Skip Navigation


PEDS Advance Access originally published online on May 27, 2004
Protein Engineering Design and Selection 2004 17(4):305-314; doi:10.1093/protein/gzh044
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary data
Right arrow All Versions of this Article:
17/4/305    most recent
gzh044v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tenno, T.
Right arrow Articles by Hiroaki, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tenno, T.
Right arrow Articles by Hiroaki, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Protein Engineering, Design & Selection vol. 17 no. 4 © Oxford University Press 2004; all rights reserved

High-throughput construction method for expression vector of peptides for NMR study suited for isotopic labeling

Takeshi Tenno1,2, Natsuko Goda1, Yukihiro Tateishi1, Hidehito Tochio1, Masaki Mishima3, Hidenori Hayashi4, Masahiro Shirakawa1 and Hidekazu Hiroaki1,5

1Graduate School of Integrated Science, Yokohama City University, 1-7-29 Suehirocho, Tsurumi, Yokohama, Kanagawa 230-0045, 2Graduate School of Science and Engineering and 4Division of Plant Molecular Biotechnology, Cell-Free Science and Technology Research Center, Ehime University, 3 Bunkyocho, Matsuyama, Ehime 790-8577 and 3Graduate School of Biological Sciences, Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0101, Japan

5 To whom correspondence should be addressed. E-mail: hiroakih{at}tsurumi.yokohama-cu.ac.jp


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Fusion protein constructs for labeled peptides were generated with the 114 amino acid thioredoxin (TRX), coupled with the incorporation of a histidine tag for affinity purification. Two tandem AhdI sites were designed in the multiple cloning site of the fusion vector according to our novel unidirectional TA cloning methodology named PRESAT-vector, allowing one-step background-free cloning of DNA fragments. Constructs were designed to incorporate the four residue sequence Ile–Asp–Gly–Arg to generate pure peptides following Factor Xa cleavage of the fusion protein. The system is efficient and cost-effective for isotopic labeling of peptides for heteronuclear NMR studies. Seven peptides of varying length, including pituitary adenylate cyclase activating polypeptide (PACAP), vasoactive intestinal peptide (VIP) and ubiquitin interacting motif (UIM), were expressed using this TRX fusion system to give soluble fusion protein constructs in all cases. Three alternative methods for the preparation of DNA fragments were applied depending on the length of the peptides, such as polymerase chain reaction, chemical synthesis or a ‘semi-synthetic method’, which is a combination of chemical synthesis and enzymatic extension. The ability easily to construct, express and purify recombinant peptides in a high-throughput manner will be of enormous benefit in areas of biomedical research and drug discovery.

Keywords: Escherichia coli expression system/isotopic labeling/NMR/TA cloning/thioredoxin fusion protein


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Biologically active peptides and peptide hormones represent an important group of biomolecules, which play an essential role in a number of cellular and physiological responses. Included in this group of biomolecules are the endogenous opioid peptides (Bodnar and Hadjimarkou, 2002Go), growth hormone-releasing peptides and gastrointestinal peptides, such as the glucagon superfamily (Sherwood et al., 2000Go). Bioactive peptides are currently attracting the attention of many researchers in the area of cell biology and medical applications. Our research efforts are focused on the 27 residue pituitary adenylate cyclase activating polypeptide (PACAP27), a member of the glucagon superfamily. The peptide activates a cellular signaling cascade via the cyclic-AMP pathway functioning hormone, neurohormone, neurotransmitter and trophic factor mainly from the hypothalamus through PAC1-R, VPAC1-R and VPAC2-R receptors (Vaudry et al., 2000Go; Laburthe and Couvineau, 2002Go; Laburthe et al., 2002Go). Vasoactive intestinal peptide (VIP) is another important member of this superfamily, which also shares VPAC-receptors with PACAP (Laburthe et al., 2002Go, Gozes and Furman, 2003Go). VIP is a 28 amino acid peptide showing 70% identity with PACAP27. Furthermore, several VIP-derived fragments, VIP(6–28) and VIP(11–28), are known to be potential antagonists of PACAP27 (Pachter et al., 1989Go; Fishbein et al., 1994Go; Ichinose et al., 1994Go; Haghjoo et al., 1996Go). Additional evidence that small segments of conserved peptide sequence can behave as independent functional motifs is exemplified by the 20-residue {alpha}-helical ubiquitin-interacting motif (UIM) (Hofmann and Falquet, 2001Go; Fujiwara et al., 2004Go; Fisher et al., 2003Go; Mueller and Feigon, 2003Go). UIM can bind to monomeric ubiquitin (Ub) and polymeric Ub chains, and also the ubiquitin-like domains (UBL) of many cellular proteins (Buchberger, 2002Go). More than 250 UIMs have been identified in genome sequences and these have been linked to various cellular functions including proteasomal protein degradation, regulation of DNA replication and repair, cell cycle control and protein trafficking (Di Fiore et al., 2003Go). The functional diversity of proteins containing a UIM motif reflects the variety of cellular roles of the ubiquitin system. Thus a comparative study of UIM peptides in terms of structure–function relationships and mechanism of molecular recognition between Ub and UIMs is of enormous interest.

When multidomain proteins are subjected to partial proteolysis, polypeptide fragments may be liberated which retain the full biological activity of the parent domains. The ability of peptides to retain biological activity has been used to develop therapeutic agents against disease (Lauta, 2000Go; Jacobsen, 2002Go; Nathisuwan and Talbert, 2002Go), peptide vaccines (Celis, 2002Go) and diagnostic imaging reagents (Behr et al., 2001Go). Currently the most common method of peptide production is solid-state synthesis. However, this technique is hampered by both high cost and relatively low yields, especially for larger peptides (e.g. >50 residues). Furthermore, solid-state synthesis of isotopically labeled peptides for multidimensional NMR studies is not a viable option, owing to the prohibitively high cost.

Incorporation of isotopic labels (13C, 15N, 2H) within a polypeptide using a bacterial recombinant system is an alternative to the chemical synthetic approach. Expression can potentially yield high levels of peptide at relatively low cost, with easy incorporation of isotopic labels. Unfortunately, expression of peptides in vivo has not been the preferred option for high-throughput studies because plasmid construction is time consuming. In addition, the unstructured state of peptides in the bacterial cytosol makes them susceptible to proteases and may also cause solubility problems. One solution to high-yield recombinant peptide production is the use of a fusion protein construct, which can aid peptide stability and solubility following expression. Fusion proteins incorporating various affinity tags and proteolytic cleavage sites can assist in the purification and subsequent peptide fragment production. Several groups have reported successfully using fusion constructs encoding a hydrophobic protein, which produces an insoluble product that is sequestered within inclusion bodies (Jones et al., 2000Go; Majerle et al., 2000Go; Sharon et al., 2002Go). However, reconstitution of inclusion body proteins involves an additional step using chemical denaturants for subsequent peptide production. A cytosolic soluble protein as a fusion partner, such as glutathione S-transferase (Smith and Johnson, 1988Go; Kami et al., 2002Go) and GB-1 (Lindhout et al., 2003Go) can also be used. However, recovery of full-length peptide from potentially contaminated shorter fragments caused by endogenous proteolysis must be achieved by other methods, such as affinity purification using a C-terminal Hisx6 tag (Lindhout et al., 2003Go). Alternatively, periplasmic thioredoxin (TRX) as the fusion partner was proposed by several groups. (LaVallie et al., 1993Go; Uegaki et al., 1996Go) The advantage of the TRX fusion approach over other techniques is the production of a soluble fusion protein in the bacterial periplasmic space via the non-standard secretion pathway, resulting in high expression levels together with significant protection against endogenous proteases.

In this paper, we report a ‘high-throughput’ TRX fusion protein expression system combined with the novel PRESAT-vector (Potential Restriction Enzyme Selectable Asymmetric T-vector)-based TA cloning methodology (Goda et al., 2004Go). We have recently developed the PRESAT-vector methodology, which is a technique of unidirectional TA cloning at the multiple cloning site to generate GST-fusion protein expression vectors. Thus, DNA encoding the peptide of interest with a 3'-dA overhang can be incorporated into the vector using the one-step TA cloning protocol. We constructed plasmids encoding seven different peptides fused to TRX, a 114-amino acid soluble globular domain. Expression was under the control of a strong T7 promoter and the recombinant Hisx6-tagged proteins were then purified by metal affinity chromatography. The ability of the TRX fusion system to express many different peptide fragments is demonstrated in this study. We have cloned, expressed and purified seven different peptides, PACAP27, VIP, VIP(6–28) and VIP(11–28), Hrs-UIM, STAM2-UIM and MJD1-UIM. In addition, we used three different methods for preparation of DNA coding the peptide of interest, polymerase chain reaction (PCR) amplified cDNA, as well as synthetic DNA and semi-synthetic DNA. The use of semi-synthetic DNA, in which partly overlapped oligonucleotides were synthesized and subjected to enzymatic extension, is beneficial to reduce the cost and the risk of long synthetic oligonucleotides. An additional three bases (5'-ACC) were included in the reverse strand, which allowed subsequent restriction enzyme selection for ORF orientation after TA-vector cloning. The methodology is quick and highly efficient. Moreover, we demonstrate the ability of this system to produce isotopic labeling of peptides for NMR studies and to provide a strong prospect for future production of peptides for various industrial, pharmaceutical and general research applications.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Reagents

Restriction enzymes NheI, NdeI, XhoI and AhdI were obtained from New England Biolabs and KpnI from Toyobo. T4 DNA ligase, T4 DNA polymerase, Wizard plasmid miniprep kit and Wizard SV DNA gel purification kit were purchased from Promega. Taq DNA polymerase was purchased from either Invitrogen or Takara. The cloning vector pGEM-T was purchased from Promega and the expression vectors pET21b and pET32a from Novagen. All oligonucleotide sequences are summarized in Table I. Oligonucleotide primers were obtained from Hokkaido System Science (Sapporo, Japan). Factor Xa was purchased from New England Biolabs.


View this table:
[in this window]
[in a new window]
 
Table I.. Amino acid and corresponding DNA sequences of peptides used in this study

 
Preparation of pET-TRX-PACAP27GC vector

We chose a pET-based vector as template to design the TRX fusion constructs because of the generally recognized high level of expression afforded by the T7 promoter (Studier and Moffatt, 1986Go; Miroux and Walker, 1996Go). Our prototype PACAP27G expressing vector, pET32aPACAP27G, was constructed from pET32a into which a synthetic 129 bp DNA fragment encoding PACAP27G was inserted (see Supplementary Figure S1, available at PEDS online). The linker sequence of our prototype vector contained an enterokinase cleavage site, which caused non-specific cleavage on removal of TRX-tag from PACAP27G (data not shown). In this study, we incorporated a new minimum linker sequence containing a hexa-histidine (Hisx6) tag and Factor Xa cleavage site C-terminal to TRX. For this purpose, the linker sequence containing Hisx6 and the Factor Xa cleavage site were attached N-terminal to the PACAP27G gene by PCR using the primers dGCTAGCCATCACCACCACCACCACAGCAGCGGCATTGACGGCCGGCATAGCGATGGCATCTTTACC and dCTCGAGGAATTCACTAGTGGATCCAAGCTTTTATTAGCCCAGCAC and then subcloned into pGEM-T. An NdeI fragment containing the thioredoxin gene from pET32a and an NheI–XhoI fragment containing Hisx6 plus Factor Xa plus PACAP27G was incorporated into the NdeI site and the NheI and XhoI sites of pET21b, respectively.

Preparation of pET-TRX-PRESAT vector

pET-TRX-PACAP27GC was converted to pET-TRX-PRESAT according to the PRESAT-vector methodology (Goda et al., 2004Go). For this purpose, two AhdI sites were created after the Factor Xa multiple cloning site, while one endogenous AhdI site within the AmpR genetic marker was disrupted using a combination of PCR mutation and site-directed mutagenesis. Firstly an ~150 bp fragment was PCR amplified using primers dGCACTAGTGGTTCTGGTTCTGGCGCTAGCCATCACCACCAC and dTTGTTAGCAGCCGGATCTCA and pET-TRX-PACAP27GC as a template. This fragment was subcloned into pGEM-T vector (Promega) according to the standard T/A-cloning protocol for further mutation. This pGEM-T subcloned linker contains the region between the NheI and XhoI sites illustrated in Figure 1a, followed by a ‘GSGSG’ pentapeptide extension, which will be used for further optimization of the linker length between thioredoxin and Hisx6 tag (data not shown). Then, starting from this pGEM-T subcloned linker, the first AhdI site was engineered by PCR mutation using primers dGGATCCGACCATTGGTCTTATTAGCCCAGCACCGCCG and dGATTTAGGTGACACTATAG. This PCR fragment was digested by NheI and BamHI and then ligated between NheI and BamHI sites of the pET-TRX-PACAP27GC replacing the region containing the TRX_PACAP27G gene. Finally, creation and disruption of remaining AhdI sites was performed simultaneously using 5'-phosphorylated mutation primers, d-pGTTATCTACACCACGGGGAGCCAGGCAACTATGG and d-pGGCATTGACGGTCGGTCTAGCGATGGCATC, and the Gene Editor mutagenesis kit (Promega).



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 1.. (a) Schematic representation of pET-TRX-PACAP27GC vector for expressing TRX_PACAP27G fusion protein. (b) Schematic representation and TA cloning site sequence of pET-TRX-PRESAT. The hatched sequence with a linker is removed after AhdI digestion yielding linearized T-vector.

 
Preparation of DNA fragments encoding peptides

The DNA fragments encoding PACAP27G and Hrs-UIM were amplified by PCR using Taq DNA polymerase and plasmids harboring the PACAP27G and mouse Hrs gene as template. Similarly, DNA fragment encoding STAM2-UIM was amplified by PCR from QuickClone(TM) mouse liver first strand cDNA pool (Clonetech). The synthetic DNA fragments encoding VIP(11–28)G were synthesized using optimized codons for Escherichia coli, as indicated in Table I. The semi-synthetic DNA fragments for VIP-G, VIP(6–28)G and MJD1-UIM were synthesized as indicated in Table I. Each pair of forward and reverse primers (10 pmol) were mixed, annealed and subjected to enzymatic extension by T4 DNA polymerase at 37°C for 1 h. The DNA was then ethanol precipitated and incubated with Taq polymerase (5 U) and 1 mM dATP at 70°C for 1 h. For each gene we introduced double stop codons and an extra 5'ACC base at the terminus of the antisense DNA strand. In addition, an extra 5'-AGA sequence at the terminus of each sense strand was attached, corresponding to the fourth Arg residue of the Factor Xa cleavage site. Note that the PCR product amplified with Taq DNA polymerase contains a 3'-single overhanging dA base at both termini. Thus the synthetic oligonucleotides for VIP(11–28)G must contain an additional 3'-dA base on each strand. The sense and antisense oligonucleotides were denatured together at 95°C for 5 min and then annealed by slow cooling for 1 h prior to the ligation reaction.

Single-step cloning and ORF selection of peptide genes into pET-TRX-PRESAT vectors

The parent pET-TRX-PRESAT vector was digested with AhdI, agarose gel purified and ligated to individual DNA fragments. Following transformation into E.coli DH5{alpha}, plasmid DNA was purified and subjected to KpnI restriction digestion to select for ORF orientation. Approximately 0.1 µg of the plasmid was treated with KpnI (10 units, 1 h, 37°C). Finally, corresponding vectors were transformed into E.coli BL21(DE3) for subsequent expression. Five randomly selected colonies containing each respective TRX fusion vector were picked and grown in 3 ml LB (plus 50 µg/ml ampicillin) to an OD600 of 0.4 at 30°C and then induced with 1 mM isopropyl D-thiogalactopyranoside (IPTG) for 3 h. The efficiency of ORF selection and solubility of the expressed protein was assessed by disrupting the cells in a sonicator (BioRuptor, Showa Electric, Japan) and analyzing the clarified cell-free extract by SDS–PAGE (15% gel).

Labeling of TRX_VIP-G and TRX_MJD1-UIM fusion proteins

For 15N labeling of the fusion proteins TRX_VIP-G and TRX_MJD1-UIM, M9 medium containing 0.5 g/l [15N]NH4Cl as the sole nitrogen source, 0.1% (w/v) glycerol and 4 g/l of glucose was used. E.coli harboring either pET-TRX_VIP-G or pET-TRX_MJD1-UIM was grown in 100 ml of 15N-enriched M9 medium containing 50 µg/ml ampicillin for 16 h. The cells were divided in two and then each 50 ml were transferred into 0.45 l cultures of the same medium in two 1 l baffled flasks. IPTG induction was carried out as described earlier except that the cells were incubated for 6 h prior to harvesting.

Purification of TRX_VIP-G and TRX_MJD1-UIM fusion proteins

BL21(DE3) cells from 0.5 l of M9 medium that expressed TRX_VIP-G were pelleted, resuspended in 12 ml of 20 mM Tris–HCl (pH 8.0), 20% (w/v) sucrose, 2.5 mM EDTA and incubated for 20 min on ice. The cells were gently collected and osmotically disrupted by resuspending into 12 ml of lysis buffer containing 20 mM Tris–HCl (pH 8.0). This step was repeated twice and all supernatants were pooled.

For TRX_MJD1-UIM, BL21(DE3) cells from 0.5 l of M9 medium were pelleted, resuspended in 10 ml of 50 mM potassium phosphate buffer (pH 7.8), 0.4 M KCl and disrupted by sonication. Cell debris was removed by centrifugation (50 000 g for 20 min at 4°C), followed by passing the extracts through a 1 ml column of fast-flow DEAE-Sepharose (Amersham Pharmacia Biotech).

The cleared extracts either from osmotic disruption or sonication were loaded on to a 5 ml column of fast-flow chelating Sepharose, previously charged with 50 mM NiSO4 and equilibrated in 20 mM imidazole and 50 mM Tris–HCl (pH 7.6). The column was then washed with 50 mM imidazole and 50 mM Tris–HCl (pH 7.6), followed by fusion protein elution with 0.1 M (TRX_MJD1-UIM) or 0.2 M (TRX_VIP-G) of imidazole and 50 mM Tris–HCl (pH 7.6). Fusion proteins eluted from the column (2 ml) were dialyzed against 1 l of buffer containing 0.1 M NaCl, 50 mM Tris–HCl (pH 8.0) at 4°C for 16 h.

Factor Xa cleavage of VIP-G and MJD1-UIM from TRX fusion proteins and purification of peptides

The solution of TRX_VIP-G and TRX_MJD1-UIM fusion proteins at a protein concentration of 5 mg/ml were adjusted to a condition for Factor Xa cleavage reaction, containing 0.1 M NaCl, 2 mM CaCl2 and 50 mM Tris–HCl (pH 8.0), by adding an aliquot of 0.2 M CaCl2. Approximately 2.5 mg of fusion proteins were digested. Factor Xa (10 units) was added to a final molar ratio of 10 units/mg substrate. Digestion was carried out at room temperature for VIP-G and at 4°C for MJD1-UIM for 2 h. Proteolysis was terminated by adding 2.3 volumes of cold (–30°C) acetone to precipitate the protein tags, which were then removed by centrifugation. Solutions were then fully dried to remove all organic solvent. Samples were analyzed on a reversed-phase C18 HPLC column with a linear gradient of acetonitrile and a major peak was collected and verified in terms of MWs by MALDI-TOF mass spectrometry. A peak containing pure peptide were pooled and lyophilized to dryness to remove all organic solvent.

Expression and purification of other peptides

The VIP-related peptides VIP(6–28)G and VIP(11–28)G were expressed, cleaved by Factor Xa and purified according to the same protocol as for VIP-G described above. PACAP27G and the UIM-related peptides, Hrs-UIM and STAM2-UIM, were expressed, Factor Xa treated and purified according to the same protocol as for MJD1-UIM. The typical yields of the peptides studied are summarized in Table II.


View this table:
[in this window]
[in a new window]
 
Table II.. Typical yields of peptides from 1 l of M9 culture

 
NMR spectroscopy

NMR experiments were performed on a Bruker AvanceDRX 500 MHz NMR spectrometer equipped with a cryogenic triple resonance probe and Z-axis pulsed-field gradients. All recorded spectra were referenced to an external sodium 2,2-dimethyl-2-silapentane-5-sulfonate (DSS) standard. Approximately 80 µg of [15N]VIP-G was dissolved in 0.25 ml of H2O–D2O (9:1) containing 50 mM potassium phosphate buffer at pH 7.2, with and without 1% w/v dodecylphosphocholine (DPC) micelle. Approximately 70 µg of [15N]MJD1-UIM was dissolved in 0.3 ml of H2O–D2O (9:1) containing 5 mM KCl, 1 mM EDTA and 20 mM potassium phosphate buffer at pH 6.8, in the absence and presence of 2 and 4 mol equiv. of human Ub. HSQC spectra (Neri et al., 1989Go) modified with a gradient sensitivity enhancement (Kay et al., 1992Go) were acquired with eight transients and 256 increments at 298 K and zero filled during spectral processing. All two-dimensional spectra were processed with nmrPipe (Delaglio et al., 1995Go) and analyzed with the program nmrDraw (Delaglio et al., 1995Go).


    Results and discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Table I shows the primary amino acid sequence and the corresponding DNA sequence of each peptide (18–29 residues in length) cloned as a TRX fusion protein. We used peptides of various lengths and hydrophobicities to evaluate the efficiency of peptide production. The cloning site for the DNA inserts is C-terminal to the TRX followed by a Hisx6-tag and Factor Xa cleavage site (Figure 1a). The amino acid sequence of Factor Xa cleavage site were critically designed for obtaining biologically active peptides. Since Factor Xa cleaves after its four recognition residues, Ile–Asp/Glu–Gly–Arg, no extra amino acid residue is left before the N-terminus of the peptide of interest. In order to design an AhdI restriction site within the Factor Xa site, we chose Ile–Asp–Gly–Arg as a Factor Xa recognition site. The use of Factor Xa for removal of TRX from the peptides of interest might be beneficial compared with enterokinase, because some non-specific cleavage was observed in the case of our prototypic expression vector pET32aPACAP27G (data not shown). Note that PACAP27G, VIP-G, VIP(6–28)G and VIP(11–28)G contain an extra glycine residue at the C-terminus of the peptide sequence. The C-terminal glycine will be converted into the C-terminal amide group according to in vitro modification of PAM (Lauta, 2000Go; Prigge et al., 2000Go). For Hrs-UIM and MJD1-UIM, an extra tyrosine residue was attached to N- and C-terminus, respectively, in order to allow spectrophotometric quantification (see Table I).

Three different strategies for the preparation of DNA encoding the peptide of interest were demonstrated. For peptides shorter than ~25 residues, chemically synthesized oligonucleotides up to 75 bases for both forward and reverse strands were synthesized. In this study, DNA encoding VIP(11–28)G was synthesized. DNA encoding peptides between 20 and 35 residues in length were generated by an enzymatic semi-synthesis method instead of fully synthesized oligonucleotides, owing to the high cost involved. In this case, only the 5' portion of the DNA sequence of each strand was synthesized with at least 15 bases of cohesive ends. The reaction conditions for enzymatic semi-synthesis were carefully adapted to the PRESAT-vector system. The sense and antisense strands were mixed, allowed to anneal, extended by T4 DNA polymerase and finally a single dA extension was added by Taq DNA polymerase for subsequent TA cloning. The DNA fragments corresponding to VIP-G, VIP(6–28)G and MJD1-UIM were prepared by this method. Alternatively, DNA encoding peptides >30 residues in length or peptides for which the genes were already cloned were amplified by a standard PCR protocol. In this study DNA encoding PACAP27G, Hrs-UIM and STAM2-UIM were amplified by PCR.

Figure 1 shows schematic illustrations of the pET-TRX vectors used in this study with the sequence of the multiple cloning sites. Originally, an expression vector of TRX_PACAP27G fusion protein was constructed according to a conventional genetic method, yielding pET-TRX-PACAP27GC (Figure 1a), where the superscript C represents a ‘conventional’ construction method. The multiple cloning site of pET-TRX-PACAP27GC was modified with a pair of AhdI restriction sites, one within the Factor Xa cleavage site and a second downstream of the stop codon of PACAP27G. This vector was linearized with AhdI, yielding an asymmetric T-vector named pET-TRX-PRESAT, as shown in Figure 1b. PCR-amplified fragments and synthetic and semi-synthetic DNA fragments were then cloned according to the PRESAT-vector cloning methodology (Goda et al., 2004Go). When PCR-amplified DNA fragments encoding PACAP27G were cloned into pET-TRX-PRESAT, yielding pET-TRX-PACAP27GP, the coding amino acid sequence of TRX_PACAP27G fusion protein is exactly the same as that expressed by pET-TRX-PACAP27GC, where the superscript P represents a ‘PRESAT-vector’.

Figure 2 shows the concept of one-step construction of TRX-fusion vector using pET-TRX-PRESAT according to PRESAT-vector methodology (Goda et al., 2004Go). In brief, DNA fragments with a 3' single dA overhang were ligated with pET-TRX-PRESAT vector linearized by AhdI restriction enzyme. Ligated vector was transformed into E.coli for amplification and a plasmid DNA preparation was then treated with KpnI. Since one of the asymmetric TA cloning sites was designed as a partial KpnI recognition sequence, only the ligated plasmid with insert of the undesired (reverse) orientation contains a newly formed KpnI site. Consequently, the undesired product is readily eliminated for the subsequent transformation into E.coli BL21(DE3) host for high-level protein expression (Miroux et al., 1996Go).



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2.. Strategy for KpnI selection of constructs containing an ORF in the desired orientation.

 
The efficiency of the KpnI digestion strategy to select positively for the desired orientation of ORF is shown in Figure 3. Five randomly selected colonies from all seven constructs were grown in LBG (Luria broth with 1% glucose) medium at 30°C and induced with 1 mM IPTG for 3 h. A protein band of the expected molecular weight was detected in 29 out of the 35 clones (i.e. 82% positive), indicating a high efficiency of KpnI ORF selection and a very low background of PRESAT-vector (Figure 3). The efficiency of ORF selection by KpnI was as high as that of the NcoI and/or NdeI ORF selection method, which was originally developed (Goda et al., 2004Go). There was no significant difference whether the source DNA was prepared by PCR or chemical synthesis (~90%), while we found unexpected low efficiency (40–80%) in the case of the semi-synthetic DNA. All of the colonies expressing shorter and longer TRX fusion proteins than expected molecular sizes were harboring frame-shift mutations, which are assumed to be introduced occasionally during enzymatic extension using a combination of T4 and Taq polymerase. In contrast, the orientations of the inserts matched correctly, suggesting that KpnI ORF selection worked correctly. Although the accuracy of semi-synthesized DNA fragments had some limitations, it is still beneficial to design the gene encoding the peptide of interest with optimized codon for bacterial expression. We recommend checking the molecular weight of the expressed fusion protein prior to DNA sequencing, in terms of saving cost and effort for analysis of DNA. With all these considerations, pET-TRX-PRESAT vector was shown to be equally useful for shorter (~20 amino acids) and longer (25–40 amino acids) peptides, derived from either PCR-amplified, synthetic or semi-synthetic DNA fragments.



View larger version (127K):
[in this window]
[in a new window]
 
Fig. 3.. Efficiency of KpnI selection procedure for seven TRX-fusion protein constructs. Whole cell extracts of IPTG-induced cells were analyzed by SDS–PAGE (15% gel). MW markers (lane M), TRX_PACAP27G (lanes a1–a5), TRX_VIP-G (lanes b1–b5), TRX_VIP(6–28)G (lanes c1–c5), TRX_VIP(11–28)G (lanes d1–d5), TRX_Hrs-UIM (lanes e1–e5), TRX_STAM2-UIM (lanes f1–f5), TRX_MJD1-UIM (lanes g1–g5).

 
First, in order to compare the level of expression and solubility of the fusion protein TRX_PACAP27G from a recombinant strain of E.coli harboring either pET-TRX-PACAP27GC or pET-TRX-PACAP27GP, we analyzed the soluble fraction of sonicated cell lysate (Figure 4a, lanes 1–4). Both the conventional (pET-TRX-PACAP27GC) and PRESAT-vector methodology (pET-TRX-PACAP27GP) were designed to generate an identical heterologous protein product (TRX_PACAP27G). Furthermore, the plasmid sequences are almost identical except for the multiple cloning site after the stop codon of TRX_PACAP27G and an AhdI restriction site internal to the AmpR genetic marker. We also analyzed the soluble fraction of sonicated cell lysate of IPTG-uninduced and -induced cells to compare the yields of soluble fraction of the recombinant proteins (Figure 4a, lanes 5–16). The expression level and solubility of PACAP, VIP-related and UIM-related TRX fusion proteins were high and sufficient for further isotope labeling experiment as shown in Table II. Hence we have demonstrated the ability of TRX to solubilize a fused peptide.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 4.. (a) TRX-fusion proteins were analyzed by SDS–PAGE (15% gel). MW markers (lane M), TRX_PACAP27G derived from pET-TRX_PACAP27GC (lanes 1, 2), TRX_PACAP27G derived from pET-TRX_PACAP27GP (lanes 3, 4), TRX_VIP-G (lanes 5, 6), TRX_VIP(6–28)G (lanes 7, 8), TRX_VIP(11–28)G (lanes 9, 10), TRX_Hrs-UIM (lanes 11, 12), TRX_STAM2-UIM (lanes 13, 14), TRX_MJD1-UIM (lanes 15, 16). A + or – sign indicates soluble fraction of sonicated extract from IPTG-induced and non-induced cells, respectively. (b) A 15–25% gradient SDS–PAGE gel of expressed, purified and Factor Xa cleaved TRX_VIP-G. MW markers (lanes M, M'), uninduced cells (lane 1), induced cells (lane 2), disrupted lysate supernatant (lane 3), Ni2+ affinity column-purified TRX_VIP-G (lane 4), Factor Xa cleavage mixture (lane 5), cleared supernatant after acetone extraction (lane 6) and HPLC-purified VIP-G (lane 7). (c) MALDI-TOF mass spectra of purified 15N-labeled VIP-G. Theoretical monoisotopic mass numbers are 3429.6 (VIP-G), 3468.6 (VIP-G + K+) and 3507.6 (VIP-G + 2K+), respectively.

 
For determining Factor Xa cleavage conditions, we found >90% cleavage for fusion proteins TRX_PACAP27G and TRX_VIP-G, whereas TRX_MJD1-UIM gave a smaller product (~20%) with the desired product (~80%) under similar conditions (data not shown). This shorter by-product might be caused by contaminated non-specific cleavage activity of Factor Xa. To obtain the full-length peptides as major products, we carefully chose the condition of shorter reaction time than that of complete digestion.

For simplicity, we chose to show an example of the purification of TRX_VIP-G (Figure 4b). A band of the predicted size can be seen in the induced extract indicating a relatively high level of expression. Typically the yield of protein was 50 mg/l from expression in LBG. The efficiency of Factor Xa treatment and acetone extraction of VIP-G from the TRX-tag was also demonstrated by SDS–PAGE (Figure 4b, lanes 5 and 6). The TRX tag was efficiently removed from the peptide by solvent precipitation using acetone prior to reversed-phase HPLC purification. This simple procedure increases the capacity of the peptide to be loaded on to an HPLC column with acceptable resolution. Finally, MALDI-TOF mass spectrometry of the purified peptides confirmed that cleavage was taking place specifically at the targeted Factor Xa site (Figure 4c).

The efficiency of 15N labeling of VIP-G was examined by 1H–15N HSQC spectra with or without 1% (w/v) DPC micelles (Figure 5). VIP-G is predominantly unstructured in solution, as evidenced by the limited chemical shift dispersion in the spectra (7.8–8.6 p.p.m. in 1H) and the limited number of HSQC peaks (21 clearly detected peaks out of 28 expected), as shown in Figure 5a. The number of observed peaks increased with the addition of DPC micelle and 27 amide protons were detected, with drastic chemical shift changes of some peaks, in addition to large chemical shift dispersion (7.1–8.7 p.p.m. in 1H, Figure 5b). The result suggests that VIP-G adopts an {alpha}-helical conformation on binding to DPC micelle, which mimics the environment of cellular phospholipid membranes. Induction of an {alpha}-helical conformation of PACAP27 upon membrane binding as a prerequisite step for receptor binding of PACAP27 was observed by NMR and a two-step ligand transportation model to the integral seven-transmembrane receptors has been proposed (Inooka et al., 2001Go). In addition, preincubation of VIP with phospholipid may potentiate physiological activity of VIP, such as vasodilation, through induction of an {alpha}-helical conformation (Rubinstein et al., 2001Go). The importance of a membrane-associated pathway on binding of a peptide hormone to its receptor was also exemplified by cholecystokinin-8 (Giragossian et al., 2002Go). Structural studies of VIP and VIP-related vasoactive peptides using isotopically labeled peptides would be of enormous interest.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 5.. 1H–15N HSQC spectra of VIP-G (a) in solution and (b) in 1% DPC micelle.

 
The efficiency of 15N labeling of MJD1-UIM peptide obtained by this method was also demonstrated by 1H–15N HSQC spectra in the absence or presence of 2 and 4 mol equiv. of non-labeled Ub (Figure 6). Like VIP-G, MJD1-UIM alone in aqueous solution was predominantly random coil, as evidenced by the limited chemical shift dispersion in the spectra (7.7–8.6 p.p.m. in 1H) and the limited number of HSQC peaks (21 peaks out of 28 expected, Figure 6, red line). In the presence of Ub, we observed eight peaks with significant chemical shift changes, while no obvious signal broadening was found (Figure 6, cyan and black lines). The results suggest relatively weak binding of MJD1-UIM to Ub in a typical fast-exchange equilibrium manner. In common, UIM-containing proteins display a very weak affinity for monomeric Ub in the range between 3 µM and 10 mM (Fisher et al., 2003Go) and therefore only a limited amount of structural information about UIM bound to UBL (Fisher et al., 2003Go; Fujiwara et al., 2004Go; Mueller and Feigon, 2003Go) and Ub (Swanson et al., 2003Go) in complexes has been reported. Human MJD1 protein, also called ataxin-3, contains three potential UIMs at residues 223–240, 243–260 and 334–351. MJD1-UIM used in this study corresponds to the second UIM in MJD1. The MJD1 gene is known to be associated with the neurodegenerative disease spinocerebellar ataxia type 3, while MJD1 protein was found to be localized in ubiquitin-positive nuclear inclusion. Although it has been reported (Burnett and Pittman, 2003Go) that the first UIM of MJD1 strongly bound to poly-Ub chains, our results showed that the second UIM can also bind to a monomeric Ub. Hence this MJD1-UIM–Ub system is an ideal model systems to study UIM–Ub interactions in terms of molecular recognition.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 6.. 1H–15N HSQC spectra of 15N MJD1-UIM. Red, cyan and black lines indicate the absence (free) and presence of 2 and 4 mol equiv. of Ub, respectively. Lines indicate trajectories of peaks with significant chemical shift changes.

 
In conclusion, we have demonstrated the feasibility of a TRX fusion protein approach for generating labeled recombinant peptide of high purity in good yield. Labeled peptides will facilitate NMR studies and mass spectrometry-based proteomics to investigate numerous structural problems of biological significance. For example, observing induced conformational changes of 15N-labeled peptides upon binding to micelles or detection of the interface of peptides bound to a target receptor protein have been demonstrated (Figures 5 and 6, respectively). The other important application of a high-yield peptide expression system is 2H-labeling that permits TROSY-based heteronuclear NMR experiments for structure determination of large molecular complexes (Pervushin, 2000Go; Fernandez et al., 2001Go) and solid-state NMR applications (Bechinger et al., 1999Go). 2H-labeled peptides can also be used to determine the interface of a peptide bound to a large protein or micelle by the cross-saturation methodology (Takahashi et al., 2000Go). The demand for high-throughput production systems for isotopically labeled peptides is increasing as peptide interactions with either membrane-incorporated GPCRs or large cytosolic molecular machinery are being recognized as biologically important. A well-characterized, efficient system for cloning, expressing and purifying recombinant peptides is now a major beneficial goal of modern drug discovery in the post-genomic era.


    Acknowledgments
 
We gratefully acknowledge Dr T.Tanaka for helpful discussions. M.M. was supported by a grant from Y-CREATE (Collaboration of Regional Entities for the Advancement of Technological Excellence in Yokohama).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results and discussion
 References
 
Bechinger,B., Kinder,R., Helmle,M., Vogt,T.C., Harzer,U. and Schinzel,S. (1999) Biopolymers, 51, 174–190.[CrossRef][Web of Science][Medline]

Behr,T.M., Gotthardt,M., Barth,A. and Behe,M. (2001) Q. J. Nucl. Med., 45, 189–200.[Web of Science][Medline]

Bodnar,R.J. and Hadjimarkou,M.M. (2002) Peptides, 23, 2307–2365.[CrossRef][Web of Science][Medline]

Buchberger,A. (2002) Trends Cell Biol., 12, 216–221.[CrossRef][Web of Science][Medline]

Burnett,B. Li,F. and Pittman,R.N. (2003) Hum. Mol. Genet., 12, 3195–3205.[Abstract/Free Full Text]

Celis,E. (2002) J. Clin. Invest., 110, 1765–1768.[CrossRef][Web of Science][Medline]

Delaglio,F., Grzesiek,S., Vuister,G.W., Zhu,G., Pfeifer,J. and Bax,A. (1995) J. Biomol. NMR, 6, 277–293.[Web of Science][Medline]

Di Fiore,P.P., Polo,S. and Hofmann,K. (2003) Nat. Rev. Mol. Cell. Biol., 4, 491–497.[CrossRef][Web of Science][Medline]

Fernandez,C., Hilty,C., Bonjour,S., Adeishvili,K., Pervushin,K. and Wuthrich,K. (2001) FEBS Lett., 504, 173–178.[CrossRef][Web of Science][Medline]

Fishbein,V.A., Coy,D.H., Hocart,S.J., Jiang,N.Y., Mrozinski,J.E.,Jr, Mantey,S.A. and Jensen,R.T. (1994) Peptides, 15, 95–100.[CrossRef][Web of Science][Medline]

Fisher,R.D., Wang,B., Alam,S.L., Higginson,D.S., Robinson,H., Sundquist,W.I. and Hill,C.P. (2003) J. Biol. Chem., 278, 28976–28984.[Abstract/Free Full Text]

Fujiwara,K., Tenno,T., Sugasawa,K., Jee,J.G., Ohki,I., Kojima,C., Tochio,H., Hiroaki,H., Hanaoka,F., Shirakawa,M. (2004) J. Biol. Chem., 279, 4760–4767.[Abstract/Free Full Text]

Giragossian,C., Pellegrini,M., Mierke,D.F., (2002) Can. J. Physiol. Pharm., 80, 383–387.[CrossRef][Web of Science][Medline]

Goda,K., Tenno,T., Takasu,H., Hiroaki,H., Shirakawa,M. (2004) Protein Sci., 13, 652–658.[CrossRef][Web of Science][Medline]

Gozes,I. and Furman,S. (2003) Curr. Pharm Des., 9, 483–494.[CrossRef][Web of Science][Medline]

Haghjoo,K., Cash,P.W., Farid,R.S., Komisaruk,B.R., Jordan,F. and Pochapsky,S.S. (1996) Pept. Res., 9, 327–331.[Web of Science][Medline]

Hofmann,K. and Falquet,L. (2001) Trends Biochem. Sci., 26, 347–350.[CrossRef][Web of Science][Medline]

Ichinose,M., Sawada,M. and Maeno,T. (1994) Regul. Pept., 54, 457–466.[CrossRef][Web of Science][Medline]

Inooka,H., Ohtaki,T., Kitahara,O., Ikegami,T., Endo,S., Kitada,C., Ogi,K., Onda,H., Fujino,M. and Shirakawa,M. (2001) Nat. Struct. Biol., 8, 161–165.[CrossRef][Web of Science][Medline]

Jacobsen,J.S. (2002) Curr. Top. Med. Chem., 2, 343–352.[CrossRef][Medline]

Jones,D.H., Ball,E.H., Sharpe,S., Barber,K.R. and Grant,C.W. (2000) Biochemistry, 39, 1870–1878.[CrossRef][Medline]

Kami,K., Takeya,R., Sumimoto,H. and Kohda,D. (2002) EMBO J., 21, 4268–4276.[CrossRef][Web of Science][Medline]

Kay,L.E., Keifer,P. and Saarinen,T. (1992) J. Am. Chem. Soc., 114, 10663–10665.[CrossRef][Web of Science]

Laburthe,M. and Couvineau,A. (2002) Regul. Pept., 108, 165–173.[CrossRef][Web of Science][Medline]

Laburthe,M., Couvineau,A. and Marie,J.C. (2002) Receptors Channels, 8, 137–153.[CrossRef][Web of Science][Medline]

Lauta,V.M. (2000) Fundam. Clin. Pharmacol., 14, 425–442.[Web of Science][Medline]

LaVallie,E.R., DiBlasio,E.A., Kovacic,S., Grant,K.L., Schendel,P.F. and McCoy,J.M. (1993) Biotechnology (NY), 11, 187–193.[CrossRef][Web of Science]

Lindhout,D.A., Thiessen,A., Schieve D. and Sykes,B.D. (2003) Protein Sci., 12, 1786–1791.[CrossRef][Web of Science][Medline]

Majerle,A., Kidric,J. and Jerala,R. (2000) J. Biomol NMR., 18, 145–151.[CrossRef][Web of Science][Medline]

Miroux,B. and Walker,J.E. (1996) J. Mol. Biol., 260, 289–298.[CrossRef][Web of Science][Medline]

Mueller,T.D. and Feigon,J. (2003) EMBO J., 22, 4634–4645.[CrossRef][Web of Science][Medline]

Nathisuwan,S. and Talbert,R.L. (2002) Pharmacotherapy, 22, 27–42.[CrossRef][Web of Science][Medline]

Neri,D., Szyperski,T., Otting,G., Senn,H. and Wuthrich,K. (1989) Biochemistry, 28, 7510–7516.[CrossRef][Medline]

Pachter,J.A., Marshak,D.W., Lam,D.M. and Fry,K.R. (1989) Neuroscience, 31, 507–519.[CrossRef][Web of Science][Medline]

Pervushin,K. (2000) Q. Rev. Biophys., 33, 161–197.[CrossRef][Web of Science][Medline]

Prigge,S.T., Mains,R.E., Eipper,B.A. and Amzel,L.M. (2000) Cell. Mol. Life Sci., 57, 1236–1259.[CrossRef][Web of Science][Medline]

Rubinstein,I., Dagar,S., Sethi,V., Krishnadas,A. and Onyuksel,H. (2001) Peptides, 22, 671–675.[CrossRef][Web of Science][Medline]

Sharon,M., Gorlach,M., Levy,R., Hayek,Y. and Anglister,J. (2002) Protein Expr. Purif., 24, 374–383.[CrossRef][Web of Science][Medline]

Sherwood,N.M., Krueckl,S.L. and McRory,J.E. (2000) Endocr. Rev., 21, 619–670.[Abstract/Free Full Text]

Smith,D.B. and Johnson,K.S. (1988) Gene, 67, 31–40.[CrossRef][Web of Science][Medline]

Studier,F.W. and Moffatt,B.A. (1986) J. Mol. Biol., 189, 113–130.[CrossRef][Web of Science][Medline]

Swanson,K.A., Kang,R.S., Stamennova,S.D., Hick,L. and Radhakrishnan,I. (2003) EMBO J., 4597–4606.

Takahashi,H., Nakanishi,T., Kami,K., Arata,Y. and Shimada,I. (2000) Nat. Struct. Biol., 7, 220–223.[CrossRef][Web of Science][Medline]

Uegaki,K., Nemoto,N., Shimizu,M., Wada,T., Kyogoku,Y. and Kobayashi,Y. (1996) FEBS Lett., 379, 47–50.[CrossRef][Web of Science][Medline]

Vaudry,D., Gonzalez,B.J., Basille,M., Yon,L., Fournier,A. and Vaudry,H. (2000) Pharmacol. Rev., 52, 269–324.[Abstract/Free Full Text]

Received December 17, 2003; revised March 31, 2004; accepted May 6, 2004.

Edited by Roger Williams


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary data
Right arrow All Versions of this Article:
17/4/305    most recent
gzh044v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tenno, T.
Right arrow Articles by Hiroaki, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tenno, T.
Right arrow Articles by Hiroaki, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?