PEDS Advance Access originally published online on April 5, 2004
Protein Engineering Design and Selection 2004 17(3):251-260; doi:10.1093/protein/gzh029
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2004 Oxford University Press
Effects of novel peptides derived from the acidic tail of synuclein (ATS) on the aggregation and stability of fusion proteins
Department of Microbiology and Brain Korea 21 Project of Medical Sciences, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemoon-gu, Seoul 120-752, Korea
1 To whom correspondence should be addressed. e-mail: jkim63{at}yumc.yonsei.ac.kr
| Abstract |
|---|
|
|
|---|
The acidic tail of
-synuclein (ATS
) has been shown to protect the glutathione S-transferase (GST)ATS
fusion protein from environmental stresses, such as heat, pH and metal ions. In this study, we further demonstrated that the introduction of ATS
into other proteins, such as dehydrofolate reductase and adiponectin, renders the fusion proteins resistant to heat-induced aggregation and that the acidic tail of ß- or
-synuclein can also protect the fusion proteins from heat-induced aggregation. Interestingly, the heat resistance of GSTATS
deletion mutants, which contain shorter peptides derived from the highly charged regions of ATS
, was approximately proportional to the number of added Glu/Asp residues. However, the negative charges in the ATS
-derived peptides appear insufficient to explain the extreme heat resistance of the fusion proteins, since polyglutamates appeared to be much less effective than the ATS
-derived peptides in conferring heat resistance on the fusion proteins. These results suggest that not only the negatively charged residues but also the specific amino acid sequence of ATS
play an important role in conferring extreme heat resistance on the fusion proteins. Furthermore, the heat-induced secondary structural changes and thermal inactivation curves of GSTATS
deletion mutants indicated that the introduction of ATS
-derived peptides does not significantly affect the intrinsic stability of the fusion proteins.
Keywords: fusion protein/heat-resistant proteins/protein aggregation/protein stability/
-synuclein
| Introduction |
|---|
|
|
|---|
Protein aggregation is a complex phenomenon that can occur both in vivo and in vitro, usually resulting in the irreversible loss of the proteins biological activity (Cleland et al., 1993
-synuclein, huntingtin and prion, respectively (Tan and Pepys 1994
Protein aggregation is a major problem, particularly in the biomedical and biopharmaceutical fields (Cleland et al., 1993
; Carpenter et al., 1999
). In addition to eliminating or reducing the proteins therapeutic efficacy and shelf-life, the aggregation of parenterally administrated proteins can cause adverse patient reactions, such as an unwarranted immune response, hypersensitization or even anaphylactic shock (Moore et al., 1980
; Robbins et al., 1987
; Ratner et al., 1990
; Thornton and Ballow, 1993
; Braun et al., 1997
). Therefore, it is essential that aggregate formation should be prevented during all stages of product handling. For this reason, many researchers have been trying to overcome protein aggregation problems (Manning et al., 1989
; Carpenter et al., 1999
; Talaga, 2001
; Horwich, 2002
; Schlieker et al., 2002
). Usually, therapeutic proteins are protected against potential stresses by the addition of proper excipients or additives. In addition, chemical modification and site-directed mutagenesis of proteins are often adopted to produce a more stable form.
In a previous report, we demonstrated that the introduction of the C-terminal acidic tail of
-synuclein (ATS
) into a heat-labile protein, glutathione S-transferase (GST), protects the fusion protein from heat-induced aggregation (Park et al., 2002a
). Furthermore, ATS
appears to protect the fusion protein from pH- and metal-induced protein aggregation, suggesting that the acidic tail can increase the virtual stability of the protein by protecting it from the aggregation induced by environmental stresses (Park et al., 2002a
). In an extension of this study, we systematically investigated the effects of novel peptides derived from the C-terminal acidic tails of synuclein family members (ATS) on the aggregation and stability of fusion proteins.
| Materials and methods |
|---|
|
|
|---|
Materials
Glutathione (GSH), dithiothreitol (DTT), 1-chloro-2,4-dinitrobenzene (CDNB) and isopropyl-ß-D-thiogalactopyranoside (IPTG) were purchased from Sigma (St Louis, MO). Glutathione-Sepharose 4B was obtained from Peptron (Taejon, Korea) and Ni-NTA resin from Invitrogen (Carlsbad, CA). Leupeptin, pepstatin, phenylmethylsulfonyl fluoride (PMSF) and imidazole were purchased from Boehringer Manheim (Mannheim, Germany).
Preparation of dihydrofolate reductase (DHFR)ATS
fusion protein
DHFR and DHFRATS
fusion protein were prepared as described previously (Park et al., 2002b
).
Preparation of adiponectin and adiponectinATS
fusion protein
Adiponectin expression vector was produced by subcloning the globular domain of mouse adiponectin gene (residues 111247) (Scherer et al., 1995
) into the pRSETA vector. AdiponectinATS
fusion construct was produced by consecutively subcloning the globular domain of mouse adiponectin gene and the C-terminal acidic tail of
-synuclein (ATS
, residues 96140) (Ueda et al., 1993
; Jakes et al., 1994
) into the pRSETA vector. Both constructs were verified by DNA sequencing.
The adiponectin and adiponectinATS
expression vectors were transformed into the Escherichia coli strain BL21 (DE3) for protein expression. One liter of bacteria carrying the recombinant plasmids was grown from a single colony at 25°C in LB medium containing 100 µg/ml ampicillin and 0.5% lactose. After overnight culture, bacteria were harvested by centrifugation. The recombinant adiponectin and adiponectinATS
fusion protein were purified by conventional column chromatographic techniques. The bacterial pellet was disrupted by sonication at 4°C in a lysis buffer containing 20 mM TrisHCl, pH 7.5, 1 mM EDTA, 0.002% PMSF and 20 µg/ml leupeptin. The homogenate was then centrifuged for 10 min at 4°C at 10 000 r.p.m. The supernatant was loaded on to a DEAE-Sepharose CL 6B column, which was pre-equilibrated with 20 mM TrisHCl buffer, pH 7.5, containing 0.1 M NaCl and 1 mM EDTA. The column was washed with the same buffer and the bound proteins were eluted from the column by a linear gradient from 0.1 to 0.4 M NaCl in 20 mM TrisHCl buffer, pH 7.5. The eluted adiponectin fractions were pooled and concentrated and were further purified on an FPLC gel-filtration column equilibrated in 20 mM phosphate-buffered saline (PBS), pH 7.5.
Preparation of GSTATSß and GSTATS
fusion proteins
GSTATSß and GSTATS
fusion constructs were generated by subcloning the acidic tail of ß-synuclein (ATSß, residues 85134) (Jakes et al., 1994
) and the acidic tail of
-synuclein (ATS
, residues 96127) (Ji et al., 1997
), respectively, into pGEX vector (Pharmacia Biotech, Buckinghamshire, UK). The protein coding region of the ATSß was amplified by PCR with the 5'-oligonucleotide primer AGCTAAGGATCCAAGA GGGAGGAATTCC containing the underlined BamHI restriction site and the 3'-oligonucleotide primer AAGTAA CTCGAGCTACGCCTCTGGCTCATA containing the underlined XhoI restriction site. The protein coding region of the ATS
was amplified by PCR with the 5'-oligonucleotide primer AAGAATGGATCCCGCAAGGAGGACTTGA containing the underlined BamHI restriction site and the 3'-oligonucleotide primer AATAGCGAATTCCTAGTCTCCCCCACTCT containing the underlined EcoRI restriction site. The amplified DNAs were gel purified, digested with appropriate enzymes, then ligated into the pGEX vector that had been digested with appropriate restriction enzymes and gel purified. All constructs (pGST-ATSß and pGST-ATS
) were verified by DNA sequencing. The GSTsynuclein fusion constructs, pGST-ATSß and pGST-ATS
, were transformed into the E.coli strain, BL21 (DE3) and the recombinant GSTsynuclein fusion proteins (GSTATSß and GSTATS
) were purified by affinity chromatography using glutathione-Sepharose 4B beads. The GSTsynuclein fusion proteins were further purified on an FPLC gel-filtration column pre-equilibrated with PBS, pH 7.4.
Deletion mutant forms of the GSTATS
fusion protein
The DNAs encoding the parts of the acidic tail of
-synuclein (ATS
) were chemically synthesized (Table I). Using these synthetic cDNAs, a series of GSTATS
deletion constructs were generated by ligating the parts of the ATS
gene into pGEX vector using the BamHI and EcoRI restriction sites. GSTSyn103115 contains 13 amino acids of the ATS
(residues 103115), GSTSyn114126 contains 13 amino acids of the ATS
(residues 114126), GSTSyn119140 contains 22 amino acids of the ATS
(residues 119140) and GSTSyn130140 contains 11 amino acids of the ATS
(residues 130140) (Table I). All constructs (pGST-Syn103115, pGST-Syn114126, pGST-Syn119140 and pGST-Syn130140) were verified by DNA sequencing. The GSTATS
deletion constructs, pGST-Syn103115, pGST-Syn114126, pGST-Syn119140 and pGST-Syn130140, were transformed into the E.coli strain BL21 (DE3) and the recombinant proteins were purified by affinity chromatography using glutathione-Sepharose 4B beads. The GSTATS
deletion mutants were further purified on an FPLC gel-filtration column pre-equilibrated with PBS, pH 7.4.
|
Preparation of GSTpolyE fusion proteins
The DNAs encoding the polyglutamates (pentamer and decamer, E5 and E10, respectively) were chemically synthesized (Table I). Using these synthetic cDNAs, GSTpolyE fusion constructs were generated by ligating the annealed oligonucleotides into pGEX vector using the BamHI and EcoRI restriction sites. All constructs were verified by DNA sequencing. The GSTpolyE fusion proteins were purified by affinity chromatography using glutathione-Sepharose 4B beads as described above.
Heat-induced protein aggregation assay
The heat-induced aggregation of GST fusion proteins was qualitatively assayed by SDSPAGE after heat treating the protein samples. Each protein in PBS (0.8 mg/ml) was heated in a boiling water-bath for 10 min and then cooled in the open air. The protein samples were centrifuged at 15 000 r.p.m. for 10 min and the supernatants were analyzed on a 12% SDSpolyacrylamide gel. The level of heat-induced aggregation of GST fusion proteins was also quantitatively measured by monitoring the apparent absorbance (scattering) at 360 nm as a function of time at 65°C (Horwitz, 1992
; Lee and Vierling, 1998
; Kim et al., 2000a
; Uversky et al., 2001
; Park et al., 2002a
). Each protein was diluted to a final concentration of 0.2 mg/ml in the PBS buffer. The protein sample in the spectrophotometric cuvette was placed in a thermostatic cell holder and the apparent absorbance was monitored in a Beckman DU-650 spectrophotometer. Finally, the concentration-dependent protein aggregation of the GST fusion proteins was quantitatively assayed by monitoring their absorbance at 360 nm, while varying the concentra tion from 0.2 to 1.0 mg/ml after heat treatment at 80°C for 5 min.
Circular dichroism (CD) measurements
The CD spectra were recorded on a Jasco (Japan) J715 spectropolarimeter equipped with a temperature control system in continuous mode as described previously (Kim et al., 2000b
; Park et al., 2002a
). Far-UV CD measurements were carried out over the wavelength range 190250 nm with 0.5 nm bandwidth, a 1 s response time and a 10 nm/min scan speed at 25 and 95°C. The spectra shown are an average of five scans that were corrected by subtraction of the buffer signal. Thermal denaturation experiments were performed using a heating rate of 1°C/min and a response time of 1 s. The CD spectra were measured every 0.5°C at a wavelength of 222 nm.
GST activity assay
The enzymatic activity of GST was assayed using a chromogenic substrate, 1-chloro-2,4-dinitrobenzene (CDNB), as described previously (Habig et al., 1974
; Park et al., 2002a
).
| Results |
|---|
|
|
|---|
Heat resistance of DHFRATS
and adiponectinATS
fusion proteins
Introducing the acidic tail of
-synuclein (ATS
, residues 96140; also called Syn96140) into GST appeared to protect the fusion protein from environmental stresses, such as heat, pH and metal ions (Park et al., 2002a
). To investigate whether ATS
can be utilized to suppress the aggregation of other proteins, we first produced a DHFRATS
fusion protein and compared the thermal behaviors of DHFR and the DHFRATS
fusion protein using a qualitative heat-induced protein aggregation assay. Each protein was heat-treated in a water bath at 65 or 100°C for 10 min and the protein solution was centrifuged to remove the precipitates. Subsequently, the supernatant was analyzed on an SDSpolyacrylamide gel (Figure 1A). As expected, DHFRATS
did not precipitate on heat treatment up to 100°C, whereas the DHFR protein completely precipitated at 65°C. We next produced a recombinant adiponectin and adiponectinATS
fusion protein and compared the heat resistance by monitoring the absorbance at 405 nm as a function of incubation temperature, while setting the concentration of each protein sample at 1.0 mg/ml. As shown in Figure 1B, the introduction of ATS
into the adiponectin appeared to protect the fusion protein significantly from heat-induced aggregation, when it was detected on a spectrophotometer. These results indicate that ATS
is a novel peptide conferring heat resistance on the fusion proteins.
|
Heat resistance of the GSTsynuclein fusion protein containing the C-terminal acidic tail of ß-synuclein or
-synuclein
In addition to
-synuclein, ß- and
-synucleins and synoretin, which belong to the synuclein family, have also been identified in humans (Ueda et al., 1993
; Jakes et al., 1994
; Ji et al., 1997
; Surguchov et al., 1999
). The N-terminal amphipathic regions of the synuclein family members are well conserved among the species, but the C-terminal acidic tails are very diverse in size and in sequence (Lavedan, 1998
; Hashimoto and Masliah, 1999
; Iwai, 2000
; Lücking and Brice, 2000
). We next investigated whether GSTATSß and GSTATS
fusion proteins containing the acidic tail of ß-synuclein (ATSß, residues 85134) and that of
-synuclein (ATS
, residues 96127), respectively, are resistant to heat-induced aggregation (Figure 2A). GSTATSß and GSTATS
fusion proteins were qualitatively examined for heat resistance by SDSPAGE, as described previously (Park et al., 2002a
). As shown in Figure 2B, GSTATSß and GSTATS
as well as GSTATS
do not precipitate at all after heat treatment at 100°C for 10 min, which indicates that they are extremely heat resistant. Subsequently, the thermal behaviors of the GSTATS fusion proteins were quantitatively compared by monitoring their absorbance at 360 nm over time, while setting the concentration of each protein at 0.2 mg/ml at 65°C (Horwitz, 1992
; Lee and Vierling, 1998
; Kim et al., 2000a
; Uversky et al., 2001
; Park et al., 2002a
). In this experiment, as shown in Figure 2C, the GST protein had almost aggregated after 23 min. In contrast, the GSTATS fusion proteins did not aggregate at all even 10 min after heat treatment. Next, the GSTATS fusion proteins were quantitatively assayed by monitoring the absorbance at 360 nm while varying the concentration from 0.2 to 1.0 mg/ml after heat treatment at 80°C for 5 min. As shown in Figure 2D, the GSTATS fusion proteins did not precipitate at all after heat treatment, independently of the concentration, whereas the GST protein was completely precipitated at a low concentration. These results indicate that in addition to ATS
, the ATSß and ATS
peptides are also capable of providing heat resistance to other proteins and they can be used in the preparation of fusion proteins having resistance to environmental stresses. Since the amino acid sequence of synoretin is very similar to that of
-synuclein (Surguchov et al., 1999
), the acidic tail of synoretin may have a similar property.
|
Heat-resistance of GSTsynuclein fusion proteins with shorter peptide fragments derived from the ATS

The C-terminal acidic tail of
-synuclein (ATS
) is composed of 45 amino acids (residues 96140) and 15 Glu/Asp residues are scattered throughout the ATS
(Ueda et al., 1993
; Jakes et al., 1994
). We next investigated the thermal behaviors of deletion mutants of the GSTATS
fusion protein which have shorter ATS
peptide fragments. For this purpose, a series of GSTATS
deletion mutants were produced using peptide fragments which span the highly charged regions of ATS
(Figure 3A). GSTSyn103115 contains five Glu/Asp residues out of a total of 13 amino acids contained in a fragment of ATS
(residues 103115); GSTSyn114126 contains 6 Glu/Asp residues out of a total of 13 amino acids contained in a fragment of ATS
(residues 114126); GSTSyn119140 contains nine Glu/Asp residues out of a total of 22 amino acids contained in a fragment of ATS
(residues 119140); and GSTSyn130140 contains five Glu/Asp residues out of a total of 11 amino acids contained in a fragment of ATS
(residues 130140). Isoelectric points (pI) of these fusion proteins are shown in Table II. When these GSTATS
deletion mutants were thermally treated at a high concentration (0.8 mg/ml), GSTSyn96140, which contains the entire region of ATS
, and GSTSyn119140, which contains 22 amino acids of ATS
, did not precipitate at all, whereas GSTSyn103115, GSTSyn114126 and GSTSyn130140, which contain 1113 amino acids, precipitated almost completely (Figure 3B). On the other hand, when these GSTATS
deletion mutants were thermally treated at a low concentration (0.2 mg/ml), none of the fusion proteins aggregated (data not shown).
|
|
The thermal behaviors of the GSTATS
deletion mutants were quantitatively analyzed by monitoring the absorbance at 360 nm over time, while setting the concentration of each protein at 0.2 mg/ml at 65°C. As shown in Figure 3C, the OD360 of the GST protein drastically increased 2 min after heat treatment and most of the protein had aggregated by 3 min. In contrast, the GSTATS
deletion mutants did not aggregate at all even 10 min after heat treatment. Next, the GSTATS
deletion mutants were quantitatively assayed by monitoring the absorbance at 360 nm, while varying the concentration from 0.2 to 1.0 mg/ml after heat treatment at 80°C for 5 min. As shown in Figure 3D, GSTSyn96140, which contains the entire region of ATS
, and GSTSyn119140, which contains 22 amino acids of ATS
, did not precipitate at all after heat treatment under these conditions, whereas GSTSyn103115, GSTSyn114126 and GSTSyn130140, which contain 1113 amino acids of ATS
, did not precipitate at a low concentration, but increasingly aggregated as the concentration rose. It is well known that the extent of protein aggregation is proportional to the concentration (Zettlmeissl et al., 1979
deletion mutants have heat resistance superior to that of wild-type GST and, interestingly, that the heat resistance varies depending on the length and charge density of ATS
. Therefore, optimum effects can be achieved by suitably selecting the length and charge density of ATS
according to the size and hydropathy of the target protein. Thermal behaviors of GSTpolyglutamate fusion proteins
As demonstrated in Figure 3, the heat resistance of the GSTATS
deletion mutants appeared to be approximately proportional to the number of Glu/Asp residues in the ATS
fragments. To address the importance of negative charge in the process of conferring heat resistance on the fusion proteins, we next examined whether GST fusion proteins with genuinely negatively charged peptide fragments such as polyglutamate are heat resistant. For this, a series of GSTpolyglutamate fusion proteins were constructed by ligating the gene part of polyglutamate into pGEX vector (Figure 4A). Purified proteins of GSTE5 (containing five consecutive glutamate residues) and GSTE10 (containing 10 consecutive glutamate residues) are demonstrated in Figure 4B and the pI values of these fusion proteins are shown in Table II. Each protein suspended in PBS (0.8 mg/ml) was heated in a boiling water-bath for 10 min and then cooled in air. The protein samples were centrifuged at 15 000 r.p.m. for 10 min and the supernatants were analyzed on a 12% SDSpolyacrylamide gel. Neither GSTE5 nor GSTE10 showed any protein bands after heat treatment, which indicates that they had been completely precipitated by heat treatment (data not shown). This indicates that, unlike the GSTATS
fusion proteins, neither GSTE5 nor GSTE10 is heat resistant under such stringent conditions.
|
The thermal behaviors of the GSTE5 and GSTE10 fusion proteins were quantitatively assayed by monitoring their absorbance at 360 nm over time, while setting the concentration of each protein at 0.2 mg/ml at 65°C. As shown in Figure 4C, the GST protein was completely aggregated after 23 min and the GSTE5 fusion protein was aggregated to a considerable extent under the same conditions, whereas the GSTE10 fusion protein did not aggregate at all under these conditions. Next, the GSTpolyglutamate fusion proteins were quantitatively assayed by monitoring their absorbance at 360 nm, while varying the concentration from 0.2 to 1.0 mg/ml after heat treatment at 80°C for 5 min. As shown in Figure 4D, the GST protein was completely precipitated at a low concentration and most of the GSTE5 protein was precipitated at a high concentration. In contrast, the GSTE10 protein was partially precipitated after heat treatment under these conditions and increasingly aggregated as the concentration rose. Hence as the length of the polyglutamate increases, the negative charge considerably increases, thus causing the amount of aggregation decrease. Interestingly, however, it is noted that the polyglutamate tail is considerably less effective in providing heat resistance, as compared with ATS peptides containing the same number of glutamate residues (Figures 3 and 4; Table II). In fact, GSTSyn130140 shows heat resistance far superior to that of GSTE5, which contains the same number of glutamate residues, and slightly better heat resistance than that of GSTE10, which contains twice as many glutamate residues (compare Figure 3D with Figure 4D). Therefore, it is suggested that the characteristic amino acid sequence of ATS, in addition to the increased solubility of the proteins due to the increase in the negative charge, plays an important role in conferring resistance to heat-induced aggregation.
CD spectra of GSTSyn119140 and GSTE10
To address the conformational properties of the introduced peptide tags, we compared the CD spectra of representing fusion proteins (Figure 5). The far-UV CD spectra of GSTSyn119140 indicate that the protein contains well-ordered secondary structure elements (absorption bands at 210220 nm in Figure 5A). The CD spectrum at room temperature appeared to be very similar to that of GST (figure 7A in Park et al., 2002a
). Interestingly, however, the far-UV CD spectra of the GSTE10 exhibit an additional absorption band at 195 nm, which is characteristic of random-coiled polypeptides (Figure 5B). These results suggest that the Syn119140 peptide in GSTSyn119140 may be packed together with the GST domain, but the E10 peptide in GSTE10 may be extended from the GST domain to the solvent forming a random-coil peptide.
|
Secondary structural changes of GSTATS
deletion mutants and GSTpolyE fusion proteins
The secondary structural changes of the GSTATS
deletion mutants and GSTpolyE fusion proteins induced by the increase of temperature were investigated by CD spectroscopy. Specifically, to compare the thermal stabilities of the fusion proteins, the thermal unfolding of each protein was monitored at 222 nm as a function of temperature (Figure 6). Consistent with a previous report (figure 7A in Park et al., 2002a
), the temperature-induced unfolding of GST started around 54°C and the CD signal kept diminishing until 100°C due to the complete precipitation of the protein (data not shown). Unlike in the case of wild-type GST protein, however, the temperature-induced unfolding of the GSTATS
deletion mutants all took place in two stages (Figure 6AD). The first transition started at
5458°C, whereas the second transition occurred at >90°C. The melting curves of GSTpolyE fusion proteins appeared to be similar to those of the GSTATS
deletion mutants (Figure 6E and F), although the secondary transition was less clearly seen. It is highly likely that the secondary transition of GST is not able to be observed, since the protein precipitates before that temperature. Interestingly, the first transition temperatures of the GSTATS
deletion mutants and GSTpolyE fusion proteins all appeared to be similar or slightly higher than that of wild-type GST, suggesting that the introduced acidic tails do not significantly affect the intrinsic stability of the protein.
|
Enzyme activity of GSTATS
deletion mutants after heat-treatment
We next compared the thermostability of the GSTATS
deletion mutants by measuring their thermal inactivation curves (Figure 7), which were used to determine the T50 values, i.e. the temperatures at which 50% of the initial enzymatic activity is lost after heat treatment. As shown in Figure 7, the T50 values of the GSTATS
deletion mutants are only slightly higher than that of wild-type GST. This suggests that the stabilizing effect of ATS
peptides on the enzymatic activity is not particularly high, at least in the case of GST.
|
| Discussion |
|---|
|
|
|---|
Previous studies have demonstrated that the C-terminal acidic tail of
-synuclein (ATS
) is capable of protecting the GSTATS
fusion protein from stress-induced aggregation (Park et al., 2002a
into other proteins, such as DHFR and adiponectin, renders the fusion proteins resistant to heat-induced aggregation. In addition to ATS
, ATSß and ATS
also appear to protect the fusion protein from heat-induced aggregation. These ATS fusion proteins also appear to be resistant to pH- and metal-induced aggregation (our unpublished results). These results indicate that ATS peptides are novel peptides, conferring resistance to environmental stresses, such as heat, pH and metal ions. These results also imply that many biologically or medically important proteins, particularly those having aggregation problems, could be transformed into a more resistant protein by introducing the ATS peptides.
The C-terminal acidic tails of the synuclein family members are diverse in size and sequence, but they are all highly charged with many Glu/Asp residues (Lavedan, 1998
; Hashimoto and Masliah, 1999
; Iwai, 2000
; Lücking and Brice, 2000
). Earlier studies have shown that protein solubility is approximately proportional to the square of the net charge on the protein (Tanford, 1961
). Therefore, the abolishment of heat-induced aggregation in ATS containing fusion proteins at high temperatures seems to be primarily due to the presence of the negatively charged residues in the ATS peptides, since these negative charges increase the solubility of the protein, by increasing its hydrophilicity and by causing intermolecular interactions to be unfavorable. This possibility is supported by the fact that the GSTATS
deletion mutants, which contain shorter peptides derived from the highly charged regions of ATS
, all appear to be relatively heat resistant. In particular, the heat resistance of the GSTATS
deletion mutants is approximately proportional to the number of Glu/Asp residues in the ATS
fragments in addition to the peptide chain length. For example, GSTSyn119140, which contains nine Glu/Asp residues out of a total of 22 amino acids contained in a fragment of ATS
, is extremely heat resistant, as in the case of GSTSyn96140. In contrast, GSTSyn103115, GSTSyn114126 and GSTSyn130140, which contain 56 Glu/Asp residues out of a total of 1113 amino acids contained in a fragment of ATS
, are less heat resistant. Consequently, the heat resistance of the GSTATS
deletion mutants is correlated with their pI values (Table II). These results indicate that the negative charges contributed by the Glu/Asp residues in the ATS
-derived peptides are crucial for conferring heat resistance on the fusion proteins.
However, the negative charges in the ATS
-derived peptides appear insufficient to explain the extreme heat resistance of the fusion proteins. As shown in Figure 4, GSTE5, which contains five consecutive Glu residues, is much less heat resistant than GSTSyn130140 or GSTSyn103115, which contain the same number of Glu/Asp residues. Similarly, GSTE10, which contains 10 consecutive Glu residues, is much less heat resistant than GSTSyn119140, which contains nine Glu/Asp residues. The heat resistance of GSTE10 is fairly comparable to that of GSTSyn130140. These results suggest that not only the charged residues, but also the specific amino acid sequence of ATS
, plays an important role in conferring extreme heat resistance on the fusion proteins. It would be interesting to investigate in more detail just why the ATS peptides fused in GST are superior to other highly charged peptides for protecting the fusion proteins from stress-induced aggregation.
To address the above question, we compared the far-UV CD spectra of GSTSyn119140 and GSTE10 and found that the conformations of the introduced peptide tags might be different (Figure 5). The CD spectra of GSTSyn119140 and GSTE10 suggest that the Syn119140 peptide might be packed with the GST domain in the fusion protein, but the E10 peptide might protrude from the GST domain, forming an exposed random coil-like conformation. This reflects that, unlike the E10 peptide, Syn119140 peptide has a potential to interact with other proteins, as has been implied by previous studies (reviewed in Lücking and Brice, 2000
). Presumably, the hydrophobic residues, which are scattered throughout the ATS, play an important role in the ATS peptideprotein interactions. Based on this observation, it is tempting to speculate that the intramolecular and/or intermolecular peptideprotein interactions mediated by the characteristic amino acid sequence of ATS peptides play an additional role in conferring the extreme heat resistance on the fusion proteins.
The effects of ATS
peptides on the stability of the fusion proteins were assessed by analyzing their heat-induced secondary structural changes and thermal inactivation curves (Figures 6 and 7, respectively). To compare the stabilities of the proteins, it is useful to determine the melting temperature (Tm) of each protein by CD spectroscopy or calorimetric analysis. Tm has been widely used as a thermodynamic parameter of the conformational stability of the protein. However, Tm can be correctly determined only for the reversible transition. For the irreversible transition, Tm is meaningless and often contains numerous errors. For example, the heat-induced unfolding of GST starts at around 54°C and the CD signal at 222 nm keeps diminishing until 100°C as the protein precipitates (Park et al., 2002a
). The Tm value determined from this melting curve cannot but be overestimated. To describe quantitatively the protein stability for the irreversible transition, we therefore compared the derived temperatures for the onset of unfolding (Tu values), which were obtained by linear extrapolation of the melting curves to the temperature axis (Table II), as previously tried by Chrunyk and Wetzel to determine the derived temperatures for the onset of aggregation (Chrunyk and Wetzel, 1993
). The Tu values of the GSTATS
deletion mutants and GSTpolyE fusion proteins appear to be around 5458°C (Figure 6; Table II), whereas that of GST is about 54°C (figure 7A in Park et al., 2002a
). These results indicate that the introduction of the acidic tails does not significantly affect the intrinsic stability of the protein. Rather, they appear to somewhat stabilize the fusion proteins. Analysis of the thermal inactivation curves results in a similar conclusion (Figure 7). The T50 values, the temperature at which 50% of the initial enzyme activity is lost after heat treatment, of the GSTATS
deletion mutants appear to be very similar to or slightly higher than that of wild-type GST. These results also indicate that the introduction of ATS
-derived peptides does not significantly affect the intrinsic stability of the protein.
In summary, we have demonstrated that the introduction of the ATS peptides into heat-labile proteins protects the fusion proteins from heat-induced aggregation. Furthermore, our data suggest that the ATS peptides do not significantly affect the intrinsic stability of the fusion proteins. Introducing the ATS peptides will also contribute to the proteins solubility, since it greatly increases the hydrophilicity of the protein and makes intermolecular interactions unfavorable through electrostatic repulsion. Therefore, the ATS peptides can be utilized to increase protein solubility and to protect the protein from environmental stresses. Many biologically or medically important proteins that have solubility problems or stress-induced aggregation problems might be saved by introducing the ATS peptides. Introducing the ATS peptides could make the protein more robust and enhance its shelf-life and duration time in vivo. Consequently, introducing the ATS peptides could also make the protein more amenable to use in alternative delivery methods and formulations.
| Acknowledgements |
|---|
We thank Dr R.Jakes (MRC, Cambridge) for the recombinant DNA of
-synuclein and Dr H.S.Rhim (Catholic University, Seoul, Korea) for the GSTSyn96140 construct. This work was supported in part by a grant from KOSEF (R01-1999-000-00129-0) and by a grant from ATGen Co. Ltd.
| References |
|---|
|
|
|---|
Braun,A., Kwee,L., Labow,M.A. and Alsenz,J. (1997) Pharm. Res., 14, 14721478.[CrossRef][Web of Science][Medline]
Carpenter,J.F., Kendrick,B.S., Chang,B.S., Manning,M.C. and Randolph,T.W. (1999) Methods Enzymol., 309, 237255.
Chrunyk,B.A. and Wetzel,R. (1993) Protein Eng., 6, 733738.
Cleland,J.L., Powell,M.F. and Shire,S.J. (1993) Crit. Rev. Ther. Drug Carrier Syst., 10, 307377.[Web of Science][Medline]
Cohen,F.E. (1999) J. Mol. Biol., 293, 313320.[CrossRef][Web of Science][Medline]
Fink,A.L. (1998) Fold. Des., 3, R9R23.[CrossRef][Web of Science][Medline]
Ghiso,J. and Frangione,B. (2002) Adv. Drug Deliv. Rev., 54, 15391551.[CrossRef][Web of Science][Medline]
Habig,W.H., Pabst,M.J. and Jakoby,W.B. (1974) J. Biol. Chem., 249, 71307139.
Hashimoto,M. and Masliah,E. (1999) Brain Pathol., 9, 707720.[Web of Science][Medline]
Hlodan,R., Craig,S. and Pain,R.H. (1991) Biotechnol. Genet. Eng. Rev., 9, 4788.[Medline]
Horwich,A. (2002) J. Clin. Invest., 110, 12211232.[CrossRef][Web of Science][Medline]
Horwitz,J. (1992) Proc. Natl Acad. Sci. USA, 89, 1044910453.
Iwai,A. (2000) Biochim. Biophys. Acta, 1502, 95109.[Medline]
Jaenicke,R. (1995) Philos. Trans. R. Soc. Lond. B Biol. Sci., 348, 97105.[Web of Science][Medline]
Jakes,R., Spillantini,M.G. and Goedert,M. (1994) FEBS Lett., 345, 2732.[CrossRef][Web of Science][Medline]
Ji,H., Liu,Y.E., Jia,T., Wang,M., Liu,J., Xiao,G., Joseph,B.K., Rosen,C. and Shi,Y.E. (1997) Cancer Res., 57, 759764.
Kane,J.F. and Hartley,D.L. (1991) Bioprocess Technol., 12, 121145.[Medline]
Kiefhaber,T., Rudolph,R., Kohler,H.H. and Buchner,J. (1991) Biotechnology, 9, 825829.[CrossRef][Medline]
Kim,T.D., Paik,S.R., Yang,C.H. and Kim,J. (2000a) Protein Sci., 9, 24892496.
Kim,T.D., Ryu,H.J., Cho,H.I., Yang,C.H. and Kim,J. (2000b) Biochemistry, 39, 1483914846.[CrossRef][Medline]
Lansbury,P.T. (1999) Proc. Natl Acad. Sci. USA, 96, 33423344.
Lavedan,C. (1998) Genome Res., 8, 871880.
Lee,G.J. and Vierling,E. (1998) Methods Enzymol., 290, 350365.[Web of Science][Medline]
Lücking,C.B. and Brice,A. (2000) Cell Mol. Life Sci., 57, 18941908.
Manning,M.C., Patel,K. and Borchardt,R.T. (1989) Pharm. Res., 6, 903918.[CrossRef][Web of Science][Medline]
Moore,W.V. and Leppert,P. (1980) J. Clin. Endocrinol. Metab., 51, 691697.
Park,S.M., Jung,H.Y., Chung,K.C., Rhim,H., Park,J.H. and Kim,J. (2002a) Biochemistry, 41, 41374146.
Park,S.M., Jung,H.Y., Kim,T.D., Park,J.H., Yang,C.H. and Kim,J. (2002b) J. Biol. Chem., 277, 2851228520.
Przybycien,T.M. (1998) Curr. Opin. Biotechnol., 9, 164170.[CrossRef][Web of Science][Medline]
Ratner,R.E., Phillips,T.M. and Steiner,M. (1990) Diabetes, 39, 728733.[Abstract]
Robbins,D.C., Cooper,S.M., Fineberg,S.E. and Mead,P.M. (1987) Diabetes, 36, 838841.[Abstract]
Ross,C.A. (2002) Neuron, 35, 819822.[CrossRef][Web of Science][Medline]
Scherer,P.E., Williams,S., Fogliano,M., Baldini,G. and Lodish,H.F. (1995) J. Biol. Chem., 270, 2674626749.
Schlieker,C., Bukau,B. and Mogk,A. (2002) J. Biotechnol., 96, 1321.[CrossRef][Web of Science][Medline]
Serpell,L.C., Sunde,M. and Blake,C.C.F. (1997) Cell. Mol. Life Sci., 53, 871887.[CrossRef][Web of Science][Medline]
Speed,M.A., Wang,D.I.C. and King,J. (1995) Protein Sci., 87, 15541559.
Speed,M.A., Wang,D.I.C. and King,J. (1996) Nat. Biotechnol., 14, 12831287.[CrossRef][Web of Science][Medline]
Surguchov,A., Surgucheva,I., Solessio,E. and Baehr,W. (1999) Mol. Cell. Neurosci., 13, 95103.[CrossRef][Web of Science][Medline]
Talaga,P. (2001) Mini Rev. Med. Chem., 1, 175186.[CrossRef][Medline]
Tan,S.Y. and Pepys,M.B. (1994) Histopathology, 25, 403414.[Web of Science][Medline]
Tanford,C. (1961) Physical Chemistry of Macromolecules. Wiley, New York.
Thornton,C.A. and Ballow,M. (1993) Arch. Neurol., 50, 135136.
Ueda,K. et al. (1993) Proc. Natl Acad. Sci. USA, 90, 1128211286.
Uversky,V.N., Li,J. and Fink,A.L. (2001) J. Biol. Chem., 276, 1073710744.
Williams,D.C., Van Frank,R.M., Muth,W.L. and Burnett,J.P. (1982) Science, 215, 687689.
Zettlmeissl,G., Rudolph,R. and Jaenicke,R. (1979) Biochemistry, 18, 55675571. [CrossRef][Medline]
Received December 16, 2003; revised February 27, 2004; accepted March 16, 2004 Edited by Taiji Imoto
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






