Skip Navigation


PEDS Advance Access originally published online on March 14, 2005
Protein Engineering Design and Selection 2005 18(1):1-10; doi:10.1093/protein/gzh102
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/1/1    most recent
gzh102v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lo, K.-M.
Right arrow Articles by Gillies, S. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lo, K.-M.
Right arrow Articles by Gillies, S. D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions{at}oupjournals.org

Engineering a pharmacologically superior form of leptin for the treatment of obesity

Kin-Ming Lo1,2, Jinyang Zhang1, Yaping Sun1, Bo Morelli1, Yan Lan1, Scott Lauder1, Beatrice Brunkhorst1, Gordon Webster1, Sophie Hallakou-Bozec3, Lilliane Doaré3 and Stephen D. Gillies1

1EMD-Lexigen Research Center, Bedford Campus, 45A Middlesex Turnpike, Billerica, MA 01821, USA and 3Merck-Santé S.A., 4 Avenue du President François Mitterand, 91380 Chilly-Mazarin, France

2 To whom correspondence should be addressed. E-mail: klo{at}emdlexigen.com


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Leptin plays a central role in the homeostasis of body weight through its regulatory effects on appetite and energy expenditure, yet in trials as a therapeutic agent for the treatment of obesity in humans it has been disappointing. The poor clinical efficacy of leptin results from its short circulating half-life, low potency and poor solubility, necessitating large and frequent doses to obtain even modest clinical benefit. Engineered Fc–leptin immunofusins, consisting of the Fc fragment of an immunoglobulin gamma chain followed by leptin, exhibit improved pharmacological properties with very consistent and potent biological activities. Furthermore, in extending the circulating half-life of the protein in vivo from a few minutes for leptin to many hours for Fc–leptin, these proteins have the potential to reduce drastically the dosage and frequency of administration required to obtain clinical benefit. The results of this study show that the engineered leptin immunofusins described here have significantly enhanced pharmacological properties in comparison with the recombinant leptin that was used in clinical trials. As such, they could represent an important step towards a therapeutically superior form of leptin if the disappointing performance of leptin in early clinical trials was due to its poor pharmacological properties rather than any conceptual weakness in the strategy of using leptin for the treatment of obesity and its related disorders.

Keywords: diabetes/Fc/immunoglobulin/leptin/obesity


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Obesity is a major physiological disorder that is associated with increased mortality and increased morbidity from a wide variety of conditions including diabetes mellitus, hypertension, hyperlipidemia, coronary artery disease and certain forms of cancer (Thompson and Wolf, 2001Go). In the USA, more than 50% of the adult population can be considered overweight, with the number of adults who can be classified as obese having risen from about 14% to well above 20% over a 15-year period (National Task Force on the Prevention and Treatment of Obesity, 2000Go). There are also indications that obesity is fast becoming a serious health problem worldwide (Thompson and Wolf, 2001Go). It is recognized that in many cases of obesity, diet and exercise alone are not enough to achieve the desired reduction in body weight, especially in people who inherit genetic traits that predispose them to becoming obese (Ioffe et al., 1998Go). Consequently, the search for potential therapeutic agents that can facilitate weight loss and reduce the risks of obesity-related disorders has become something of a holy grail in the field of obesity research.

Leptin, a mammalian cytokine of 167 amino acids, plays an essential role in mediating adaptive responses to environmental variations in the availability of energy, regulating the storage of excess energy as triglycerides in adipose cells when energy supplies are plentiful and the subsequent utilization of this stored energy during prolonged periods of nutritional deprivation (Spiegelman and Flier, 1996Go). Through studies of profoundly obese and diabetic phenotypes in mice and humans associated with mutations in the ob gene, the ob gene product leptin was identified as the endocrine link between the brain and the storage of fat in adipose tissue (Zhang et al., 1994Go; Green et al., 1995Go). Similar investigations of the genetic loci associated with obesity and diabetes subsequently led to the discovery of a leptin receptor (OB-R) (Tartaglia et al., 1995Go). To date, six differently spliced isoforms of OB-R have been identified (Lee et al., 1996Go). The longer Ob-Rb isoform, predominantly expressed in the hypothalamus, seems to be the form of OB-R uniquely responsible for the neuroendocrine effects of leptin in energy homeostasis (Chen,H. et al., 1996Go; Ghilardi and Skoda, 1997Go), via its ability to activate jak/stat signaling pathways (Baumann et al., 1996Go; Ghilardi et al., 1996Go; Vaisse et al., 1996Go; Ghilardi and Skoda, 1997Go).

Leptin exerts a regulatory effect on lipid levels as a result of its expression and secretion by adipocytes in proportion to their levels of stored triglycerides. Indeed, circulating levels of leptin in the blood are known to be closely correlated with the degree of obesity (Considine et al., 1996Go). The key physiological effects of leptin that make it a potentially useful therapeutic agent for the treatment of obesity-related disorders, reducing appetite, facilitating weight loss and reversing obesity-related insulin resistance have been most clearly demonstrated in studies involving the administration of recombinant leptin to mice with the ob/ob phenotype, a leptin-deficient mouse strain (Weigle et al., 1995Go; Seufert et al., 1999Go). Although the most obvious biological effects of leptin are associated with adiposity, energy homeostasis in mammals involves many other physiological systems in addition to the regulation of fat storage and consumption. As a primary modulator of the multi-factorial metabolic systems involved in energy homeostasis, leptin has systemic and far-reaching behavioral and physiological effects that influence not only adiposity (Friedman and Halaas, 1998Go), but also many other functional areas such as food intake (Schwartz et al., 2000Go), glucose homeostasis (Seufert et al., 1999Go; Schwartz et al., 2000Go), fatty acid homeostasis in non-adipocytes (Unger et al., 1999Go), reproduction and sexual development (Brann et al., 2002Go; Moschos et al., 2002Go), immune response (Lord et al., 1998Go; Marti et al., 2001Go), angiogenesis (Sierra-Honigmann et al., 1998Go), wound healing (Ring et al., 2000Go) and bone remodeling (Ducy et al., 2000Go).

Two of the major problems that must be addressed for the use of leptin as a therapeutic agent are its short circulating half-life and poor solubility. In an early clinical trial, the use of leptin to reduce body weight in humans met with only limited success (Friedman and Halaas, 1998Go). To achieve clinical benefit, high doses had to be injected three times daily for 6 months, which caused local reactions in the skin. Furthermore, clinical benefit was observed in only a small fraction of patients in this 6-month trial. More recently, an extensive, randomized and controlled clinical trial to observe the effects of exogenous leptin in groups of obese and lean adults also yielded disappointing results (Heymsfield et al., 1999Go). Although a small but statistically significant weight loss was observed in some of the study participants, it was only amongst the most obese subjects who were given the highest doses of leptin. In addition, inflammatory responses at the sites of injection produced redness and swelling that were severe enough to cause some of the subjects to drop out of the study prematurely.

A therapeutically effective form of leptin suitable for the clinical treatment of obesity may be possible if leptin can be produced as a highly soluble protein with a long circulating half-life. In this paper, we describe a series of novel leptin immunofusins (immunoglobulin fusion proteins) that have several desirable properties with the potential to enhance the clinical efficacy of leptin. These fusion proteins consist of the Fc fragment of the immunoglobulin gamma chain as the N-terminal fusion partner, followed by leptin. Whereas the recombinant leptin used in previous clinical trials was produced in the form of insoluble inclusion bodies in bacteria and has solubility problems following the renaturation process (Fawzi et al., 1996Go), soluble Fc–leptin fusion proteins were produced in mammalian cells and secreted into the media, from which they could be readily purified to homogeneity by protein A affinity chromatography. Purified Fc–leptin is highly soluble and possesses a very consistent and potent biological activity that is many-fold greater than that of its bacterially produced counterpart. More importantly, Fc–leptin exhibits a much longer serum half-life, which obviates the need for daily injections and potentially makes it a much more acceptable pharmacological agent for the treatment of obesity.

The use of a fused N-terminal immunoglobulin Fc domain (Fc–X) has been shown to enhance significantly the production and secretion of proteins expressed in mammalian cells in addition to providing an easy route to their purification (Lo et al., 1998Go). The protein of interest is expressed as a fusion to a signal peptide and an immunoglobulin Fc domain, which lead to high levels of cellular expression and secretion. This Fc–X approach should be superior to an X–Fc expression system since X may not always be a protein that is normally targeted to the endoplasmic reticulum or expressed at a high level. Furthermore, as a relatively large and highly soluble protein vehicle, the Fc domain can potentially extend the circulating half-life of pharmacological proteins in vivo protecting them from degradation and preventing their clearance by renal filtration. The use of Fc domains, however, may produce some unwanted properties in pharmacological fusion proteins, since the Fc domain itself may be recognized by the Fc receptors of the immune system, triggering the cellular activation responses associated with the immune effector functions of Fc (Ravetch, 1997Go) and reducing the circulating half-life of the fusion protein (Gillies et al., 1999Go). This can be largely circumvented by the use of immunoglobulin Fc isotypes such as Fc{gamma}2 that have a lower affinity for the Fc receptor (Cole et al., 1997Go; Gillies et al., 1999Go). Site-directed mutagenesis can also be used to abrogate further Fc receptor binding by making selective changes to the receptor binding regions in the Fc domain itself (Gillies et al., 1999Go).

In the first part of the study described here, the feasibility of the Fc fusion approach for leptin treatment is demonstrated in leptin-deficient and normal, lean mice, using fusion constructs combining murine Fc (muFc) and murine leptin (muLeptin). The initial use of murine constructs in mice allowed us to establish a proof of principle for the clinical use of Fc–leptin in the absence of the experimental artifacts that arise as a result of the immunogenicity of the injected agent. The expression properties and in vivo activities of Fc–leptin and leptin–Fc constructs are compared, along with an additional leptin–linker–Fc construct that we designed to try to circumvent some of the expression problems that we encountered with the leptin–Fc constructs.

Having established the proof of principle for the use of Fc–leptin for controlling obesity, the second part of this study describes similar experiments with constructs combining human Fc and human leptin. The huFc{gamma}2h–huLeptin construct, a potential clinical candidate for the treatment of obesity and its related disorders in humans, consists of a modified human immunoglobulin Fc chain of the {gamma}2 isotype (huFc{gamma}2h) fused with human leptin (huLeptin). Its expression properties and activity are compared with those of human Fc{gamma}1 and Fc{gamma}2 fusion constructs. The Fc{gamma}2 domain has a greatly reduced affinity for the Fc receptor compared with Fc{gamma}1, but in trying to produce the recombinant protein we observed that it is much more prone to post-translational misfolding and aggregation. This appears to be because Fc{gamma}2 has four disulfide bridges instead of the two that are present in Fc{gamma}1, therefore post-translational misfolding can more readily lead to cross-linking and aggregation. The Fc{gamma}2h chain is a modified form of Fc{gamma}2 that we engineered to have only two disulfide bridges as described in Materials and methods, thereby making it a more amenable fusion partner for recombinant protein expression.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Cloning and expression of Fc–leptin fusion proteins

RNA was prepared from the fat cells of a normal C57/BL6 mouse and reverse transcribed with reverse transcriptase. The resultant cDNA was used as a template for polymerase chain reactions (PCRs) to clone and adapt the murine leptin cDNA for expression as an muFc–muLeptin fusion protein (where muFc is the Fc region of murine immunoglobulin-{gamma}2a and muLeptin is murine leptin). The forward primer was 5'-CCCGGGTAAAGTGCCTATCCAGAAAGTCC, where the sequence CCCGGG (XmaI restriction site) TAAA encodes the carboxyl terminus of the immunoglobulin heavy chain, followed by a sequence encoding the N-terminus of leptin. The reverse primer was 5'-CTCGAGTCAGCATTCAGGGCTAACATC, which encodes the anti-sense strand of the C-terminal sequence of leptin with its translation STOP codon, followed by a XhoI restriction site. The 450 base-pair PCR product was cloned and sequenced. The expression vector pdCs–muFc–muLeptin was constructed by ligating the XmaI–XhoI fragment encoding muLeptin into the pdCs–muFc vector (Lo et al., 1998Go). The resultant vector pdCs–muFc–muLeptin was used to transfect human 293 and mouse NS/0 cells for protein expression as described previously (Lo et al., 1998Go).

Human forms of Fc–leptin were produced in a similar manner. A human leptin cDNA was obtained by PCR cloning from Human Fat Cell Quick-Clone cDNA (Clontech, Palo Alto, CA) and ligated as an XmaI to XhoI fragment into the pdCs–huFc{gamma}1 expression vector (Lo et al., 1998Go) encoding the Fc fragment of human immunoglobulin-{gamma}1 (huFc{gamma}1). The PCR primers used were 5'-CCCGGGTAAAGTGCCCATCCAAAAAGTCCA and 5'-CTCGAGTCAGCACCCAGGGCTGAGGTC for the forward and reverse primers, respectively. For the construction of huFc{gamma}2 h–huLeptin, the genomic DNA encoding Fc{gamma}2 was obtained by PCR on cellular DNA isolated from human peripheral blood mononuclear cells (PBMC). The forward primer has the sequence 5'-CCTTAAGCGAGCGCAAATGTTGTGTCGAG, where CTTAAGC (containing an AflII restriction site) was introduced just upstream of the {gamma}2 hinge coding region. The reverse primer has the sequence 5'-CCTCGAGTCATTTACCCGGGGACAGGGAG, where an XhoI restriction site CTCGAG was introduced immediately after the translation stop codon (anticodon TCA). In addition, the reverse primer also introduced an SmaI CC CGGG by silent mutation (A to G substitution underlined). The 910 bp PCR fragment was cloned into TOPO TA Cloning Vector (Invitrogen, Carlsbad, CA) for sequence verification. The natural SmaI restriction site in the DNA sequence encoding the upper CH3 region was deleted by a silent mutation introduced by an overlapping PCR technique. The forward primer has the sequence 5'-CTGCCCCCATCACGGGAGGAGATGACCAAG, where the C to A substitution is underlined; and the reverse primer has the sequence 5'-GGTCATCTCCTCCCGTGATGGGGGCAGGGTGTAC, where the G to T substitution is underlined. After sequence verification, the resultant AflII–XhoI restriction fragment encoding the Fc of {gamma}2 contains a unique SmaI site upstream of the translation stop codon, followed by the XhoI site. The AflII–SmaI fragment encoding Fc{gamma}2 was then used to replace the corresponding restriction fragment encoding Fc{gamma}1 in pdCs–huFc{gamma}1 to produce pdCs–huFc{gamma}2.

The immunoglobulin-{gamma}2 hinge region contains four cystine disulfide bonds. The AflII–StuI fragment 5'-CTTAAGCGAGCGCAAATGTTGTGTCGAGTGCCCACCGTGCCCAG containing the native {gamma}2 hinge exon in pdCs–huFc{gamma}2–Leptin was replaced by the corresponding AflII–StuI fragment 5'-CTTAAGCGAGCCCAAATCTTCTGACAAAACTCACACATGCCCACCGTGCCCAG containing the modified {gamma}1 hinge exon from pdCs–huFc{gamma}1–Leptin. The {gamma}1 hinge sequence in pdCs–huFc{gamma}1 contains a Cys to Ser mutation (underlined) that eliminates the Cys residue which forms a disulfide bond with the light chain in Ig{gamma}1 (Lo et al., 1998Go). Since the StuI sites in both the {gamma}1 and {gamma}2 exons are C-methylated and the StuI restriction endonuclease is methylation sensitive, both plasmids had to be isolated from a DNA cytosine methylase (DCM) negative strain of bacteria before they could be digested with the StuI enzyme. The resultant pdCs–huFc{gamma}2–Leptin with the hinge region from pdCs–huFc{gamma}1 was designated pdCs–huFc{gamma}2 h–Leptin ({gamma}2h: gamma-2 hinge mutant).

Cloning and expression of leptin–Fc fusion proteins

The murine leptin cDNA was adapted for expression as a muLeptin–muFc fusion protein by PCR. The forward primer, 5'-CTTAAGCGTGCCTATCCAGAAAGTCCA, introduced an AflII (CTTAAG) restriction site for ligating the cDNA encoding the mature N-terminus of murine leptin to the DNA encoding a signal peptide (Lo et al., 1998Go). The reverse primer, 5'-GATATCGCATTCAGGGCTAACATC, introduced an EcoRV restriction site into the sequence encoding the C-terminus of murine leptin, without the STOP codon. The EcoRV site served as a linker–adaptor for an in-frame fusion of the murine leptin to the murine Fc, which was engineered to contain a unique EcoRV site at the 5' end of the hinge region with the following sequence GATATCTTAAGCGAGCCCAGA, where the CTTAAG is the AflII site preceding the DNA sequence encoding the hinge region (Lo et al., 1998Go). The reconstructed pdCs–muLeptin–muFc expression vector contains a DNA fragment encoding a signal peptide and the mature murine leptin, followed by muFc. A different expression plasmid, designated pdCs–muLeptin–linker–muFc, was engineered in the same fashion except that it contained an insertion at the EcoRV site, of a linker encoding Gly–Ala–Gly2–Ser–Gly2–Ser.

Western blotting analyses

For transient transfection analysis, 293 cells (1.5 x 106 cells on a 100 mm plate) were transfected with plasmid DNA using LipofectAmine Plus Reagent (Life Technologies, Gaithersburg, MD). Three days after transfection, cell culture medium was harvested and after two washes with PBS, cells were lysed in a triple-detergent lysis buffer (50 mM Tris–HCl (pH 8.0), 150 mM NaCl, 0.02% sodium azide, 0.1% SDS, 100 mg/ml phenylmethylsulfonyl fluoride (PMSF), 1 mg/ml aprotinin, 1% Nonidet P-40 (NP-40), 0.5% sodium deoxycholate). Total cell lysate or cell culture media samples were incubated with protein A Sepharose beads at 4°C overnight. Beads were then washed several times with PBS containing 1% Triton X-100. Bound proteins were eluted in SDS gel buffer and separated on a 4–20% polyacrylamide gradient gel. After electrophoresis, the proteins were blotted on to PVDF membranes (Millipore, Bedford, MA) and visualized by reaction with either horseradish peroxidase (HRP)-conjugated anti-mouse Fc antisera (Jackson ImmunoResearch, West Grove, PA) or biotinylated anti-mouse leptin antibody (R&D Systems, Minneapolis, MN), followed by incubation with HRP-conjugated avidin. For characterizing the huFc–huLeptin in the pharmacokinetics study, 3 µl of mouse serum samples per lane were loaded on a 4–20% polyacrylamide gradient gel. Western blot analysis was performed with HRP-conjugated anti-human IgG (Jackson ImmunoResearch).

Specific activity analyses

The specific activities of the huFc–huLeptin constructs were measured using a standard proliferation assay using the murine pro-B cell line BAF-3 (a gift from R&D Systems) transfected with the gene for the human OB receptor (Gainsford et al., 1996Go). This cell line is dependent on leptin for growth and is under G418 selection for optimal expression of the human OB receptor. Proliferation was measured using the uptake of [3H]thymidine. Washed BAF-3 (OB-R) cells in the log phase (10 000 cells/well) were incubated with leptin for 32 h. [3H]thymidine (Dupont-NEN-027) was then added and the incubation continued for an additional 16 h. The cells were then lysed with water and harvested from the wells on to glass microfiber filter plates and radioactivity was measured by liquid scintillation counting.

Treatment of mice with leptin fusion proteins

C57BL/6 J mice, AKR/J, wild-type and C57BL/6J ob1J/ob1J mice, which were homozygous for the obese gene mutation (ob/ob mice), were purchased from Jackson Research Laboratories (Bar Harbor, ME). All mice were allowed ad libitum access to food and water and their body weights were measured daily and before any injections. The leptin fusion proteins were suspended in phosphate-buffered saline (PBS) and administered following the dose schedules indicated in the figure captions. The amounts of leptin injected were normalized to a given weight of leptin per kilogram of mouse body weight.

Pharmacokinetics of leptin fusion proteins

The pharmacokinetics of muFc–muLeptin and murine leptin (R&D Systems) were compared. Ob/ob mice were injected in the tail vein (six mice per group) with control leptin or fusion proteins in PBS. The amounts of leptin injected were normalized to 1 mg of leptin per kilogram of mouse body weight. Blood samples were obtained by retro-orbital bleeding immediately after injection (0 min) and at 0.1, 0.5, 1, 2, 4, 8, 24 and 48 h post-injection. Blood samples were collected in tubes containing heparin to prevent clotting and placed on ice. Cells were removed by centrifugation in an Eppendorf high-speed microcentrifuge for 4 min. The concentration of leptin in the plasma was measured using a commercial mouse leptin immunoassay kit (R&D Systems). The pharmacokinetics of huFc–huLeptin in ob/+ mice were determined in a similar manner, except that the concentrations and integrity of huFc–huLeptin in the serum samples were determined by huFc ELISA and western blot analysis, respectively.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Expression of the leptin fusion proteins

The Fc portion of IgG has been extensively used as a fusion partner. In most cases the configuration of these molecules places the Fc at the C-terminus (Bush et al., 2002Go; Christadoss and Goluszko, 2002Go). Leptin contains two cysteine residues that form a covalent linkage between the middle of the protein and the C-terminus (Zhang et al., 1997Go). This could potentially make it more difficult for an N-terminal leptin–Fc fusion protein to form the correct secondary structure since the C-terminal cysteine of leptin would be peptide bonded to the hinge region of the Fc. Such misfolding could negatively affect the production and secretion rate of the protein and also its affinity for the leptin receptor. We compared the expression of both the traditional leptin–Fc configuration and the oppositely oriented fusion construct Fc–leptin by transient expression analysis in 293 human kidney carcinoma cells. Both expression plasmids used identical promoters, signal sequences and other regulatory elements, so that any differences in expression would be the result of the properties of the proteins themselves. Transient expression analyses did indeed indicate that the level of leptin production and its ability to be secreted into the cell culture medium were greatly influenced by the orientation of the Fc fusion partner (Figure 1a). In fact, with murine leptin as the N-terminal domain of the fusion protein, the majority of the immunoreactive protein detected with either murine Fc- or murine leptin-specific antibodies was cell associated. The problem of secretion was not alleviated when a peptide linker of eight amino acids was added between leptin and the Fc domain, to allow more flexibility in protein folding. In contrast, muFc–muLeptin was readily secreted into the medium at a level estimated to be at least 20-fold higher than that of muLeptin–muFc. Such a difference was also observed in stable NS/0 clones. For muFc–muLeptin, the expression levels of the clones were about 30 µg/ml. By contrast, for muLeptin–muFc and muLeptin–linker–muFc the expression levels of the highest producing clones were only about 1 µg/ml.



View larger version (35K):
[in this window]
[in a new window]
 
Fig. 1.. Transient expression analysis of leptin fusion proteins. (a) Expression vectors for (1) muFc (control), (2) muFc–muLeptin, (3) muLeptin–muFc and (4) muLeptin linker-muFc were used to transfect 293 cells. Total cell lysates (C) and supernatants (S) were analyzed by western blot analysis using horseradish peroxidase (HRP)-conjugated anti-mouse Fc-{gamma} antisera (upper gel) and biotinylated anti-mouse leptin antibody (R&D Systems) (lower gel). Under reducing conditions, muFc and muFc–muLeptin have apparent molecular weights of 33 and 48 kDa, respectively. (b) Non-reducing SDS-PAGE comparison of the soluble fractions obtained from the expression of (1) muFc–muLeptin, (2) huFc{gamma}1–huLeptin, (3) huFc{gamma}2h–huLeptin and (4) huFc{gamma}2–huLeptin. The misfolding and aggregation of the huFc{gamma}2–huLeptin can clearly be seen, resulting from intermolecular cross-linking of the four disulfide bridges present in the human Fc{gamma}2 domain. By contrast, the modified Fc{gamma}2h variant with only two disulfide bridges shows the uniform and high-yield expression of a single molecular species.

 
The expression of the pharmacologically optimized huFc{gamma}2h–huLeptin construct was also compared with that of the huFc{gamma}1 and huFc{gamma}2 constructs (Figure 1b). It can clearly be seen that the huFc{gamma}2h construct does not exhibit the misfolding and aggregation to which the unmodified huFc{gamma}2 is prone and shows improved levels of expression even in comparison with the earlier huFc{gamma}1 construct (with subsequently optimized production clones of the huFc{gamma}2h–huLeptin construct, expression levels as high as 300 µg/ml were achieved). All of these results have also been confirmed by quantitative ELISA from both transient and stable transfection analyses.

Specific activity analyses

An in vitro bioassay was used to demonstrate that the leptin domain in the recombinant huFc–huLeptin constructs is recognized by the leptin receptor (OB-R) and can successfully signal through that receptor to cause cell proliferation. The specific activities of the huFc–huLeptin constructs were measured using the proliferation of murine pro-B cell line BAF-3 transfected to express the human OB receptor. Figure 2 shows a representative experiment comparing the specific activities of the three huFc–huLeptin constructs huFc{gamma}1–huLeptin, huFc{gamma}2–huLeptin and huFc{gamma}2h–huLeptin relative to the WHO international standard (Robinson et al., 2001Go). The leptin in these three different huFc–huLeptin molecules range in average specific activity from about one-quarter to about half of the specific activity of the international standard for human leptin.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.. Bioassay of huFc–huLeptin activity. The bioactivity of the huFc–huLeptin constructs as measured by the proliferation of the murine pro-B cell line BAF-3 transfected to express the human OB receptor. Closed circles represent the international recombinant human leptin standard (97/594), filled squares recombinant human leptin from R&D Systems, open circles huFc{gamma}1–huLeptin, open squares huFc{gamma}2–huLeptin and open triangles, huFc{gamma}2h–huLeptin. This is a representative graph showing the averaged responses with standard errors.

 
Treatment of ob/ob mice by intraperitoneal (i.p.) injection of muFc–muLeptin

Groups of 5- to 6-week-old ob/ob mice (three mice per group) received daily i.p. injections of either muFc–muLeptin (0.25 mg of leptin per kg body weight) or vehicle (PBS), over an approximately 3-month period. The control group exhibited a steady 40% increase in mean body weight (from 50 to 70 g). The treatment group had a 45% reduction in mean body weight (from 50.5 to 28 g) over the first month, after which the mean reduction in body weight stabilized at between 45 and 47% (Figure 3a). The mice did not receive treatment over the weekends, which caused their body weights to increase slightly at weekends, with the resumption of daily treatment leading to a steady decrease in their body weights during the week. As shown in Figure 3a, muFc–muLeptin was shown to be effective for over 3 months. During the first 2 weeks of this study, food intake for the treatment group was below detectable limits. After 3–4 weeks, when the mean body weight had decreased by about 41% and most excess adipose tissue was apparently depleted, the mice consumed a daily average of about 3 g of food per mouse. This is consistent with the results of an earlier study (Mounzih et al., 1997Go), which showed that the daily food consumption of ob/ob mice receiving leptin treatment at 20 mg/kg resumed at about 2.6–3.2 g at day 45. The remarkable weight loss represented by the data in Figure 3a, and also the general physiological effects of muFc–muLeptin on ob/ob mice, are graphically illustrated by the series of photographs of one of the treated ob/ob mice, shown in Figure 4.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3.. Effects of muFc–muLeptin on the body weight of ob/ob mice. (a) 5- to 6-week-old mice (two mice per group) received intraperitoneal injections of PBS (circles) or 0.25 mg/kg of murine leptin (diamonds) in the form of muFc–muLeptin, daily for the first 12 days and Monday through Friday thereafter. (b) Mice (two mice per group) received daily intravenous injections of PBS (circles) or muFc–muLeptin at 0.25 (squares) or 1 mg (triangles) of murine leptin per kg of body weight from day 0 to day 4. (c) A group of three ob/ob mice received 0.25 mg/kg (triangles) of murine leptin in the form of muFc–muLeptin by daily subcutaneous injections (Monday through Friday) up to day 17; from day 18 to day 31 the frequency of injection was reduced to Monday and Friday only; thereafter the frequency of injection was increased to three times weekly (Monday, Wednesday and Friday). Another group also consisting of three ob/ob mice (squares), received 0.1 mg/kg of murine leptin in the form of muFc–muLeptin by daily subcutaneous injections from Monday through Friday up to day 20; from day 21 to day 63 the frequency of injection was reduced to three times weekly (Monday, Wednesday and Friday); after day 63, the dosage was increased to 1 mg/kg once every four days. A control group of three ob/ob mice (circles) received PBS daily, Monday through Friday.

 


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 4.. Physiological effects of muFc–muLeptin on ob/ob mice. The general physiological effects of muFc–muLeptin on ob/ob mice are strikingly illustrated in this series of photographs showing an individual ob/ob mouse after treatment with muFc–muLeptin for (a) 0, (b) 16, (c) 28 and (d) 39 days. The body weight of the mouse shown, initially in the extremely obese range (65.3 g) was reduced by 56% over the course of 39 days of treatment (to 28.8 g), putting it well within the range for normal lean mice. The psoriasis and accompanying hair loss evident at the outset of the treatment are probably a combination of the immune dysfunction that is characteristic of ob/ob mice and the inability of the mouse to clean itself properly owing to its extreme obesity.

 
Treatment of ob/ob mice by subcutaneous (s.c.) and intravenous (i.v.) injection of muFc–muLeptin

S.c. injection of muFc–muLeptin was found to be as effective as i.p. injection in reducing body weight in 5- to 6-week-old ob/ob mice (three mice per group). After 17 days, the mice receiving daily (Monday through Friday) s.c. injections of muFc–muLeptin at 0.1 and 0.25 mg of leptin per kg body weight had reductions of 14% and 22% in mean body weight, respectively, while the control group receiving PBS exhibited a 15% weight gain. The decrease in food intake in mice receiving s.c. injections was similar to that in mice receiving i.p. injections of equivalent doses; i.v. injection was also effective. Ob/ob mice (two mice per group) received daily i.v. injections of muFc–muLeptin at 0.25 or 1 mg/kg. Treatment was stopped after 5 days, but body weights continued to be recorded daily. As shown in Figure 3b, treatment with 0.25 and 1 mg/kg of muFc–muLeptin caused the mean body weight to decrease for the next 48 and 72 h, respectively. These results suggest that muFc–muLeptin has a much longer circulating half-life than murine leptin, based upon the high, frequent doses of murine leptin that have been shown to be necessary for reducing body weight (Friedman and Halaas, 1998Go).

Dosing schedules of three times weekly or once every 4 days were effective

To show that daily injections of muFc–muLeptin are not necessary, different dosing schedules were tested on ob/ob mice (three mice per group). The results shown in Figure 3c demonstrate that s.c. injections of 0.25 mg/kg of muFc–muLeptin three times weekly (Monday, Wednesday and Friday) were effective in stabilizing a mean reduction in body weight of about 10% (from 42 to 38 g) for over 3 months. These results also show that after an initial weight gain of about 14% (from 44 to 51 g) for mice on an ineffective dosing schedule of 0.1 mg/kg three times weekly, switching to a new regimen of s.c. injections of 1 mg/kg once every 4 days resulted in a mean reduction in body weight of about 33% (from 51 to 34 g) in 4 weeks, after which the mean reduction in body weight leveled off at about 37% (32 g).

Treatment of lean mice and db/db mice with muFc–muLeptin

For comparison with ob/ob mice, normal C57BL/6J, C57BL/KS and Balb/C mice, and also diabetic C57BL/KS db/db mice, all received daily (Monday through Friday) i.p. or s.c. injections of 0.25 or 1 mg/kg of leptin in the form of muFc–muLeptin. As shown in Table I, muFc–muLeptin at both dosage levels had no effect on db/db mice, as would be expected, since these mice lack the receptor for leptin. In normal C57BL/6J, C57BL/KS and Balb/C mice, the low dose had only a very modest effect. The high dose, however, resulted in a significant reduction in body weight over 19 days (Table I), independent of the ages and initial body weights of the mice.


View this table:
[in this window]
[in a new window]
 
Table I.. Percentage change in body weight of mice (three mice per group) treated with 0, 0.25 and 1 mg/kg of muFc–muLeptin by daily (Monday through Friday) intraperitoneal or subcutaneous injections for 19 days

 
Treatment of ob/ob mice with huLeptin and huFc–huLeptin

The data presented in Figure 5a clearly demonstrate the greatly enhanced efficacy in vivo of the human Fc–leptin constructs in comparison with recombinant human leptin. It is interesting that even at the highest dosage of recombinant leptin (5.0 mg/kg), only a very modest weight loss (about 7%) could be obtained over the 12-day treatment period. By contrast, a 50-fold lower dose of huFc{gamma}2h–huLeptin (0.1 mg/kg) was sufficient to obtain a very significant weight loss (about 33%) over the same treatment period. Even at a 200-fold lower dosage (0.025 mg/kg), huFc{gamma}2h–huLeptin was somewhat more effective than recombinant human leptin (5 mg/kg). Based on the results shown in Figure 5a, therefore, huFc{gamma}2h–huLeptin administered to ob/ob mice is at least two orders of magnitude more potent in vivo than recombinant human leptin.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5.. Effects of huFc–huLeptin on the body weight of ob/ob and normal lean AKR/J mice. (a) Effect of huFc–huLeptin on body weight of ob/ob mice. Eight-week-old ob/ob mice (four mice per group) received i.p. injections of PBS (diamonds), 0.1 (squares), 1.0 (triangles), 2.5 (crosses) or 5.0 (asterisks) mg/kg of human leptin, 0.1 mg/kg of huFc{gamma}1-huLeptin (open diamonds) or 0.0125 (pluses), 0.025 (small bars), 0.05 (large bars), 0.075 (open triangles) or 0.1 (open squares) mg/kg of huFc{gamma}2h–huLeptin over a 12-day treatment period. (b) Effect of huFc–huLeptin on body weight of AKR/J mice under a chow diet. Eight-week-old AKR/J mice (four mice per group) received i.p. injections of PBS (diamonds), 2.5 (squares) or 5.0 (triangles) mg/kg of human leptin or 0.1 (open squares), 1.0 (asterisks) or 5.0 (open diamonds) mg/kg of huFc{gamma}2h–huLeptin over a 12-day treatment period. In addition, a separate group of four mice on a high-fat diet received 1.0 mg/kg of huFc{gamma}2h–huLeptin (open triangles) over the same treatment period. (c) Effect of huFc–huLeptin on body weight ofAKR/J mice under a high fat diet. Eight-week-old AKR/J mice (four mice per group) received i.p. injections of PBS (diamonds), 5.0 (squares) or 10.0 (triangles) mg/kg of human leptin or 0.1 (crosses), 0.5 (asterisks), 1.0 (circles), 2.5 (pluses), 5.0 (short horizontal bars) or 10.0 (long horizontal bars) mg/kg of huFc{gamma}2h–huLeptin over a 12-day treatment period.

 
Treatment of AKR/J mice with huLeptin and huFc–huLeptin

Figure 5b and c show the effect of huFc{gamma}2h–huLeptin in AKR/J mice under chow (Figure 5b) and high-fat (Figure 5c) diets. Since these mice are not leptin deficient, higher doses were required to see significant weight loss over a relatively short treatment period. In spite of this, however, huFc{gamma}2h–huLeptin administered to AKR/J mice led to significant weight losses over the first few days of the treatment period, displaying a far greater potency in vivo than recombinant human leptin. After 5–6 days, however, the efficacy of these huFc–huLeptin constructs was limited, presumably by the production of antibodies against these non-murine proteins. On both diets, even the highest doses of human leptin (as high as 10.0 mg/kg) failed to achieve any significant weight loss in the AKR/J mice over the 12-day treatment period. By contrast, huFc{gamma}2h–huLeptin at a much lower dose (1.0 mg/kg) induced a weight loss of about 12% for mice on the chow diet and as much as 3% for mice on the high-fat diet, over the same treatment period. These results are particularly encouraging insofar as they indicate that the clinical administration of huFc{gamma}2h–huLeptin may potentially benefit even the non-leptin-deficient majority of obese individuals.

Pharmacokinetics

We compared the circulating half-lives of the recombinant mouse leptin and the Fc–leptin fusion protein after intravenous injection. The circulating half-lives of muFc–muLeptin and murine leptin in mice were determined to be 8.8 h and 18 min. respectively. The huFc–huLeptin constructs were found to have circulating half-lives of over 10 h in mice. As shown in Figure 6, western blot analysis revealed that even after 24 h in the mouse blood circulation, the huFc{gamma}2h–huLeptin construct remained essentially intact, with no detectable cleavage of the leptin domain from the Fc fragment.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 6.. Western blot of huFc{gamma}2 h–huLeptin from a treated mouse. Western blot (anti-huFc) under reducing conditions of huFc{gamma}2 h–huLeptin from the serum of a treated mouse 0, 0.5, 1, 2, 4, 8, 24 and 48 h post-injection, compared with the starting material (SM) as a control.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Fc–leptin has greatly improved pharmacological properties compared with the bacterially produced leptin used in earlier clinical trials (Fawzi et al., 1996Go). As a result of its greater in vivo potency and a much longer serum half-life, Fc–leptin was successfully used to treat obesity in both leptin-deficient (ob/ob) and normal mice. The results described here suggest that if the disappointing performance of the recombinant leptin used for the treatment of obesity in early clinical trials was a result of its poor pharmacological properties, then the leptin immunofusins described in this study may represent a promising approach for the development of pharmacological agents suitable for the clinical treatment of obesity.

The use of the Fc fragment as the N-terminal fusion partner results in efficient expression and secretion of leptin from mammalian cells, resulting in expression cell lines that produce about 380 mg of Fc–leptin per ml of tissue culture supernatant. This level of expression exceeds the highest yields of recombinant leptin that can be obtained from Escherichia coli (Fawzi et al., 1996Go). In contrast to the complicated process involved in renaturing leptin from bacterial inclusion bodies, the expression protocol described here yields soluble Fc–leptin in its native, biologically active form, that can be readily purified by protein A affinity chromatography.

To date, large-scale production of recombinant leptin has been done in E.coli (Fawzi et al., 1996Go) and the denaturing and renaturing protocols that are used lead to products that vary widely in yield and potency. In addition, leptin contains an intramolecular disulfide bond, so the refolding process must be carefully controlled in order to minimize the formation of intermolecular disulfide bonds and insoluble aggregates. It is interesting that one of the cysteine residues forming the disulfide bond is located at the C-terminus. The proximity of this cysteine to the Fc moiety may explain why both leptin–Fc and leptin–linker–Fc fusion proteins are not efficiently secreted.

In a recent clinical trial (Friedman and Halaas, 1998Go), the use of unfused recombinant leptin required high doses of the protein to be injected three times daily for 6 months to achieve the desired weight reduction. It is presumed that these frequent, high doses were necessitated by the combination of the low potency and short serum half-life of leptin. This observation is also reflected in the current ob/ob mouse models in which a daily intraperitoneal injection of 5–20 mg/kg of leptin was needed to demonstrate a significant reduction in body weight (Halaas et al., 1995Go; Pelleymounter et al., 1995Go; Chehab et al., 1996Go; Mounzih et al., 1997Go). To overcome the sub-optimal pharmacokinetics of leptin, a chronic subcutaneous infusion of leptin at 400 ng/h was needed to achieve a physiological plasma level of leptin in mice (Halaas et al., 1997Go).

The use of Fc–leptin obviates the need for frequent and high doses. As demonstrated in the ob/ob mouse model, a daily intraperitoneal or subcutaneous injection of 0.1 mg/kg of leptin in the form of muFc–muLeptin was enough to achieve reductions in body weight comparable to those obtained using the more frequent, high-dose regimen with unfused leptin. The frequency of injection could be lowered if a higher dosage was used. For example, 0.25 mg/kg three times weekly or 1 mg/kg once every 4 days was also sufficient to maintain optimal body weight for the ob/ob mice in our study. Furthermore, ob/ob mice injected daily with muFc–muLeptin for over 1 year were healthy and fertile, with decreased appetite, normalized blood glucose levels (as shown in Figure 7) and increased thermogenesis and locomotor activities. Although ob/ob mice are immunodeficient, it has been shown that the administration of exogenous leptin can restore immune function (Lord et al., 1998Go). In spite of this fact, the ob/ob mice receiving 0.5 mg/kg of huFc–huLeptin (Figure 5a) developed only low, non-neutralizing antibody titers against the human fusion proteins, even after more than 1 year of treatment (data not shown). This is also interesting in view of the finding that leptin has been shown to suppress Th2 cytokine production (Lord et al., 1998Go), a response generally thought to be essential for promoting antibody production (Mosmann and Coffman, 1989Go).



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 7.. Effect of muFc–muLeptin on blood glucose of ob/ob mice. The circulating blood glucose levels of ob/ob mice (two mice per group) receiving daily i.p. injections of 4 mg/kg for the first 3 days, then 0.25 mg/kg thereafter, of muFc–muLeptin (triangles) were compared with a control group receiving PBS (diamonds). Blood was drawn from a vein in the tail of each mouse and assayed for glucose levels using blood glucose test strips (Abbot Laboratories, Bedford, MA). Circulating blood glucose levels are expressed in mg per dl of mouse blood.

 
The efficacy of the huFc–huLeptin constructs in the groups of test mice was similar to that of the corresponding murine constructs. The huFc{gamma}2h–huLeptin construct, a candidate for clinical trials in humans, displays remarkable potency in vivo, inducing significant weight loss at doses two orders of magnitude lower than those required to obtain even a modest weight loss using recombinant leptin. The combination of this high potency, greatly extended serum half-life, lack of immunological effector activity and ease of recombinant production make huFc{gamma}2h–huLeptin a potentially promising lead for the development of pharmacologically superior forms of leptin. Fc–leptin was also shown to be able to rescue the fertility of both male and female ob/ob mice (results not shown). Male ob/ob mice housed with ob/ob females were able to produce litters of homozygous ob/ob pups as determined by PCR (data not shown) and females treated with Fc–leptin from an early enough age exhibited none of the sexual maturation problems associated with the ob/ob genotype and were even able to lactate and nurse their pups normally.

The frequent doses of leptin required for treatment appear to be a product of the intrinsic properties of the protein itself. With a molecular weight of 16 kDa, leptin is small enough to be cleared by renal filtration, hence a high dose is necessary to compensate for its reduced serum half-life. Fc–leptin, with a molecular weight of 96 kDa, exhibits a much longer serum half-life. For example, muFc–muLeptin has a circulating half-life of about 9 h in ob/ob mice, compared with 18 min for murine leptin. The circulating half-lives of the huFc–huLeptin constructs in mice are about 10 h and this is likely to be even longer in humans.

The dosage of leptin that can be administered in clinical trials is limited by its solubility. Attempts to improve the solubility of leptin have included the mutation of certain residues to aspartates or glutamates, thereby lowering the isoelectric point of leptin from 5.84 to below 5.5 (DiMarchi et al., 1998Go). The use of Fc as a fusion partner avoids the creation of such a leptin mutein, since the Fc domain is glycosylated and highly charged at neutral pH and hence acts as a carrier to solubilize leptin. As a result, Fc–leptin exhibits a much greater solubility than leptin.

It has been shown that leptin is able to enter the brain via a saturable transport process (Banks et al., 1996Go) where it is recognized by the biologically active, long-form leptin receptor (Ob-Rb) in the arcuate nucleus of the hypothalamus (Chen,G. et al., 1996Go) and from where it exerts its neuroendocrine effects on the regulation of appetite (Schwartz et al., 2000Go) and the storage of triglycerides (Cohen et al., 2002Go). Although it has not been directly shown that Fc–leptins are able to traverse the blood–brain barrier, it seems most likely that these molecules are able to gain access to the relevant areas of the hypothalamus in much the same manner as the normal, unfused leptin protein, based on the potent activity in vivo, of the Fc–leptin constructs described in this paper. Indeed, it is well established that the diffusion of even relatively large proteins into the hypothalamus from the circulation is facilitated by the proximity of the hypothalamus to the median eminence, an area of the brain outside the blood–brain barrier whose capillaries lack the tight junctions that are characteristic of the endothelial cells in the blood vessels of the brain (Gloor et al., 2001Go).

It is plausible that Fc–leptin may have a very favorable tissue distribution, especially in view of its long serum half-life and the high dose of soluble protein that can be administered. The successful treatment of non leptin-deficient mice with Fc–leptin raises some hope for the successful treatment of the non-leptin-deficient majority of obese humans with Fc–leptin, analogous to the insulin treatment of type II (insulin-resistant) diabetes. The data from subcutaneous injections in mice suggest that intramuscular injections in humans should be equally successful, while other routes of administration such as aerosols delivered nasally and gene therapy approaches (Chen,G. et al., 1996Go) could also be explored.


    Acknowledgments
 
The authors are grateful to R&D Systems (Minneapolis, MN) for their kind gift of the murine pro-B cell line BAF-3 that was used in the cell proliferation assays to measure the specific activities of the huFc–huLeptin. All photographic images were prepared for publication using the Gnu Image Manipulation Program (available at www.gnu.org).


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Banks,W.A., Kastin,A.J., Huang,W., Jaspan,J.B. and Maness,L.M. (1996) Peptides, 17, 305–311.[CrossRef][Web of Science][Medline]

Baumann,H., et al. (1996) Proc. Natl Acad. Sci. USA, 93, 8374–8378.[Abstract/Free Full Text]

Brann,D.W., Wade,M.F., Dhandapani,K.M., Mahesh,V.B. and Buchanan,C.D. (2002) Steroids, 67, 95–104.[CrossRef][Web of Science][Medline]

Bush,K.A., Farmer,K.M., Walker,J.S. and Kirkham,B.W. (2002) Arthritis Rheum., 46, 802–805.[CrossRef][Web of Science][Medline]

Chehab,F.F., Lim,M.E. and Lu,R. (1996) Nat. Genet., 12, 318–320.[CrossRef][Web of Science][Medline]

Chen,G., et al. (1996) Proc. Natl Acad. Sci. USA, 93, 14795–14799.[Abstract/Free Full Text]

Chen,H., et al. (1996) Cell, 84, 491–495.[CrossRef][Web of Science][Medline]

Christadoss,P. and Goluszko,E. (2002) J. Neuroimmunol., 122, 186–190.[CrossRef][Web of Science][Medline]

Cohen,P., et al. (2002) Science, 297, 240–243.[Abstract/Free Full Text]

Cole,M.S., Anasetti,C. and Tso,J.Y. (1997) J. Immunol., 159, 3613–3621.[Abstract]

Considine,R.V., et al. (1996) N. Engl. J. Med., 334, 292–295.[Abstract/Free Full Text]

DiMarchi,R.D., Hermeling,R.N. and Hoffmann,J.A. (1998) Anti-obesity proteins. US patent 5,7,19,266. EI: Lilly & Company.

Ducy,P., et al. (2000) Cell, 100, 197–207.[CrossRef][Web of Science][Medline]

Fawzi,A.B., Zhang,H. van Heek,M. and Graziano,M.P. (1996) Horm. Metab. Res., 28, 694–697.[Web of Science][Medline]

Friedman,J.M. and Halaas,J.L. (1998) Nature, 395, 763–770.[CrossRef][Medline]

Gainsford,T., et al. (1996) Proc. Natl Acad. Sci. USA, 93, 14564–14568.[Abstract/Free Full Text]

Ghilardi,N. and Skoda,R.C. (1997) Mol. Endocrinol., 11, 393–399.[Abstract/Free Full Text]

Ghilardi,N., Ziegler,S., Wiestner,A., Stoffel,R., Heim,M.H. and Skoda,R.C. (1996) Proc. Natl Acad. Sci. USA, 93, 6231–6235.[Abstract/Free Full Text]

Gillies,S.D., Lan,Y., Lo,K.M., Super,M. and Wesolowski,J. (1999) Cancer Res., 59, 2159–2166.[Abstract/Free Full Text]

Gloor,S.M., Wachtel,M., Bolliger,M.F., Ishihara,H., Landmann,R. and Frei,K. (2001) Brain Res. Brain Res. Rev., 36, 258–264.[CrossRef][Medline]

Green,E.D., et al. (1995) Genome Res., 5, 5–12.[Abstract/Free Full Text]

Halaas,J.L., et al. (1995) Science, 269, 543–546.[Abstract/Free Full Text]

Halaas,J.L., et al. (1997) Proc. Natl Acad. Sci. USA, 94, 8878–8883.[Abstract/Free Full Text]

Heymsfield,S.B., et al. (1999) JAMA, 282, 1568–1575.[Abstract/Free Full Text]

Ioffe,E., Moon,B., Connolly,E. and Friedman,J.M. (1998) Proc. Natl Acad. Sci. USA, 95, 11852–11857.[Abstract/Free Full Text]

Lee,G.H., et al. (1996) Nature, 379, 632–635.[CrossRef][Medline]

Lo,K.M., et al. (1998) Protein Eng., 11, 495–500.[Abstract/Free Full Text]

Lord,G.M., Matarese,G. Howard,J.K., Baker,R.J., Bloom,S.R. and Lechler,R.I. (1998) Nature, 394, 897–901.[CrossRef][Medline]

Marti,A., Marcos,A. and Martinez,J.A. (2001) Obesity Rev., 2, 131–140.

Moschos,S., Chan,J.L. and Mantzoros,C.S. (2002) Fertil. Steril., 77, 433–444.[CrossRef][Web of Science][Medline]

Mosmann,T.R. and Coffman,R.L. (1989) Annu. Rev. Immunol., 7, 145–173.[CrossRef][Web of Science][Medline]

Mounzih,K., Lu,R. and Chehab,F.F. (1997) Endocrinology, 138, 1190–1193.[Abstract/Free Full Text]

National Task Force on the Prevention and Treatment of Obesity (2000) Arch. Intern. Med. 160, 898–904.[Abstract/Free Full Text]

Pelleymounter,M.A., et al. (1995) Science, 269, 540–543.[Abstract/Free Full Text]

Ravetch,J.V. (1997) Curr. Opin. Immunol. 9, 121–125.[CrossRef][Web of Science][Medline]

Ring,B.D., et al. (2000) Endocrinology, 141, 446–449.[Abstract/Free Full Text]

Robinson,C.J., Gaines Das,R. and Woollacott,D. (2001) J. Mol. Endocrinol., 27, 69–76.[Abstract]

Schwartz,M.W., Woods,S.C., Porte,D. Jr., Seeley,R.J. and Baskin,D.G., (2000) Nature, 404, 661–671.[Medline]

Seufert,J., Kieffer,T.J. and Habener,J.F. (1999) Proc. Natl Acad. Sci. USA, 96, 674–679.[Abstract/Free Full Text]

Sierra-Honigmann,M.R., et al. (1998) Science, 281, 1683–1686.[Abstract/Free Full Text]

Spiegelman,B.M. and Flier,J.S. (1996) Cell, 87, 377–389.[CrossRef][Web of Science][Medline]

Tartaglia,L.A., et al. (1995) Cell, 83, 1263–1271.[CrossRef][Web of Science][Medline]

Thompson,D. and Wolf,A.M. (2001) Obesity Rev., 2, 189–197.

Unger,R.H, Zhou,Y.T. and Orci,L. (1999) Proc. Natl Acad. Sci. USA, 96, 2327–2332.[Abstract/Free Full Text]

Vaisse,C., et al. (1996) Nat. Genet., 14, 95–97.[CrossRef][Web of Science][Medline]

Weigle,D.S., et al. (1995) J. Clin. Invest., 96, 2065–2070.[Web of Science][Medline]

Zhang,Y., et al. (1994) Nature, 372, 425–432.[CrossRef][Medline]

Zhang,F., et al. (1997) Nature, 387, 206–209.[CrossRef][Medline]

Received April 7, 2004; revised November 12, 2004; accepted December 13, 2004.

Edited by Ian Tomlinson


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/1/1    most recent
gzh102v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lo, K.-M.
Right arrow Articles by Gillies, S. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lo, K.-M.
Right arrow Articles by Gillies, S. D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?