Cys228 and is the site of the free radical. The side chain of Trp290 stacks over this Tyr–Cys feature (Figure 1A). The semi-reduced form of the enzyme [Cu(II)-Tyr] can undergo a one electron oxidation to the oxidized state [Cu(II)-Tyr·] which catalyses the two electron oxidation of the substrate.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 1. Structure of GO. (A) The active site showing the copper ligands, the thioether bond between Tyr272 and Cys228, and the stacking interaction with Trp290. (B) An overview of the GO monomer showing domains 1 and 2 and showing the locations of the residues Cys383, Tyr436 and Val 494 (shown in mauve and highlighted by yellow labels), which form the basis of the present study. The active site residues are shown in atom colouring and are labelled by arrows. Non-covalent bond interactions are shown as dotted lines.

 
There is interest in the use of GO for industrial processes such as derivatization of guar gum and related polymers. Guar gum is a galactomannan isolated from Cyamopsis tetragonoloba. It comprises a 1->4-linked ß-D-mannopyranose backbone with 1->6-linked {alpha}-D-galactopyranose residues in a ratio of 1 D-galactose to ~1.5–2 D-mannose residues. Guar gum is a complex polymer with molecules that comprise ~10 000 monosaccharide residues. It is widely used as a food thickener and emulsifier, and is also used in a variety of other industries including textiles, printing, cosmetics, pharmaceuticals and paper manufacture (Hall and Yalpani, 1980Go; Andreana et al., 2002Go).

In order to improve the activity of GO towards appropriate substrates, there have been recent reports of directed evolution based on error-prone PCR. In the first example (Delagrave et al., 2001Go), a digital imaging system was used to screen microcolonies for activity against 1-methyl-{alpha}-D-galactoside as an analogue for guar gum, and also against guar gum itself. Using an assay system based on crude lysates of bacterial cultures, these authors determined KM and Vmax values. The results identified mutations at Cys383, Tyr436 and Val494 that were subsequently combined by subcloning and assayed for additive contributions to enhanced activity. The triple mutant C383S/Y436H/V494A showed a reduced KM and increased Vmax contributing to a 15.9-fold greater Vmax/KM with 1-methyl-{alpha}-D-galactoside as substrate, relative to wild-type. This variant also showed 10.4-fold higher activity against guar gum than the wild-type. This study was designed to identify improved enzymatic activity in crude extracts and so there was no measurement of relative expression levels of the variant proteins. Enhanced activity towards substrate in such an assay system may therefore be due to contributions from increased levels of expressed protein and/or enhanced catalytic activity.

The importance of enhanced expression is demonstrated in a second directed evolution study on GO (Sun et al., 2001Go). In this case, individual bacterial colonies were cultured, lysed and assayed in microtitre plates for increased activity. Further rounds of mutagenesis led to increased activity and variants were purified for further analysis. The most active variant (A3E7) displayed a 30-fold increase in activity resulting from an 18-fold higher expression and 1.7-fold greater catalytic efficiency. This variant contained a silent mutation in the codon for P136 and five amino acid substitutions: S10P, M70V, G195E, V494A and N535D. Two of these mutations were common to both studies where V494A was identified as enhancing Vmax, while N535D was shown to contribute a modest increase in activity.

We have investigated in detail the variants identified by Delagrave et al. (2001Go) by generating a series of single and double mutants comprising V494A, C383S and Y436H for comparison with the triple mutant clone. We also studied the variants C383A and Y436A. The locations of the mutated residues are shown in Figure 1B. The most interesting effect is reported to be due to the C383S mutation (Delagrave et al., 2001Go) which leads to a significant reduction in KM. Cys383 lies in a pocket at the back of the active site behind the copper atom and therefore is not able to make direct interactions with the alcohol substrate. It is one of five cysteines that can be titrated in the denatured, reduced enzyme, but no role has yet been assigned to this residue. To explore the structural basis for improvement in KM we have determined the three-dimensional structure of the C383S variant by X-ray crystallography.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Generation of GO mutants

GO from Fusarium spp. (NRRL 2903) was expressed using the pPICZ{alpha} vector (Invitrogen) in Pichia pastoris X-33. The GO gene encodes a 41 amino acid N-terminal leader sequence comprising a secretion signal and a 17 amino acid pro-sequence that remains associated with the protein when it is purified under copper-free conditions from the heterologous host Aspergillus nidulans.

The constructs used in this work contained the coding sequence for the 17 amino acid pro-form of the enzyme linked in-frame to the {alpha}-mating factor secretion signal of the vector, and are therefore referred to as Pro-GO. The single mutant C383S and the triple mutant C383S/Y436H/V494A, referred to as variant 2-1 and 8-1, respectively (Delagrave et al., 2001Go), were kindly provided by Hercules European Research Center (Barnveld, The Netherlands). Other mutants were generated using the plasmid pPICZ{alpha}proGO as template for the QuikChange Multi Site-Directed mutagenesis kit (Stratagene). The mutagenic oligonucleotides 5'-CTGATGCCATGTCTGGAAACGCTGTC-3' (C383S), 5'-CTGATGCCATGGCTGGAAACGCTGTC-3' (C383A), 5'-CCATTGTTCGCGCTTACCATAGCATTTCC-3' (V494A), 5'-GCAATGGGTTGGCTTTTGCCCGAACG-3' (Y436A) and 5'-GCAATGGGTTGCATTTTGCCCGAACG-3' (Y436H) were purchased from MWG Biotech; the altered codon is underscored, while nucleotide substitutions are shown in bold. The presence of the expected mutation and the absence of further mutations were confirmed by DNA sequencing of the complete GO-encoding gene.

Pichia pastoris transformation and characterization

Plasmid DNA was linearized with SacI (New England Biolabs) and transformed into Mut+ P.pastoris X-33 cells using the EasyComp transformation kit (Invitrogen). Colonies were then screened for activity by plating onto BMMY plates (buffered complex medium containing methanol; Invitrogen manual) containing the components for a chromogenic assay {D-galactose (2%), 2,2'-azino-bis(3-ethylbenz-thiazoline-6-sulphonic acid) (ABTS) (1.2 mg/ml) and horseradish peroxidase [0.04 units (0.4 µg)/ml]}. Transformants that expressed active GO resulted in formation of a green coloration following incubation for between 5 min and several hours at 30°C.

To confirm the identity of the protein being produced by Pichia transformants, genomic DNA was extracted. Briefly, P.pastoris transformants were grown in 10 ml of YPD medium for 16 h. The cells were harvested (1500 g, 10 min) and resuspended in 1 ml of SCED buffer (1 M sorbitol, 10 mM Na citrate, pH 7.5, 10 mM EDTA, 10 mM DTT) containing 100 units/ml of lyticase (Sigma). After incubating at 37°C for 50 min the resulting spheroplasts were harvested (10 000 g, 10 min). The pellet was used for genomic DNA preparation using the Qiagen DNeasy plant kit (Qiagen) by following the manufacturer’s instructions. The genomic DNA was used as template for PCR using the pPIC{alpha}Z vector-specific primers AOX1 (gactggttccaattgacaagc) or ALPHAF (actattgccagca ttgctgc) as forward primers, and 3'AOXB (GTCGACGGC GCTATTCAGATC) as the reverse primer, and the following conditions: 94°C for 2 min, then 25 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min, with a final 72°C for 7 min incubation. Each reaction contained 1x buffer (Amersham Pharmacia), 1 µg of genomic DNA, 50 µM each dNTP, 50 pmol of each primer and 2.5 units of Taq DNA polymerase (Amersham Pharmacia). The PCR products were purified through a Qiagen PCR clean-up column and were used as templates for DNA sequencing using the following primers, labelled at their 5'-ends with an appropriate IRD700 or IRD800 dye. Forward primers (IRD700): AOX1, 5'(IRD700)GAC TGGTTCCAATTGACAAGC3'; ALPHAF 5'(IRD700)ACT ATTGCCAGCATTGCTGC3'; GOFOR, 5'(IRD700)GGC AGCCCTGTTGCGTCAG3'; GOFORB, 5'(IRD700)CCAG TCTAACCGTGGTGTAG3'; reverse primers (IRD800): GOREV, 5'(IRD800)GATCTCAGGTGTAAATACC3'; 3'AOX1, 5'(IRD800)GCAAATGGCATTCTGACATCC3'; 3'AOXB, 5'(IRD800)GTCGACGGCGCTATTCAGATC3'.

The reaction products were analysed on a Li-Cor IR2 automated DNA sequencing instrument.

Protein expression and purification

Cultures (1 litre) of P.pastoris transformants were grown overnight at 30°C in BMGY (Invitrogen manual). When the culture OD600 reached 2–6, cells were harvested by centrifugation and resuspended in BMMY containing 0.5 mM copper sulphate and 0.5% methanol to induce expression of GO and were grown for a further 48 h at 25°C with a further addition of methanol to 0.5% at 24 h (Whittaker and Whittaker, 2000Go). Secreted GO was purified from the culture supernatant using a modification of the affinity/size exclusion procedure described by Hatton and Rodgoeczi (1982)Go and Sun et al. (2001)Go. Proteins were concentrated from the 50 mM Tris–HCl, pH 8, buffered culture supernatant by adding ammonium sulphate to 65% saturation. Protein was redissolved in and dialysed against 100 mM ammonium acetate buffer, pH 7, prior to loading onto a pre-equilibrated Sepharose 6B column. The eluted enzyme was concentrated by ultrafiltration using an Amicon UF unit and YM30 membranes before being copper-loaded according to the dialysis procedure described by Baron et al. (1994)Go.

Kinetic measurements

Protein concentration was determined by absorbance at 280 nm ({epsilon}280 105 400 mM–1 cm–1). Kinetic measurements were made using the coupled assay system to measure hydrogen peroxide production (McPherson et al., 2001Go). A sample of diluted enzyme (50 µl) was added to 1 ml of the assay buffer containing horseradish peroxidase (0.165 mg/ml), 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid), diammonium salt, ABTS (1 mg/ml), D-galactose or 1-methyl-{alpha}-D-galactose (0–700 mM) or guar [1% (w/v)], sodium phosphate (100 mM, pH 7.0) and the absorbance change at 405 nm was recorded. Assays were performed at 25°C. The chromophore {epsilon}405 used was 31 300 mM–1 cm–1. To ensure that copper was not limiting in the reactions, we also performed kinetic measurements following pre-incubation of the enzyme in the presence of 50 µM copper sulphate and conducted the assay in the presence of this concentration of copper sulphate.

For experiments with guar gum, 0.5 g of supercol guar gum (food grade; kindly provided by Hercules Inc.) was suspended in 200 ml of sterile water to give a 0.25% solution. This was incubated at 50°C for 1 h and then centrifuged at 14 000 g for 30 min, and the supernatant was used in kinetic measurements. Assays were performed by mixing 500 µl of 2x assay buffer, 450 µl of 0.25% guar and 50 µl of enzyme. Three independent measurements were made to determine the specific activity for each enzyme being investigated, where the concentration of protein varied between 1 and 0.1625 µg/ml in the assay.

Mass spectrometry

Samples were analysed on a Q-Tof orthogonal acceleration quadrupole time-of-flight mass spectrometer equipped with nano-electrospray ionization (Micromass UK Ltd, Manchester, UK). Samples were dissolved in 1:1 (v/v) aqueous methanol containing 1% formic acid. Data were acquired over the appropriate m/z range and spectra processed using the MassLynx software supplied with the mass spectrometer. The spectra were calibrated with a separate introduction of horse heart myoglobin (MW 16 951.49 Da) and a mass accuracy of 0.01% is expected.

Enzyme oxidation and reduction

Protein samples (2–15 µM) in 0.1 M sodium phosphate buffer pH 7 were chemically oxidized by incubating at room temperature for 5–10 min in the presence of 50 mM potassium ferricyanide. Oxidant was subsequently removed by size exclusion chromatography using a Micro Bio-Spin 6 column (Bio-Rad) equilibrated in 50 mM sodium acetate, pH 4.5. This pH jump procedure for simultaneous oxidant removal and buffer exchange was designed to stabilize the radical form of GO (Rogers et al., 1998Go). Samples were then used for UV–Vis spectral studies in a Shimadzu UV2401-PC spectrophotometer over the range 300–900 nm.

Crystallography

The C383S mutant protein was dialysed into 20 mM HEPES (pH 7.0) overnight and then concentrated to 2 mg/ml using an Amicon Concentrator. The protein was crystallized at 18°C using the sitting drop method where the well solution was 0.2–1.0 M ammonium sulphate, 200 mM sodium acetate (pH 4.6) and 20–30% PEG 4000. Four to 7 µl of well solution were added to 4–7 µl of C383S protein solution in the drop and mixed thoroughly by pipetting. Crystals appeared after 2 weeks and reached ~400 µm in the largest dimension after 8 weeks. Prior to X-ray diffraction data collection, a crystal was placed in cryoprotectant comprising 0.3 M ammonium sulphate, 20% PEG 8000, 25% PEG 400. The crystal was soaked for 2–3 min and then flash frozen in liquid nitrogen. The data were collected on station 14.2 at Daresbury Laboratory, UK.

Data processing and structure determination

The data set was processed using the HKL suite comprising DENZO and SCALEPACK (Otwinowski and Minor, 1997Go). A single frame was used for indexing. Data were scaled and merged in SCALEPACK (Otwinowski and Minor, 1997Go). The output from SCALEPACK was converted to an MTZ format using the CCP4 program MTZ2VARIOUS (Bailey, 1994Go) and then to structure factor amplitudes using the CCP4 program TRUNCATE (Bailey, 1994Go). Phase information was obtained by using the original GO structure (PDB code 1GOG) since the space group and unit cell were isomorphous to the C383S variant. Rigid body refinement was carried out using CNS (Brunger et al., 1998Go) with data to a resolution of 3 Å until the R-values converged (final R = 23.97, free R = 24.42). Water molecules were added using WATER_PICK.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Pichia pastoris transformation and protein purification

DNA sequence analysis confirmed the presence of the desired mutations in the pPICZ{alpha}proGO constructs and these were then transformed into P.pastoris strain X-33. Transformants expressing active GO formed a green colour on BMMY plates containing the chromogenic assay components. All GO mutants tested in this qualitative assay displayed some level of enzyme activity. Cultures (1 l) were induced by the addition of methanol to 0.5% for production of GO protein that was purified from the culture medium by ammonium sulphate precipitation followed by dialysis and then affinity purification using a Sepharose 6B column essentially according to the procedure of Sun et al. (2001)Go. The resulting proteins were pure as judged by SDS–PAGE. The GO was isolated as the inactive blue form of the enzyme as reported by Whittaker and Whittaker (2000Go), probably due to the presence of methanol in the culture medium leading to the semi-reduced form (Cu2+/Tyr).

The wild-type and variant proteins were analysed by electrospray mass spectrometry (ES-MS). The PRO-GO protein produced in P.pastoris displayed a mixture of N-terminal extended species rather than the expected 17 amino acid N-terminal pro-sequence observed when produced in A.nidulans (Rogers et al., 2000Go). The majority of the protein has the additional residues Ser3, Leu2 and Arg1 at the N-terminal end. The expected and observed molecular masses of the mature proteins are shown in Table I. The C383S/V494A variant exhibited a low solubility that prevented ES-MS analysis. For the majority of the samples there is good agreement between the expected and observed molecular masses. The V494A variant shows a substantially higher mass than expected of +42 mass units, which may be due to the presence of other metal ions, such as a calcium or two sodium ions. The variants Y436H/V494A, C383S/Y436H/V494A and the wild-type control all differ from the expected value by 10 or more mass units, although the reason for this is unclear. To confirm that the proteins being characterized contained only the expected mutations, the GO coding region was PCR amplified from P.pastoris genomic DNA isolated from each transformant, and was subjected to DNA sequence analysis. These data confirmed the correct gene sequence with no undesired mutations.


View this table:
[in this window]
[in a new window]
 
Table I.. Molecular masses of proteins determined by ES-MS
 
Enzyme kinetics

The initial selection process that gave rise to these variants (Delagrave et al., 2001Go) was designed to identify variants that would function efficiently using guar gum as substrate. However, difficulties in preparing working solutions of guar gum led initially to the use of 1-methyl-{alpha}-D-galactose as a guar substrate mimic. It was interesting, therefore, to compare the kinetic parameters of the various mutants against this substrate and unmodified D-galactose, the commonly used substrate for GO. Crude cell extracts were previously used to make kinetic measurements (Delagrave et al., 2001Go), so the use of purified protein in the present work should provide more accurate information about the influence of the various mutations on enzyme activity. Initial enzyme activity was measured for the wild-type and each variant across a range of substrate concentrations (10–700 mM) for both D-galactose and 1-methyl-{alpha}-D-galactose, and KM and kcat values were determined. The inclusion of additional copper sulphate at 50 µM did not alter the assay results, indicating that protein samples were not deficient in copper. Table II provides a summary of the kinetic data for both substrates and also reports the catalytic efficiency (kcat/KM) as well as the relative catalytic efficiency compared with wild-type GO. In general, the kinetic parameters for the wild-type GO and the variants were similar with both substrates. We have confirmed the observation that the KM of GO variants containing the C383S substitution is reduced by 3.5- to 4.5-fold compared with wild-type GO (Delagrave et al., 2001Go). This difference is not simply due to the loss of the sulphur atom, as this effect is not observed for the C383A variant, implying that enhancement of substrate binding is due to the serine side chain. The C383S variant shows a minor reduction in kcat, but in terms of catalytic efficiency the dominant effect of KM results in an enzyme with a 3- to 4-fold enhanced kcat/KM. In contrast, the C383A variant represents a slightly worse enzyme with a kcat/KM of 0.5- to 0.6-fold that of the wild-type due to a reduction in kcat.


View this table:
[in this window]
[in a new window]
 
Table II.. Kinetic properties of GO mutants with D-galactose and 1-methyl-{alpha}-D-galactose as substrates
 
Combination of the Y436A or H and V494A variants reveals an interesting feature, with the Y436H/V494A variant showing a catalytic efficiency essentially the same as wild-type, indicating that the positive effect of the V494A variant on kcat is not evident in this double mutant. In contrast, the Y436A/V494A variant does reveal the enhanced kcat, thus proving to be a more efficient enzyme with a 2- to 3-fold enhanced catalytic efficiency. The triple mutant C383S/Y436H/V494A displays an enhanced kcat/KM predominantly due to the KM effect of C383S but with a small kcat enhancement against both substrates tested.

There are some interesting differences in the data for the two substrates, for example, the C383S/Y436A variant displays a 2-fold lower catalytic efficiency against 1-methyl-{alpha}-D-galactose than against D-galactose, largely due to an effect on kcat. The reason for such differences remain unclear at present. Figure 2 provides an overview of the comparative catalytic efficiencies of the variant enzymes with wild-type and for the substrates D-galactose and 1-methyl-{alpha}-D-galactose. The improvement afforded by proteins carrying the C383S variant is clearly demonstrated.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2. Catalytic efficiencies of the GO variants relative to wild-type. The kcat/KM values for the variants are plotted for the two monosaccharides, D-galactose and 1-methyl-{alpha}-D-galactose, used in this study. The plot shows the enhanced catalytic efficiencies of variants that include the C383S variant.

 
In order to assess the relative efficiencies of the variants against guar gum we conducted coupled assays using a 1% (w/v) guar gum solution. Since it was not possible to measure KM data for guar gum, Table III shows a comparison of kcat data for 1-methyl-{alpha}-D-galactose and guar gum as substrates. It is clear that activity against guar gum is poor, being only 3 to 6% of the activity with 1-methyl-{alpha}-D-galactoside as substrate. Even for variants such as C383S/V494A and the triple mutant C383S/Y436H/V494A, which display a 4.9- and 3.3-fold enhancement in catalytic efficiency with the monosaccharide substrate, the activity with guar gum remains low.


View this table:
[in this window]
[in a new window]
 
Table III.. Comparison of kcat for GO and variant proteins with 1-methyl-{alpha}-D-galactoside and guar
 
UV–Vis spectroscopy

Samples of the proteins were oxidized by incubation with ferricyanide at pH 7 to generate the oxidized (radical-containing) form of the enzyme (Cu2+/Tyr·) and this species was then trapped by a pH jump desalting step into 50 mM sodium acetate buffer at pH 4.5 (Rogers et al., 1998Go). The UV–Vis spectra showed the 445 nm band characteristic of the oxidized spectrum. The broad feature centred around 800 nm is not seen, as this arises from a ligand-through-metal-ligand charge transfer and at low pH Tyr495 becomes protonated and dissociates from the metal, so reducing this spectral feature (Whittaker and Whittaker, 1993Go; McGlashen et al., 1995Go). All the variants showed essentially similar spectra for their oxidized states.

X-ray crystallography

We determined the crystal structure of the C383S variant in order to explore structural differences between this variant and wild-type GO that might explain the reduction in KM on substitution of the sulphur atom with an oxygen atom. C383S was crystallized in space group C2 and the three-dimensional structure was solved to a resolution of 2.4 Å. A summary of the crystallographic data collection and refinement statistics is provided in Table IV. Apart from the alteration of Cys383 to a serine residue (Figure 3A and B), there are no major structural changes. Figure 3B shows the presence of a mixed occupancy site with acetate (~40%) and water (~60%) close to the acetate binding site in the original crystal structure (Ito et al., 1991Go, 1994Go). It seems likely this mixed occupancy has arisen during the transfer of crystals from the crystallization liquor (acetate, pH 4.5) to cryoprotectant (no acetate, pH 6.3). The position of the acetate provides an indication of the site of substrate binding, consistent with modelling studies (Ito et al., 1994Go). The Ser383 side chain forms a H-bond interaction to a water that is part of a H-bond network to other waters and the backbone nitrogen between residues Tyr495 and His496 (Figure 3B).


View this table:
[in this window]
[in a new window]
 
Table IV.. Crystallographic data collection and refinement statistics for C383S
 


View larger version (41K):
[in this window]
[in a new window]
 
Fig. 3. (A) Electron density map of wild-type GO showing Cys383. (B) Stereo view of the active site of the C383S variant. Copper is shown as the large green sphere and water molecules as small red spheres, acetate is labelled Ac and indicate the site at which substrate would bind. The structure shows the H-bond interaction between Ser383 and a water that leads to a further water-mediated interaction with the backbone nitrogen between residues Tyr495 and His496.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
The construct used for GO expression in these experiments contains the 17 amino acid N-terminal pro-sequence (Rogers et al., 2000Go; Firbank et al., 2001Go) and mass spectrometry data revealed that the major form of GO contains an additional three residues at the N-terminus (Ser3, Leu2 and Arg1). This finding contrasts with the production of recombinant enzyme from a pro-sequence construct in the filamentous fungus A.nidulans or of the native enzyme from F.graminearum where in both cases there is a single mature enzyme species starting at Ala +1 (McPherson et al., 1992Go; Baron et al., 1994Go). This observation is consistent with a previous report of mixed N-terminal sequences from constructs expressing GO containing a pro-sequence in P.pastoris (Whittaker and Whittaker, 2000Go). The reason for the differences in N-terminal processing by these two hosts is unclear; however, the recombinant enzymes prepared from P.pastoris and A.nidulans exhibit similar properties including kinetics, UV–Vis spectra and three-dimensional structure (Deacon et al., 2004Go).

The wild-type GO and variants display Michaelis–Menten kinetics. The KM for wild-type GO is high at ~60–70 mM. This seems to be a consequence of the broad substrate specificity of the enzyme resulting in an active site capable of binding a range of different alcohol substrates, but therefore being relatively weak at binding any particular substrate.

The V494A variant has been selected in two independent directed evolution experiments, indicating that it must provide a selective advantage under the rather different selection criteria used in these two studies. This residue is adjacent to the copper ligands Tyr495 and His496, and may therefore influence the positions of these residues. In particular, it may affect Tyr495, which plays a critical role as a general base in the first step of the catalytic cycle (Whittaker and Whittaker, 1993Go; Reynolds et al., 1997Go; Rogers et al., 1998Go). It is perhaps more surprising that C383S, which shows a substantial effect on KM, was only identified in one study (Delagrave et al., 2001Go). Perhaps this reflects differences in the selection regimes used. In one case, concentrations of 1-methyl-{alpha}-D-galactoside of 0.72–200 mM were used (Delagrave et al., 2001Go), while in the other, 50 and then 25 mM D-galactose were employed (Sun et al., 2001Go).

The most active mutant identified by Sun et al. (2001)Go contains six mutations, a synonymous mutation in the codon for P136 together with amino acid substitutions of S10P, M70V,G195E,V494A and N535D. Some of these changes, such as N553D and G195E, may enhance protein solubility and reduce the very high pI of GO, making its expression more efficient in Escherichia coli and potentially other expression hosts. This variant shows a 1.7-fold increase in kcat/KM against D-galactose compared with the wild-type protein. In our V494A variant there is a slight reduction in KM and a modest increase in kcat, leading to a 1.3- to 1.8-fold increase in kcat/KM. This is quite similar to the variant A3.E7 (Sun et al., 2001Go) and is also in general agreement with initial observations with V494A (Delagrave et al., 2001Go). Therefore, the additional mutations in A3.E7 are important for enhanced expression and solubility of the protein.

Mutations Y436H and Y436A have little effect on catalytic efficiency alone but in combination with C383S result in substantial enhancement in kcat/KM. Tyr436 lies on the surface of the protein ~27 Å away from the active site copper and it is not clear from the three-dimensional structure of the enzyme how alterations at this residue may affect the catalytic activity of the enzyme. Presumably, changes at this site mediate subtle alterations that influence the modified active site of the C383S variant.

Single and double mutants exhibit general agreement in the kinetics measurement trends observed in crude assays (Delagrave et al., 2001Go) and the present study. Some of the previously reported relative Vmax/KM values are somewhat higher than the relative kcat/KM values reported here. For example, the reported increase in Vmax/KM for the triple mutant (C383S/Y436H/V494A) was 15.9 (Delagrave et al., 2001Go) compared with a level of 3.4–4.4 in the present study. This is probably because the original assays were performed in crude extracts compared with the use of purified proteins here.

Since one aspect of enhancing the activity of GO is to improve activity against polymeric substrates, we assayed the variants with guar as substrate. It should be noted, however, that activity is expressed in terms of kcat as it was not possible to determine KM values for guar gum as substrate. For variants that showed improved activity against 1-methyl-{alpha}-D-galactose, a comparable pattern of increases in relative activity against guar gum was observed (Delagrave et al., 2001Go). This trend is also seen in our data where, for example, C383S/V494A is the most efficient variant against 1-methyl-{alpha}-D-galactose and also shows the highest activity against guar. However, as shown in Table III, the wild-type and variants, including C383S/V494A, all show very low levels of activity against guar in a coupled assay system. Thus, despite differences in catalytic efficiencies against a monosaccharide substrate, these enhanced activities of only 1–2% do not make the enzymes substantially more efficient with guar. Of course the assay system we used was based on initial activity and therefore may not be a good predictor of residual activity in a longer incubation assay system. The major reason for low activity against guar gum is likely to relate to the complex structure of this polymer. The guar gum preparation used was cationic and cold extracted, which should enhance solubility, but could only be used in the assays at concentrations of 1%, resulting in a low concentration of galactose (<20 mM). Since the galactomannan isolated from guar seeds comprises some 38 ± 2% galactose with a complex tertiary structure that will limit enzyme access (Hoffman and Svensson, 1978Go; McCleary et al., 1985Go), many of the D-galactose residues will be inaccessible to the enzyme, thereby lowering the apparent concentration further.

Clearly, the most important single mutation in this study is C383S and the effects of this mutation are maintained in combination with all the other mutations tested. As illustrated in Table II, this mutation results in a 3- to 3.6-fold increase in kcat/KM due to a reduction in KM to ~17 mM. The substitution results in the exchange of a sulphur atom for a smaller oxygen, leading to more space in a pocket that lies behind the copper in the active site. Cys383 does not directly interact with the alcohol substrate, but the presence of the -OH group on Ser383 clearly leads to an enhancement of substrate binding, presumably through indirect interactions with substrate.

The importance of the serine at position 383 is demonstrated by the Ala383 variant, which shows a similar KM to wild-type and a reduced kcat, resulting in an enzyme that is slightly poorer than the wild-type. Interestingly, a C383G variant (Delagrave et al., 2001Go) also displayed a low KM similar to C383S, although the reason for this difference between the Ala and Gly substitutions is unclear. The absence of a side chain in the C383G variant may allow a water molecule to occupy a position equivalent to the -OH group of Ser383, thus mediating similar differences in the H-bond network in the active site.

Examination of the three-dimensional crystal structure of the C383S variant (Figure 3) provides little understanding of the reason for the beneficial effect of this substitution. Cys383 lies within a pocket at the back of the active site. Substitution by Ser replaces a weak H-bond group with a strong H-bonding group and would lead to a stronger interaction with neighbouring water molecules. Such a change could be transmitted through the H-bond network to the substrate binding site, subtly altering its structure or flexibility. Perhaps more obvious differences within the active site would become apparent upon substrate binding. Unfortunately, there is no crystal structure for GO with any bound substrate, therefore preventing direct testing of this possibility at present.

A feature of directed evolution experiments as a tool for the identification of beneficial mutations within proteins is that unexpected substitutions can be observed that lie some distance from the active site. Rationalization of the mechanism(s) by which such changes mediate their beneficial effects is often difficult, presumably as a consequence of the subtle manner in which they lead to concerted effects on protein structure and H-bond networks. The detailed characterization of these mutational variants of GO that display improvements in catalytic properties provides an excellent starting point for further selection strategies to optimize the enzyme to act on new polysaccharide substrates.


    Acknowledgements
 
We are grateful to Denise Ashworth for DNA sequence analysis and Dr Alison Ashcroft for mass spectrometry analysis. This work was supported by funding from Hercules Inc. and BBSRC 24/B11662.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Andreana,P.R., Xie,W., Cheng,H.N., Qiao L, Murphy,D.J., Qu-Ming G and Wang,P.G. (2002) Org. Lett., 4, 1863–1866.[CrossRef][Web of Science][Medline]

Avigad,G., Amaral,D., Asensio,C. and Horecker,B.L. (1962) J. Biol. Chem., 237, 2736–2743.[Free Full Text]

Bailey,S. (1994) Acta Crystallogr. D, 50, 760–763.[CrossRef][Medline]

Baron,A.J., Stevens,C., Wilmot,C., Seneviratne,K.D., Blakeley,V., Dooley,D.M., Phillips,S.E., Knowles,P.F. and McPherson,M.J. (1994) J. Biol. Chem., 269, 25095–25105.[Abstract/Free Full Text]

Brunger,A.T et al. (1998) Acta Crystallogr. D, 54, 905–921.[CrossRef][Medline]

Deacon,S., Mahmoud,K., Spooner,R.K., Firbank,S.J., Knowles,P.F., Phillips,S.E.V. and McPherson,M.J. (2004) Chembiochem, in press.

Delagrave,S. et al. (2001) Protein Eng., 14, 261–267.[Abstract/Free Full Text]

Firbank,S.J., Rogers,M.S., Wilmot,C.M., Dooley,D.M., Halcrow,M.A., Knowles,P.F., McPherson,M.J. and Phillips,S.E.V. (2001) Proc. Natl Acad. Sci. USA, 98, 12932–12937.[Abstract/Free Full Text]

Hall,L.D. and Yalpani,M.A. (1980) Carbohydr. Res., 81, C10–C12.[CrossRef]

Hatton,M.W.C. and Regoeczi,E. (1982) Methods Enzymol., 89, 172–176.

Hoffman,J. and Svensson,S. (1978) Carbohydr. Res., 65, 65–71.[CrossRef]

Ito,N., Phillips,S.E., Stevens,C., Ogel,Z.B., McPherson,M.J., Keen,J.N., Yadav,K.D. and Knowles,P.F. (1991) Nature, 350, 87–90.[CrossRef][Medline]

Ito,N., Phillips,S.E.V., Yadav,K.D.S. and Knowles,P.F. (1994) J. Mol. Biol., 238, 794–814.[Web of Science][Medline]

Kosman,D.J., Ettinger,M.J., Weiner,R.E. and Massaro,E.J. (1974) Arch. Biochem. Biophys., 165, 456–467.[CrossRef][Web of Science][Medline]

Maradufu,A. and Perlin,A.S. (1974) Carbohydr. Res., 32, 93–99.[CrossRef]

Maradufu,A., Cree,G.M. and Perlin,A.S. (1971) Can. J. Chem., 49, 3429–3437.[CrossRef]

McCleary,B.V., Clark,A.H., Dea,I.C.M. and Rees,D.A. (1985) Carbohydr. Res., 139, 237–260.[CrossRef]

McGlashen,M.L., Eads,D.D., Spiro,T.G. and Whittaker,J.W. (1995) J. Phys. Chem., 99, 4918–4922.[CrossRef]

McPherson,M.J., Ogel,Z.B., Stevens,C., Yadav,K.D.S., Keen,J.N. and Knowles,P.F. (1992) J. Biol. Chem., 267, 8146–8152.[Abstract/Free Full Text]

McPherson,M.J., Parsons,M.R., Spooner,R.K. and Wilmot,C.M. (2001) In Messerschmidt,A., Huber,R., Poulos,T. and Wieghardt,K. (eds), Handbook of Metalloproteins. John Wiley & Sons, Ltd, Chichester, Vol. 2, pp. 1272–1283.

Mendonca,M.H. and Zancan,G.T. (1987) Arch. Biochem. Biophys., 252, 507–514.[CrossRef][Web of Science][Medline]

Otwinowski,Z. and Minor,W. (1997) Methods Enzymol., 276, 307–326.[CrossRef][Web of Science]

Reynolds,M.P., Baron,A.J., Wilmot,C.M., Vincombe,E., Stevens,C., Phillips,S.E.V., Knowles,P.F. and McPherson,M.J. (1997) J. Biol. Inorg. Chem., 2, 327–335.[CrossRef]

Rogers,M.S., Knowles,P.F., Baron,A.J., McPherson,M.J. and Dooley,D.M. (1998) Inorg. Chim. Acta, 276, 175–181.[CrossRef]

Rogers,M.S., Baron,A.J., McPherson,M.J., Knowles,P.F. and Dooley,D.M. (2000) J. Am. Chem. Soc., 122, 990–991.[CrossRef]

Sun,L.H., Petrounia,I.P., Yagasaki,M., Bandara,G. and Arnold,F.H. (2001) Protein Eng., 14, 699–704.[Abstract/Free Full Text]

Whittaker,M.M. and Whittaker,J.W. (1993) Biophys. J., 64, 762–772.[Web of Science][Medline]

Whittaker,M.M. and Whittaker,J.W. (2000) Protein Expr. Purif., 20, 105–111.[CrossRef][Web of Science][Medline]

Received September 19, 2003; revised December 19, 2003; accepted December 24, 2003 Edited by Alan Fersht


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Protein Eng Des SelHome page
J. Paramesvaran, E. G. Hibbert, A. J. Russell, and P. A. Dalby
Distributions of enzyme residues yielding mutants with improved substrate specificities from two different directed evolution strategies
Protein Eng. Des. Sel., July 1, 2009; 22(7): 401 - 411.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
17/2/141    most recent
gzh018v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wilkinson, D.
Right arrow Articles by McPherson, M.J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilkinson, D.
Right arrow Articles by McPherson, M.J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?