PEDS Advance Access originally published online on August 27, 2004
Protein Engineering Design and Selection 2004 17(7):581-587; doi:10.1093/protein/gzh071
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression of the C-terminus of HIV-1 reverse transcriptase p66 and p51 subunits as a single polypeptide with RNase H activity
1Programa de Virología, Instituto de Ciencias Biomédicas, Facultad de Medicina, Universidad de Chile, Independencia 1027, Santiago, Chile and 2Department of Biochemistry, University of Medicine and Dentistry of New JerseyRobert Wood Johnson Medical School, 675 Hoes Lane, Piscataway, NJ 08854, USA
3 To whom correspondence should be addressed. E-mail: roth{at}waksman.rutgers.edu
| Abstract |
|---|
|
|
|---|
The C-terminus of the HIV-1 reverse transcriptase heterodimer was reconstructed into a single polypeptide. The construct encodes the p51 thumb (T) and connection (C) subdomains joined through a linker region to the p66 connection (C) and RNase H (R) domain. The TCCR protein was purified from insoluble fractions of Escherichia coli lysates. The TCCR construct maintains Mn2+-dependent RNase H activity and specifically cleaves the substrate mimicking the tRNA removal required for second-strand transfer reactions.
Keywords: C-terminus/HIV-1 reverse transcriptase/p66 and p51 subunits/RNase H activity/single polypeptide
| Introduction |
|---|
|
|
|---|
The appearance and spread of drug-resistant human immunodeficiency virus (HIV) isolates in the population reinforces the need of new drugs and targets for drug development for treatment of AIDS (Check, 2003
The HIV RT is a multifunctional enzyme possessing three enzymatic activities: (1) RNA-dependent DNA polymerase, (2) DNA-dependent DNA polymerase and (3) RNase H activity. The RNase H activity has been further divided into two modes: polymerase dependent and polymerase independent. Based on the positioning of the 3'OH in the polymerase active site, the polymerase-dependent RNase H cleavages are defined as those that are coupled
18 nucleotides from the point of polymerization (Wohrl et al., 1993
, 1995a
,b
). During viral replication, specific RNase H cleavages are required for the generation and removal of the plus-strand primer and the removal of the minus-strand tRNALys,3 primer (Omer and Faras, 1982
; Champoux et al., 1984
; Resnick et al., 1984
). These cleavages ultimately define the termini of the viral DNA and require stringent control.
The HIV-1 RT is an asymmetric heterodimer consisting of 66 and 51 kDa subunits (p66 and p51, respectively). The structure of RT (Arnold et al., 1992
; Kohlstaedt et al., 1992
) has been related to the shape of a right hand, with subdomains named fingers, palm, thumb, connection and RNase H. The RNase H domain is unique to the C-terminus of p66 and not found within the primary sequence of p51. Previous analysis of the expression of isolated subdomains indicated that constructs encoding the RNase H domain were sufficient to catalyze Mn2+-dependent specific removal of the tRNA primer using oligonucleotide substrates that mimic the replicative intermediate (Smith and Roth, 1993
; Smith et al., 1994
, 1998
). Reconstitution of Mg2+-dependent cleavage required the presence of either the full-length p51 subunit or the addition in trans of fingerpalm plus thumbconnections domains to either the connectionRNase H (Ser322) or the thumbconnectionRNase H (Gln222) constructs (Smith et al., 1994
). These results indicated that magnesium ion-dependent activity could be restored to the RNase H domain through stabilizing interactions between the p66 and/or p51 domains.
In this work, a novel HIV-1 RNase H construct was generated which reconstitutes the C-terminus of both p51 and p66 into a single polypeptide. The construct consists of the thumb and connection domain of p51 connected through a linker region to the connection and RNase H domain of p66 (named TCCR). This construct provides the contacts of the p51 thumb with RNase H and also the dimerization and substrate binding contacts within connections. The TCCR construct can facilitate studies of polymerase-independent RNase H cleavages and also screening for RNase H inhibitors.
| Materials and methods |
|---|
|
|
|---|
Reagents
Superdex 75, HR 10/30 was purchased from Pharmacia. Guanidine.HCl, Igepal and sodium deoxycholate were obtained from Sigma, DTT and urea from Bio-Rad, imidazole from Merck, HEPES from Calbiochem and Ni2+-nitrilotriacetic acid agarose (Ni2+-NTA) from Qiagen. HIV-1 RT was obtained from Jeffrey Culp and Christine Debouch, Department of Protein Biochemistry, SmithKlineBeecham Pharmaceuticals.
Molecular modeling
Molecular modeling of the TCCR was performed using SYBYL, version 6.5 (MIPS3-IRIX6.2) based on the reverse transcriptase structure IRTJ. Loop regions were designed based on the protein loop search program within SYBYL.
Construction of His6-TCCR
The TCCR construct was generated from HIV-1 HXB2 sequences. The construct was assembled using two previously generated HIV-RT subdomain constructs TC and Ser322 (Smith et al., 1994
). DNA sequences encoding thumb and connection from amino acids P247 to K431 were PCR amplified using pTC as template and primers 9591 (5' GCATATGCCAGAAAAAGACAGCTGGACTG 3') and 9594 (5'CCTCCTTTCCTAACTGGTACCATAATTTTC 3'). PCR was performed using Pfu polymerase (Stratagene). The resulting 573 bp product was subcloned into the SmaI site of pTZ18 U after destruction of the BamHI site (pTC-TZ18 UBamH). DNA sequences encoding the connection and RNase H domain from L325 to G543 were PCR amplified with pSer322 as a template using primers 9593 (5' CCAGATCTCATAGCAGAAATACAGAAGCAG 3') and 9592 (5' CCGGATCCTATCCAATTCCTTTGTGTGCTG 3'). The resulting 673 bp product was subcloned into the SmaI site of pTZ18UBamHI and named pCRTZ18UBamHI. Novel restriction sites introduced into the PCR products are underlined within the primers. The linker reqion, consisting of two flexible loops bracketing sequences I293D328 of the HIV-1 RT thumb domain, was introduced through the use of two complementary oligonucleotides. 49-mer oligonucleotide 9596 (5'GATCCGGGGGAGGGTCAATCCCACTCACAGAAGCAGAGCCTGGAGCT 3') when hybridized to 41-mer oligonucleotide 9595 (5' CCAGCTCTGCTTCTTCTGTGAGTGGGATTGACCCTCCCCCG 3') resulted in terminal overhangs encoding BamHI and SacI restriction sites. pTC-TZ18UBamHI was digested with BamHI and SacI and ligated with primers 9596/9595 (pTC+linkerA). The second half of the linker region was generated by hybridization of the 73-mer oligonucleotide 9597 (5' CGCAGAAAACCGCGAGATTCTGAAAGAACCAGTACATGGAGTGTATTATGACGGAGGGGGATCGTATGACCCA 3') with the complementary 81-mer oligonucleotide 9598 (5' GATCTGGGTCATACGATCCCCCTCCGTCATAATACACTCCATGTACTGGTTCTTTCAGAATCTCGCGGTTTTCTGCGAGCT 3'). The combination of oligonucleotides 9597 and 9598 was ligated into BglIISacI-digested pCR-TZ18UBamHI vector (plinkerB+CR). The full-length TCCR was generated through a three-fragment ligation involving the NdeISacI RT coding region of pTC+linkerA, the SacINsiI RT coding region of plinkerB+CR and the NdeINsiI vector backbone of pETRHN2-T (Smith and Roth, 1993
) containing the His6 tag and thrombin cleavage site at its amino terminus and the RNase H domain through L560 at its carboxy terminus. The resulting plasmid expressed the His6thrombinTClinkerCR domains of RT (pTCCR). The sequence of the TCCR construct was confirmed by DNA sequencing.
Western blot analysis of HIV-1 RNase H TCCR protein expression
Induction of the protein expression was effected as described previously (Smith and Roth, 1993
). Basically, Escherichia coli BL21 (DE3) containing the plasmid pTCCR was grown in LB carbenicillin (100 µg/ml) at 37°C to an OD600 nm of 0.60.8 and induced with the addition of isopropyl-ß-D-thiogalactopyranoside (IPTG) to 1 mM. Cultures were grown for an additional 2 h, pelleted in 1 ml aliquots and lysed with 150 µl of cracking buffer (10 mM sodium phosphate pH 7.2, 1% SDS, 1% ß-mercaptoethanol, 6 M urea). Samples were boiled for 35 min and 15 µl aliquots were analyzed using 10% SDSPAGE gel. Gels were either stained with 0.25% Coomassie Brilliant Blue R-250 or transferred to nitrocellulose membranes at 300 mA for 1 h for western blot analysis. Western blots were probed with anti-His antibodies (Sigma) or with RT-specific monoclonal antibody M15 (Restle et al., 1992
).
TCCR purification
A 100 ml volume of LB containing 50 µg/ml carbenicillin was inoculated with E.coli BL21/DE3 containing the pTCCR from glycerol cultures and grown overnight. Cells were recovered by centrifugation at 5000 r.p.m. for 20 min, resuspended in 20 ml and used to inoculate 1 l of LB-ampicillin (200 µg/ml). Growth was carried out at 30°C up to an OD600 nm of 0.8, then IPTG to a final concentration of 0.4 mM was added and incubated at 30°C for 1 h. The cell pellet was kept at 80°C.
Rapid renaturation of the insoluble proteins prior to affinity purification
The cell pellet was resuspended in 50 ml of solubilization buffer (50 mM sodium phosphate pH 8.0, 10 mM CHAPS, 10 mM imidazole, 300 mM NaCl) containing 60 mg of lysozyme and a tablet of protease inhibitors [complete EDTA-free protease inhibitor cocktail (Roche)]. The resuspended cells were left for 20 min on ice and then sonicated by six pulses of 15 s (Branson 450 sonicator, at maximum intensity). The lysate was centrifuged at 7000 r.p.m. (Sorvall SS-34 rotor) for 10 min. The pellet was resuspended in 50 ml of 20 mM HEPES (pH 7.8), 0.1% (v/v) Igepal, 1 M NaCl, 5% glycerol and 20 mM ß-mercaptoethanol and kept at 20°C.
Rapid renaturation of the TCCR construct was performed as described by Maldonado et al. (1996)
. The resuspended fraction was defrosted on ice and centrifuged at 7000 r.p.m. The pellet was washed twice with 10 ml of 20 mM HEPES (pH 7.8), 0.1% (v/v) Igepal, 0.05% (v/v) sodium deoxycholate, 10% (v/v) glycerol, 0.5 mM EDTA and 20 mM ß-mercaptoethanol and recovered by centrifugation. Finally, the pellet was washed and resuspended with 10 ml of the same buffer lacking sodium deoxycholate (inclusion bodies). Based on Coomassie Brilliant Blue staining of the SDSPAGE gel, the concentration of the TCCR was estimated to be 12.4 mg/ml, using a Thermo Spectronic Biomate 3 spectrophotometer. Second-order linear regression (polynomial) was performed on the protein standard curve.
A 0.8 ml volume of the inclusion bodies (
10 mg of TCCR) was centrifuged at 17 300 g for 5 min. The pellet was solubilized in 10 ml of 20 mM HEPES (pH 7.8), 6 M guanidine. HCl, 10% (v/v) glycerol, 0.5 mM EDTA and 20 mM ß-mercaptoethanol and left in ice overnight. A 40 ml volume of 20 mM HEPES (pH 7.8), 10% (v/v) glycerol, 0.5 mM EDTA and 20 mM ß-mercaptoethanol was added and left for 7 h in ice. The solution was then dialyzed against 10 volumes of 20 mM HEPES (pH 7.8), 0.2 M NaCl, 10% (v/v) glycerol, 0.5 mM EDTA and 20 mM ß-mercaptoethanol, followed by dialysis with the same buffer in the absence of ß-mercaptoethanol and EDTA. The dialyzate was diluted with 1 volume of 20 mM HEPES (pH 7.8), 0.2 M NaCl, 50 mM imidazole, 0.2% Igepal and passed twice through an Ni-NTA-agarose column equilibrated with 20 mM HEPES (pH 7.8), 0.2 M NaCl, 25 mM imidazole, 5% glycerol, 0.1% Igepal. The column was washed with 5 ml of the above solution containing 10 mM M ß-mercaptoethanol and kept at 4°C overnight. The protein was finally eluted with 300 mM imidazole in the same buffer used in the previous step. Fractions of 0.5 ml were collected. The yield of protein was 1.4 mg or 14% of input TCCR.
Affinity purification under denaturing conditions was followed by slow renaturation. Alternatively, TCCR was purified using slow renaturation as described previously (Smith et al., 1994
). Briefly, induced bacterial cultures (1.5 l) were pelleted and solublized in 40 ml of 6 M guanidine buffer (40 mM TrisHCl pH 7.5, 0.1 mM EDTA, 20 mM ß-mercaptoethanol, 1 M NaCl and 6 M guanidine.HCl). The pH was adjusted to 8.0, followed by dounce homogenization and shaking for 2 h at room temperature. The slurry was centrifuged at 16 000 r.p.m. (SS-34 rotor) for 30 min and the supernatant was loaded on to a 1 ml NTA-Ni2+ resin pre-equilibrated with 6 M guanidine buffer pH 8.0. After 1 h, the resin was washed with 40 ml of 6 M guanidine buffer pH 8.0, then 20 ml each of 6 M guanidine buffer pH 6.3 and 5.9. Finally, the protein was eluted with 60 ml of 6 M guanidine buffer pH 4.5. Fractions containing the TCCR construct or equivalent pET11C controls were adjusted to pH 8.0 and loaded on to a 1 ml NTA-Ni2+ column pre-equilibrated in 6 M guanidine buffer pH 8.0. The column was washed sequentially with 10 column volumes each of 6 M guanidine buffer pH 8.0, 4 M urea buffer pH 8.0 (TrisHCl pH 7.5, 100 mM NaH2PO4, 10% glycerol, 100 mM NaCl, 0.1% NP40, 20 mM ß-mercaptoethanol and 4 M urea), 4 M urea buffer pH 6.3 and 5.9. The His-tagged protein was eluted in 4 M urea buffer pH 4.5 (1 ml fractions). Fractions containing the peak protein were pooled and dialyzed in a stepwise manner in 1 l of 3 M urea HEDG buffer (20 mM HEPES pH 7.4, 3 M urea, 400 mM monopotassium glutamate, 0.1% NP40, 1.5 mM DTT, 20% glycerol) followed by 2, 1, 0.5 and 0 M urea HEDG buffer over 6 days at 4°C. Final dialysis was in HEDG buffer containing 50% glycerol. Before storage at 80°C, the renatured protein sample was centrifuged at 4°C to remove any insoluble precipitate. The soluble supernatant preparation was used in the RNase H assays.
Gel filtration on Superdex 75
TCCR fractions (350 ml) that were renatured and eluted from the NTA resin in 300 mM imidazole were further size fractionated on a Superdex 75 equilibrated with HEPES 20 mM (pH 7.8), 0.1% Igepal, 0.2 M NaCl, 5% glycerol and 20 mM ß-mercaptoethanol. Fractions of 0.5 ml were collected. Glycerol was added to 50% and stored at 80°C.
RNase H assay
The substrate for the tRNA removal assay consists of a 17-mer RNADNA oligonucleotide (5' GTTCGGGCGCCACTGCT 3') hybridized to the complementary DNA oligonucleotide (5' CTAGCAGTGGCGCCCGAAGAGGGAC 3', 5331), where the RNA sequences are indicated in bold. Radioactive labeling and preparation of the substrate were as described previously (Smith et al., 1998
). Reaction mixtures (20 µl) contained 50 mM TrisHCl pH 7.5, 50 mM KCl, 2 mM DTT and 8 mM MnCl2, in the presence of
1 pmol of substrate and 1 pmol of enzyme. When indicated, 8 mM MgCl2 was substituted for MnCl2. Reactions were incubated at 37°C and stopped by the addition of formamide stop buffer. Reaction products were separated on 20% denaturing polyacrylamide gels. Protein concentration was determined by using a Bio-Rad Protein Assay kit with bovine serum albumin as standard.
| Results |
|---|
|
|
|---|
Design of the TCCR construct
Figure 1A shows a schematic of the HIV-1 reverse transcriptase. The protein consists of an asymmetric heterodimer of p66 and p51 subunits. The individual subdomains identified are named finger (F), palm (P), connection (C) and RNase H (R). The RNase H domain is restricted to the p66 subunit. The three-dimensional structure of the RT heterodimer, as determined by X-ray crystallography (1RTJ), is depicted in Figure 1B. The orientation of the thumb and connection domains is distinct in p66 versus p51. The p66 thumb domain functions in binding the substrate (Patel et al., 1995
), whereas the p51 thumb is in close contact with the p66 RNase H domain.
|
Molecular modeling was used to design a construct that would regenerate the C-terminus of the heterodimer. The N-terminus of p51 thumb at position P247 was selected for appending the hexahistidine tag followed by a thrombin cleavage site. The tag was predicted to be accessible for binding to nickel-affinity resins under native conditions. The primary sequence of p51 extended from P247 through K431 within the connection domain (Figure 1A). Within the p66 structure, L325 was selected as an initiation point within connection and continued through the C-terminus of RNase H (Figure 1A). The design of the linker involved three steps. The first required the identification of a sequence that would span the distance between the C-terminus of the p51 connection to the N-terminus of the p66 connection domain. Consideration was placed on sequences that were known to fold within alternative three-dimensional structures. In fact, the RT thumb domain from position I293 to D320 had these characteristics and would span the 50 Å, necessary to join the two subunits. Additional steps in the design involved selecting the loop regions to join the thumb linker to the connection domains. For the first loop, a simply GlySer heptamer (GGSGGGS) was inserted. For the second loop, a bend of 102° was desired in order to localize the thumb region over potential hydrophobic residues exposed by the removal of the fingerspalm domains. Using protein loop search analysis (Sybyl), the sequence GGGSYDPD was selected to provide the more restricted conformation. Figure 1C summarizes the predicted structure of the TCCR construct, including the loop/linker regions.
Molecular cloning of these components involved PCR amplification of the TC and CR regions and subsequent introduction of the linker region through the use of two pairs of complementary oligonucleotides. The construct was assembled within a pET vector previously expressing the isolated RNase H domain pETRHN2-T (Smith and Roth, 1993
), providing the His6 tag and the restriction sites to unidirectionally exchange the fragments for protein expression.
The TCCR construct expresses a stable RNase H protein. The predicted molecular mass of the TCCR construct is 55.6 kDa. Analysis of four independent clones containing the pTCCR plasmid after induction with IPTG revealed the presence of a single protein species comigrating with the 55 kDa molecular mass marker (Figure 2A, lanes 25). This protein product was not present in the control induction of the pET11C vector (Figure 2A, lane 1). The 55 kDa protein was verified to be the full-length TCCR product by western blot analysis using anti-His monoclonal antibody (Figure 2B) and a monoclonal antibody to the C-terminus of RT (Figure 2C). Using either the antibody reactive to the N-terminus His tag or to the RNase H domain of RT, the predominant product detected was the 55 kDa protein predicted to be TCCR. This protein was not present in the control pET11C lanes (lanes 1, panels B and C).
|
Activity of TCCR versus pET11C control
Initial purification of TCCR was performed under denaturing conditions followed by slow renaturation, as has been described for the previously isolated HIV-1 RNase H domains (Smith et al., 1994
). Proteins were extracted from the insoluble pellet with 6 M guanidine.HCl and purified through two nickel-affinity NTA columns in the presence of 6 M guanidine.HCl. The protein was eluted from the first NTA column at pH 4.5 in the presence of 6 M guanidine.HCl; elution from the second NTA column was at pH 4.5, in the presence of 4 M urea. Individual fractions from the pH 4.5 step were dialyzed in a stepwise manner to eliminate the urea and assayed for RNase H activity in the presence of Mn2+. Figure 3 shows the comparative purification of the control pET11C versus the TCCR construct. For the control pET11C, the main proteins were smaller than the carbonic anhydrase (31 kDa) protein marker and eluted in the first and second fractions. In parallel columns, the TCCR protein eluted in the second fraction and continued to trail off throughout the pH 4.5 step (Figure 3A, lanes 37). A low level of smaller protein species migrating with the carbonic anhydrase marker (35 kDa) were visible and correlated with the elution of the TCCR product. These products reacted with anti-His antibodies by western blot analysis (data not shown) and therefore probably represent C-terminal breakdown products. After renaturation, the proteins were assayed for specific cleavage of a tRNA/DNA mimic. Cleavage on this substrate has been extensively characterized and occurs between the C and A encoded at the 3' end of the RNA (Smith et al., 1990
; Smith and Roth, 1992
). The 17-mer substrate, 32P labeled on the 5' terminus of the RNA, is outlined in Figure 3B. The major RNase H activity detected from the TCCR column was in fraction 2, where the majority of the input substrate was cleaved in this assay. Secondary cleavages releasing smaller RNA products were observed. Additional RNase H activity was detected in fractions 37. The level of RNase H activity observed in the TCCR column was distinct from the background cleavage observed in the pET11C column. For comparison, cleavage of the substrate by the HIV-1 RT is included. Within this assay, the substrate has been extensively cleaved and the initial cleavage product is no longer observed at the 30 min time point (Figure 3B, lane 9). These results indicate that TCCR construct contains Mn2+-dependent RNase H activity that specifically recognizes and cleaves the substrate for tRNA removal.
|
A second purification procedure for the TCCR was also used. In this protocol the protein was extracted from the inclusion bodies in 6 M guanidine.HCl, followed by rapid dilution renaturation and elution from NTA resin using imidazole. Figure 4 shows the activity of two different preparations. In both cases the substrate was cleaved in Mn2+ (lanes 610 and 1620) but not in Mg2+. Removal of the His tag with thrombin did not result in loss of activity (data not shown).
|
The TCCR protein eluted in buffer containing 300 mM imidazole was injected on to a Superdex 75 column. Figure 5 shows the activity and elution profile of TCCR on the Superdex 75 column. The 55 kDa TCCR product was the predominant species purified from the NTA resin run under non-denaturing conditions (Figure 5B, lane 1). In addition, four minor and one major (
18 kDa) protein products were observed. Fractionation on the Superdex 75 separated the full-length TCCR protein from these smaller species. The TCCR protein was predominantly detected in fractions 1517 with continued detection through fraction 20. Corresponding with the TCCR protein, an RNase H activity appears in fraction 15, with the peak activity in fraction 16. This activity continues through fraction 20. A second peak of RNase H activity appears in fractions 25 and 26, corresponding to the second peak of the 18 kDa protein species. In the presence of Mg2+, no RNase H activity was observed across the Superdex columns. These results indicate that the TCCR fractions are not contaminated with E.coli RNase H. The full-length TCCR protein corresponded to the Mn2+-dependent RNase H, which specifically cleaves the tRNA/DNA substrate. Figure 5C analyzes the fractionation of Superdex 75 with respect to the marker standards. Using fraction 16 as the peak, the calculated Mr of TCCR corresponded to 55 000. The TCCR construct, therefore, behaved as a monomer by size fractionation.
|
| Discussion |
|---|
|
|
|---|
This paper describes the design, purification and characterization of a novel HIV-1 RNase H domain which reconstructs the C-terminus of both the p51 and p66 subunits within a single polypeptide chain. The resulting protein encodes the p51 connection and thumb domain covalently joined in primary sequence with the p66 connection RNase H domain. The resulting construct was analyzed for its solubility, metal-dependent activity and specificity of RNase H cleavages.
Previous isolated RNase H constructs varied in their solubility based on the presence of the connection domain (Smith and Roth, 1993
; Smith et al., 1994
). The HIV-1 RNase H construct that initiated at position 427 was efficiently purified from the soluble fraction (Smith and Roth, 1993
), whereas constructs which initiated at position 400 or contained larger segments of the connection domain were predominantly insoluble in E.coli (Smith and Roth, 1993
; Smith et al., 1994
). The dimerization face between the connection domain involves hydrophobic interactions (Wang et al., 1994
). In the design of TCCR, it was believed that including the two connection domains might eliminate the exposed hydrophobic domains and allow for the increased solubility of TCCR. Although the TCCR could be purified from the soluble fraction, the majority of the protein remained within the inclusion bodies. Whereas the previous RNase H constructs were solubilized in 4 M urea, extraction and purification of the TCCR construct required extraction with 6 M guanidine.HCl. This was similar to the purification requirements for the thumbconnection subdomain construct (Smith et al., 1994
). The design of the linker region did include a loop region aimed at positioning the linker region over potential hydrophobic amino acids exposed on the surface of the molecular model of the connection. It is possible that site-specific mutagenesis of these residues might be required to improve the solubility of the TCCR construct. Studies of the HIV-1 (Jenkins et al., 1996
), RSV (Hyde et al., 1999
), SIV IN (Li et al., 1999
) and MuLV RT (Das and Georgiadis, 2001
) have been greatly advanced through the mutational analysis of hydrophobic residues for improved solubility. For each, one point mutation improved the solubility and greatly facilitated the crystallographic studies.
Previously, specific domain combinations were capable of reconstituting Mg2+-dependent RNase H activity. These include a connectionRNase H domain (S322) plus thumbconnection and fingerpalm or a thumbconnectionRNase H (Q222) construct plus thumbconnection and fingerpalm. Alternatively Ser322 or Q222 plus p51 resulted in Mg2+-dependent RNase H activity. Within TCCR, the interaction of the p51 thumb would stabilize the C-terminal loop of RNase H, including the conserved His539 residue. However, this stabilization is not sufficient to provide the conformations necessary for Mg2+-dependent RNase H activity. Analysis of the crystal structure of RT with either double-stranded DNA or an RNADNA hybrid encoding the RNase H-resistant polypurine tract (PPT) indicated that the substrates bear a 40° bend around the p66 thumb domain (Jacobo-Molina et al., 1991
; Sarafianos et al., 2001
). Short tRNADNA mimics (12-mer of RNA plus 5-mer of DNA) were positioned within the RNase H domain and maintained the contacts of the p66 thumb by molecular modeling (Snyder and Roth, 2000
). It is possible that the presence of the p66 thumb may assist in the reconstitution of Mg2+-dependent RNase H activity. The ability to reconstruct the p66 thumb domain within TCCR is being examined.
The TCCR construct did maintain the Mn2+-dependent RNase H activity. Several factors contributing to the activity of the isolated HIV-1 RNase H domain have been proposed including substrate binding (Davies et al., 1991
), a role of the His-tag (Smith and Roth, 1993
; Smith et al., 1994
), the presence of disorder loops (Davies et al., 1991
; Chattopadhyay et al., 1993
), extensive mobility and flexibility of the domain (Powers et al., 1992
) and metal-induced conformations (Pari et al., 2003
; Mueller et al., 2004
). Crosslinking studies have indicated that the Mn2+ plays both a structural and a catalytic role within RNase H. Using a substrate in which a crosslinking agent was placed in the DNA opposite the scissile bond, crosslinking was dependent on the presence Mn2+ and corresponded to the activity profile (Guaitiao et al., 2004
). NMR analysis of the isolated domain indicated that divalent metals stabilize the structure of the isolated RNase H domain (Pari et al., 2003
). Previous studies have indicated that the RNase H constructs including Pro387 or which included the p66 connection domain contained RNase H activity independent of the His tag (Smith et al., 1994
). With the TCCR construct, the histidine tag is attached to the N-terminus of the p51thumb domain and would be spatially distinct from the RNase H active site or substrate-binding cleft.
The potential to develop novel drugs directed at the RNase H domain of RT is high. The need for new drugs with alternative targets is great, with the current spread of drug-resistant viruses within primary infections. The RNase H activity of RT has become the target of high-throughput screening for HIV inhibitors (Parniak et al., 2003
). Reagents that reconstitute the RNase H domain independent of the polymerase domain would assist in the identification of new drugs and defining their specificity.
| Acknowledgments |
|---|
This work was supported by grant RO1 CA90174 award to M.J.R. We thank Dr Prem N.Yadav and Dr Marie Cote (UMDNJ) for assistance with the molecular modeling.
| References |
|---|
|
|
|---|
Arnold,E. et al. (1992) Nature, 357, 8589.[CrossRef][Medline]
Champoux,J.J., Gilboa,E. and Baltimore,D. (1984) J. Virol., 49, 686691.
Chattopadhyay,D. et al. (1993) Acta Crystallogr. D, 49, 423427.[CrossRef][Medline]
Check,E. (2003) Nature, 424, 361.[Medline]
Das,D. and Georgiadis,M.M. (2001) Protein Sci., 10, 19361941.[CrossRef][Web of Science][Medline]
Davies,J.F.,III, Hostomska,Z., Hostomsky,Z., Jordan,S.R. and Matthews,D.A. (1991) Science, 252, 8895.
Guaitiao,J., Zuniga,R., Roth,M. and Leon,O. (2004) Biochemistry, 43, 13021308.[CrossRef][Medline]
Hyde,C.C., Bushman,F.D., Mueser,T.C. and Yang,Z.-N. (1999) J. Mol. Biol., 296, 535538.
Jacobo-Molina,A., Arthur,D., Clark,J., Williams,R.L., Nanni,R.G., Clark,P., Ferris,A.L., Hughes,S.H. and Arnold,E. (1991) Proc. Natl Acad. Sci. USA, 88, 1089510899.
Jenkins,T.M., Engelman,A., Ghirlando,R. and Craigie,R. (1996) J. Biol. Chem., 271, 77127718.
Klarmann,G.J., Hawkins,M.E. and Grice,S.F.L. (2002) AIDS Rev., 4, 183194.[Medline]
Kohlstaedt,L.A., Wang,J., Friedman,J.M., Rice,P.A. and Steitz,T.A. (1992) Science, 256, 17831790.
Li,Y. et al. (1999) Acta Crystallogr. D, 55, 19061910.[CrossRef][Medline]
Maldonado,E., Drapkin,R. and Reinberg,D. (1996) Methods Enzymol., 274, 72100.[Web of Science][Medline]
Mueller,G.A., Pari,K., DeRose,E.F., Kirby,T.W. and London,R.E. (2004) Biochemistry, 43, 93329342.[CrossRef][Medline]
Omer,C.A. and Faras,A.J. (1982) Cell, 30, 797805.[CrossRef][Web of Science][Medline]
Pari,K., Mueller,G.A., DeRose,E.F., Kirby,T.W. and London,E. (2003) Biochemistry, 42, 639650.[CrossRef][Medline]
Parniak,M., Min,K., Budihas,S., Grice,S.L. and Beutler,J. (2003) Anal. Biochem., 322, 3339.[CrossRef][Web of Science][Medline]
Patel,P., Jacobo-Molina,A., Ding,J., Tantillo,C., Clark,A., Raag,R., Nanni,R., Hughes,S. and Arnold,E. (1995) Biochemistry, 34, 53515363.[CrossRef][Medline]
Powers,R., Clore,G.M., Stahl,S.J., Wingfield,P.T. and Gronenborn,A. (1992) Biochemistry, 31, 91509157.[CrossRef][Medline]
Resnick,R., Omer,C.A. and Faras,A.J. (1984) J. Virol., 51, 813821.
Restle,T., Pawlita,M., Sczakiel,G., Muller,B. and Good,R.S. (1992) J. Biol. Chem., 267, 1465414661.
Sarafianos,S.G., Das,K., Tantillo,C., Arthur,D., Clark,J., Ding,J.-P., Whitcomb,J.M., Boyer,P.L., Hughes,S.H. and Arnold,E. (2001) EMBO J., 20, 14491461.[CrossRef][Web of Science][Medline]
Smith,C.M., Leon,O., Smith,J.S. and Roth,M.J. (1998) J. Virol., 72, 68056812.
Smith,J.S. and Roth,M.J. (1992) J. Biol. Chem., 267, 1507115079.
Smith,J.S. and Roth,M.J. (1993) J. Virol., 67, 40374049.
Smith,J.S., Kim,S. and Roth,M.J. (1990) J. Virol., 64, 62866290.
Smith,J.S., Gritsman,K. and Roth,M.J. (1994) J. Virol., 68, 57215729.
Snyder,C.S. and Roth,M.J. (2000) J Virol., 74, 96689679.
Wang,J., Smerdon,S., Jager,J., Kohlstaedt,L., Rice,P., Friedman,J. and Steitz,T. (1994) Proc. Natl Acad. Sci. USA, 91, 72427246.
Wohrl,B.M., Ehresman,B., Keith and Grice,S.F.L. (1993) J. Biol. Chem., 268, 1361713624.
Wohrl,B.M., Georgiadis,M.M., Telesnitsky,A., Hendrickson,W.A. and Grice,S.F.L. (1995a) Science, 267, 9699.
Wohrl,B.M., Tantillo,C., Arnold,E. and Grice,S.F.L. (1995b) Biochemistry, 34, 53435356.[CrossRef][Medline]
Received June 7, 2004; revised August 18, 2004; accepted August 20, 2004.
Edited by Steven Russell
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
W. Wang, W. W. Prosise, J. Chen, S. S. Taremi, H. V. Le, V. Madison, X. Cui, A. Thomas, K.-C. Cheng, and C. A. Lesburg Construction and characterization of a fully active PXR/SRC-1 tethered protein with increased stability Protein Eng. Des. Sel., July 1, 2008; 21(7): 425 - 433. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Gaidamakov, I. I. Gorshkova, P. Schuck, P. J. Steinbach, H. Yamada, R. J. Crouch, and S. M. Cerritelli Eukaryotic RNases H1 act processively by interactions through the duplex RNA-binding domain Nucleic Acids Res., April 14, 2005; 33(7): 2166 - 2175. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






