PEDS Advance Access originally published online on March 14, 2005
Protein Engineering Design and Selection 2005 18(1):25-31; doi:10.1093/protein/gzi007
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bioactive IL7-diphtheria fusion toxin secreted by mammalian cells
Harvard Skin Disease Research Center, Department of Dermatology, Brigham and Women's Hospital, Boston, MA 02115, USA
1 To whom correspondence should be addressed. E-mail: brich{at}rics.bwh.harvard.edu
| Abstract |
|---|
|
|
|---|
A number of targeted cytotoxic agents have been developed that selectively kill malignant or otherwise pathological cells. These engineered proteins consist of a potent cytotoxic element connected to a ligand domain that binds to specific molecules on the surface of the target cell. Several of these agents have shown promise in clinical trials and one is currently administered to patients. A significant technical obstacle that has impeded the development of some of these toxins is the difficulty of preparing certain recombinant proteins in properly folded forms. These fusion proteins have generally been produced in bacteria requiring them to be denatured and renatured in vitro. For some proteins this is an efficient process whereas for others it is not. We describe here a system to produce fusion toxins rapidly and efficiently by engineering mammalian cells to secrete them as properly folded molecules which can be purified in native form from cell culture medium. We have used this system to produce highly active preparations of DAB389-IL7, a molecule consisting of the catalytic and transmembrane domains of diphtheria toxin fused to interleukin 7. This system is generalizable and can be used to produce and evaluate rapidly fusion toxins incorporating novel or uncharacterized ligands.
Keywords: diphtheria toxin/fusion protein/interleukin-7/leukemia/lymphoma
| Introduction |
|---|
|
|
|---|
Molecules on the surface of cells can be exploited as targets for selective cytotoxic agents. Cytokine fusion toxins are among a number of types of pharmacological agents that are directed against cell surface receptors. These engineered proteins consist of a highly toxic domain connected to a ligand domain that is specific for a molecule on the surface of the target cell (Pastan, 1997
One such toxin that has been created is DAB389-IL7 (Sweeney et al., 1998
). Bacterially produced DAB389-IL7 was highly toxic to an IL7-dependent cell line while exhibiting no effects on a cell line lacking the cognate receptor. The IL-7 receptor, which consists of the IL7R
chain (IL7R, CD127) and the common
chain (
c, CD132), is normally expressed most prominently by immature lymphocytes and mature T cells. When engaged by IL-7, the receptor activates JAK3 kinase, which transmits a potent mitogenic and anti-apoptotic signal. Forced autocrine expression of IL-7 in transgenic mice causes inflammatory disorders and hematopoietic malignancies (Fisher et al., 1993
; Rich et al., 1993
) and persistent IL-7 signaling has been implicated in a number of human hematopoietic malignancies including cutaneous T cell lymphomas (CTCL) (Dalloul et al., 1992
; Foss et al., 1994
; Bagot et al., 1996
), acute T cell leukemias (Barata et al., 2001
; Baba et al., 2002
), chronic (Frishman et al., 1993
; Plate et al., 1993
; Long et al., 1995
) and acute B cell malignancies (Pontvert-Delucq et al., 1996
; De Waele et al., 2001
; Kebelmann-Betzing et al., 2001
), Burkitt's lymphoma, (Benjamin et al., 1994
) and Hodgkin's disease (Foss et al., 1995
). There are also indications that IL-7 signaling may play a role in melanoma (Mattei et al., 1994
) and certain epithelial cell tumors (Al-Rawi et al., 2003
). Therefore, it is likely that an effective toxin directed against cells expressing the IL7 receptor will be useful for the treatment of certain human diseases.
The DT and pseudomonas exotoxin A molecules have been studied extensively and the mechanisms of their action have been described in detail [reviewed in Murphy and van der Spek (1995)
and Collier (2001)
]. These molecules each have cell-binding, transmembrane and catalytic domains in different configurations. The cell-binding domain of DT engages the cellular heparin binding epidermal growth factor receptor (Naglich et al., 1992
) and the toxin is taken into the cell by endocytosis. Endosomal proteases including furin (Gordon et al., 1995
) cleave a loop of the toxin, leaving the catalytic domain held to the translocation domain by disulfide bonds. The acidic environment within the endosome causes a conformational change in the translocation domain resulting in the translocation of the catalytic domain through the vesicular membrane where it is released into the cytosol. Within the cytosol the catalytic domain inactivates elongation factor 2 (EF-2) by catalyzing ADP-ribosylation of the diphthamide structure. This modification of EF-2 is essentially irreversible. In the absence of functional EF-2, protein synthesis is blocked and the cell dies. The presence of a single molecule of the enzymatic domain of the toxin in the cytoplasm has been shown to be sufficient to kill a cell (Yamaizumi et al., 1978
).
Most fusion toxins that have been created have been expressed at high levels in bacteria and purified from inclusion bodies, necessitating their denaturation and renaturation. Although this approach has been successful for many fusion toxins, some molecules have proved difficult to fold properly. Since eukaryotic cells have more extensive specialized secretory mechanisms than bacteria, we sought to develop a system in which fusion toxins could be efficiently produced in mammalian cells and released in an active folded form. Proteins secreted via the classical secretory pathway of eukaryotic cells are folded as they enter the endoplasmic reticulum and are ultimately transported to the surface of the cell in their native form (Mellman and Warren, 2000
). Folding is an active process that involves a number of factors. Although some proteins are released by other non-classical pathways and certain improperly folded proteins may be released from cells (Tanudji et al., 2002
), there is significant evidence that most improperly folded proteins are prevented from leaving cells and are ultimately degraded (Ellgaard et al., 1999
). Therefore, proteins secreted by eukaryotic cells are more likely to be optimally folded and highly active.
Several types of mutations have been identified which confer varying levels of DT-resistance to mammalian cells. Mutations with intermediate levels of resistance cause reduced uptake or processing of the toxin; however, one class of mutations is unique in that they convey absolute resistance to DT. These mutations alter the structure of EF-2 and they prevent the post-translational addition of the diphthamide structure (Gupta and Siminovitch, 1978
; Kohno and Uchida, 1987
; Foley et al., 1992
, 1995
). Chinese hamster ovary (CHO) cells bearing such mutations are highly resistant to DT and ETA and remain fairly viable even when homozygous for the mutation. Yeast homozygous for similar EF-2 mutations are fully viable but have been reported to be somewhat temperature sensitive (Kimata and Kohno, 1994
).
Previously investigators have expressed DT-containing fusion toxins in DT-resistant Saccharomyces cerevisiae (Perentesis et al., 1988
). A highly active DT-containing fusion immunotoxin has been produced in DT-sensitive (Woo et al., 2002
) and resistant (Liu et al., 2003
) Pichia pastoris in addition to DT-resistant mutant CHO cells (Liu et al., 2000
). Remarkably, a DT-containing fusion toxin targeted against the GM-CSF receptor was produced in insect cells infected with a baculovirus vector (Williams et al., 1998
), even though similar cells engineered to express a mammalian DT receptor were highly sensitive to exogenous DT (Valdizan et al., 1995
).
In this study, DT-resistant variants of a readily transfectable human embryonic kidney cell line were isolated and engineered to secrete a highly active fusion toxin incorporating IL-7 and DT (DAB389-IL7). This method will facilitate the production of highly active preparations of this toxin for further evaluation and may also expedite the development of toxins with novel ligand domains.
| Materials and methods |
|---|
|
|
|---|
DNA manipulations
Sequences encoding the various parts of the fusion protein were amplified by PCR from synthetic oligonucleotides or plasmids containing the corresponding cDNAs. Primers used for this were designed to maintain a continuous reading frame and incorporate unique restriction enzyme sites between segments. Pfu Ultra enzyme (Stratagene) was used according to the manufacturer's recommendations. Amplified fragments were cut with appropriate enzymes and serially ligated into pEGFPN1 plasmid (Clontech) to generate the expression construct as shown in Figure 1. The segment encoding the murine immunoglobulin-kappa (Ig
) signal peptide (SIG) was synthesized as two complementary oligonucleotides: GCTAGCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTGTGGGTTCCAGGTTCCACTGGTGACAGATCT and its exact complement, which were hybridized together without amplification. The segment consisting of codons 1389 of DT (DAB389) was amplified from plasmid pJV127 (van der Spek et al., 1993
) with primers AAGCTTATGGGCGCTGATGATGTTGTTG and CTGCAGATGCGTCTTGTGACCCGGAGA. The segment encoding murine IL-7 was amplified from plasmid pIg17 (Rich et al., 1993
) with primers GTCGACGATGTTCCATGTTTCTTTTAGA and GGATCCCGTATACTGCCCTTCAAAATT.
|
Cell culture
293T cells and derivatives were maintained in DMEM (Gibco) supplemented with 10% fetal bovine serum (Sigma), glutamine and penicillinstreptavidin (Gibco). U937, KG-1a and Jurkat cells were cultivated in RPMI 1640 medium (Gibco) supplemented with 10% fetal bovine serum (Sigma) and penicillinstreptavidin (Gibco). Cells were incubated at 37°C in 5% CO2 at 100% humidity. Supplement-free DMEM media were obtained from Specialty Media. Plasmids were introduced into cells using PolyFect transfection reagent (Qiagen).
DT-resistant 293T cells
Proliferating 293T cells were subjected to mutagenesis by culturing overnight in the presence of 400 µg/ml of ethyl methanesulfonate (Sigma), rinsing with PBS and then selecting in the presence of 10 ng/ml DT (Sigma). Surviving clones were picked by hand as small colonies and were then screened for resistance to 1 µg/ml DT. Surviving clones were designated with the suffix D and a number (e.g. 293TD3).
Flow cytometry
293T and 293TD3 cells were suspended by digestion with trypsin 72 h after transfection and transferred into PBS with 2 mM EDTA. KG-1a, Jurkat and U937 cells were stained with a phycoerythrin-conjugated monoclonal mouse anti-human IL7R antibody (Pharmingen). A FACScan fluorescent flow cytometry machine and CellQuest software (Becton-Dickenson) were used for data collection and processing.
Expression and partial purification of fusion protein
293D3 cells were transfected with the pSIG-DAB-IL7-EGFP expression plasmid and cultured for 72 h in DMEM with 2% FBS. Culture supernatant was collected and passed through a 0.45 mm filter (Millipore). Cleared medium was diluted 2-fold with 20 mM TrisHCl, pH 7.5 and applied to a HighQ column (Bio-Rad) using the BioLogic LP chromatography system (Bio-Rad) at a flow rate of 3 ml/min at 4°C. Absorbed proteins were separated by elution with a gradient of NaCl from 0 to 0.5 M. Collected eluate fractions were tested for activity using the whole cell protein synthesis inhibition assay. Fractions which showed activity in the assay were pooled and concentrated using Apollo centrifugation concentration devices with a membrane cutoff at 10 kDa (Orbital Bioscience).
Western blots
Samples of protein preparations and dilutions of reference preparations of human IL-7 (National Cancer Institute, Biological Resources Branch Preclinical Repository, Frederick, MD), DT (Sigma) and Ontak (Ligand Pharmaceuticals) were resolved by electrophoresis for 1.5 h at 180 V on 420% gradient SDSPAGE gels (Cambrex) and electroblotted to an Immobilon P membrane (Millipore) for 2 h at 25 V at room temperature in a Trisglycinemethanol buffer system. Membranes were blocked in 5% milk in PBST (PBS+0.5% Tween-20) for 30 min and subsequently incubated with primary antibodies in 5% milk in PBST overnight at 4°C. Polyclonal rabbit anti-IL7 antibodies (Cedar Lane Laboratories) were used at a 1:2000 dilution. Monoclonal anti-DT antibody (clone 7F2, Research Diagnostics) was used at 720 ng/ml. Membranes were then washed at least four times with PBST and incubated with horseradish peroxidase-conjugated goat anti-mouse or goat anti-rabbit antibodies (BD Biosciences, 1:50 000) for 1 h. After that the membrane was washed again at least five times and incubated with chemiluminescent substrate (Pierce West Pico chemiluminescent substrate). The chemiluminescent signal was detected using Blue Sensitive Autoradiographic Film (Marsh Bioproducts).
Quantitative western blots
Fusion protein concentrations were determined by comparison with standardized reference preparations of IL7 in quantitative western blots. After SDSPAGE and transfer as above, membranes were blocked with Odyssey Blocking Buffer (LiCOR) and then incubated with polyclonal rabbit anti-IL7 antibodies as above, washed and then incubated with goat anti-rabbit IgG-Cy5.5 (LiCOR) according to the manufacturer's recommendations. Fluorescent images of the membranes were acquired with an Odyssey Imager (LiCOR) and quantified using software supplied with the system.
Whole cell protein synthesis assay
Rapidly growing cells were cultured in the presence of serial 1:3 dilutions of the toxin or control preparations to be assayed in flat-bottomed 96-well plates (Falcon 3072). A total of 10 00050 000 cells were plated in 0.1 ml of fresh medium in each well. After 48 h of incubation, 50 µl of serum-free, amino acid-free DMEM containing 0.51 µCi [3H]leucine were added to each well. Cells were incubated for an additional 4 h and then harvested by filtration (Tomtec cell harvester) on to glass fiber filters (Wallac) in PBS or isotonic saline solution (0.15 M NaCl). The filters were dried in a microwave oven for 5 min and sealed in a plastic bag with scintillation fluid (BetaPlate Scint, Wallac). Incorporation of [3H]leucine was measured by scintillation counting (MicroBeta counter, Wallac). The mean counts per minute of triplicate or quadruplicate parallel assays were normalized and presented as a percentage relative to cultures with no toxin added. IC50 values and best-fit curves were calculated using Prism statistical software (GraphPad).
Antibody neutralization assay
Fusion toxin preparations were preincubated with polyclonal rabbit anti-IL7 or control antibodies (Cedar Lane Laboratories) in 20 µl of culture medium. After 30 min at 37°C, 100 ml of cells were added to the wells and the whole cell protein synthesis assay was carried out as described above.
| Results |
|---|
|
|
|---|
An expression construct encoding secreted DAB389-IL7-EGFP
A cDNA encoding a fusion toxin was assembled into a plasmid suitable for transient expression studies. As shown in Figure 1, this plasmid contains a continuous open reading frame consisting of sequences encoding a signal peptide from murine Ig
, DAB389, murine IL7 and EGFP flanked by a CMV promoter and an SV40-derived polyadenylation signal suitable for efficient transient expression. The signal peptide sequence was included to enable the fusion toxin to be secreted. DAB389 and IL7 constitute the toxin and targeting ligand, respectively. EGFP was included to facilitate tracking of the protein. The plasmid backbone (derived from pEGFPN1, Clontech) also incorporates the SV40 origin of replication to enhance expression in cells that also express the SV40 T antigen.
DT-resistant 293T cells
Numerous schemes have been developed to express bioactive proteins in mammalian cells and various different cell lines are more or less suitable for these. The human embryonic kidney cell line 293 transfected with the SV40 T antigen (293T) (DuBridge et al., 1987
) is particularly suited for transient expression assays because it is readily transfected at high efficiency and the SV40 T antigen replicates plasmids containing the SV40 origin (see above). Therefore, this cell line was subjected to mutagenesis and clones highly resistant to DT were isolated.
293T cells and a DT-resistant clone, 293TD3, were transfected with pSIG-DAB-IL7-EGFP (see Figure 1) in addition to the parental plasmid pEGFPN1 that does not encode the enzymatic domain of DT. After 48 h, the cells were suspended by trypsin digestion and green fluorescence was measured by flow cytometry. Figure 2 depicts histogram plots of the relative numbers of cells exhibiting various levels of fluorescence. Both cell lines transfected with pEGFPN1 exhibit very strong fluorescence relative to untransfected cells. 293TD3 cells transfected with pSIG-DAB-IL7-EGFP show a prominent population of fluorescent cells whereas 293T cells transfected with the same plasmid are reduced in numbers (not shown) and fail to exhibit any increase in fluorescence. Hence 293TD3 cells are able to synthesize the fusion toxin and accumulate enough EGFP to be detectable by flow cytometry. The 293T cells transfected in parallel appear to have become rapidly intoxicated and were unable to synthesize detectable amounts of EGFP. The number of 293TD3 cells transfected with pSIG-DAB-IL7-EGFP that express green fluorescence and their levels of fluorescence are lower than those transfected with pEGFPN1. This is likely to reflect the efficient translation and cytoplasmic accumulation of EGFP in contrast to less efficient translation of the bacterially derived DAB389 portion of the fusion protein cDNA and secretion of the fusion toxin. In summary, the DT-resistant 293TD3 cells appear to be capable of synthesizing significant quantities of fusion toxin containing the enzymatic domain of DT.
|
The specific mutations responsible for conveying immunity to DT in 293TD3 and related cell lines have not been characterized, but they are likely to alter the sequence of EF-2, thereby preventing the addition of the dipthamide group (Foley et al., 1995
Fusion toxin secreted by DT-resistant 293T cells
The plasmid pSIG-DAB-IL7-EGFP shown in Figure 1, encoding the signal peptide, DAB389, IL7 and EGFP was transfected into several plates of 293TD3 cells. After transfection, the cells were transferred to serum-free medium and incubated for 2 days. The culture supernatant was collected and proteins were fractionated by anion-exchange chromatography in a gradient of NaCl from 0 to 0.5 M as shown in Figure 3. Fractions were collected and assayed for western blot reactivity with anti-IL7 polyclonal antibodies, fluorescence and bioactivity in the whole cell protein synthesis assay (see below). Bioactivity was detected in several fractions eluting just after the bulk of material. These fractions were pooled and analyzed by western blots using polyclonal anti-IL7 antibodies or a monoclonal anti-DT antibody (see Figure 4). Although it was difficult to visualize in cell culture medium, a protein of approximately the predicted molecular weight of 88 000 was readily detected in the partially purified preparations by either anti-IL7 or anti-DT antibodies. This protein was quantitated by comparison with reference preparations of IL-7 using the Odyssey Imager (LiCOR, data not shown). The culture medium contained up to 100 ng/ml of this fusion protein. Fractions containing this immunoreactive protein displayed green fluorescence (not shown) and were further assayed for cytotoxic activity specific for cells expressing the IL7R (see below).
|
|
|
Sensitivity of cells to DAB-IL7-EGFP toxin correlates with IL7R expression
To evaluate the bioactivity of the DAB-IL7-EGFP toxin, three cell lines derived from human hematopoietic malignancies were evaluated for expression of the IL7R and sensitivity to the toxin. KG-1a is an undifferentiated variant of an established acute myelogenous leukemia cell line (Koeffler et al., 1980
), Jurkat is a cell line derived from a T cell leukemia (Gillis and Watson, 1980
) and U-937 is a cell line derived from a histiocytic lymphoma (Sundstrom and Nilsson, 1976
). Figure 5A shows immunofluorescent flow cytometry of each of these cell lines stained with an anti-IL7R antibody. Prominent expression of the IL-7R is found on the lymphoid U-937 cells whereas a lower level is detected on the Jurkat cells. Minimal expression was detected on the myeloid KG-1a line.
Previously, inhibition of protein synthesis has been measured by dissolving [3H]leucine-labeled cells in KOH, precipitating macromolecules with trichloroacetic acid (TCA), collecting the precipitates by filtration and counting scintillation (Sweeney et al., 1998
). In the whole-cell protein synthesis assay, cells cultured in 96-well plates are pulse-labeled with [3H]leucine and harvested by filtration in isotonic conditions. The cells captured in the glass-fiber filters are dried and counted by scintillation. This modification of the standard assay eliminates the use of hazardous chemicals (KOH and TCA) and significantly reduces the manipulations involved, minimizing the risk of contamination and greatly reducing the variability of the assay. Figure 5B presents results of representative whole cell protein synthesis assays using KG-1a, Jurkat and U-937 cells and various concentrations of a DAB389-IL7-EGFP toxin preparation. The concentration at which the toxin inhibits 50% of protein synthesis (IC50) of U-937 cells is 1.5 x 1012 M, whereas the IC50 for Jurkat cells is 5.6 x 1012 M and for KG-1a cells it is 4.9 x 1011 M.
Anti-IL7 antibodies diminish activity of the fusion toxin
Since some polyclonal anti-IL7 antibodies should bind to the IL-7 component of the fusion protein and compete with the IL-7R, we examined their effect on the toxicity of the fusion protein. Figure 6 shows an experiment in which the action of the fusion toxin on Jurkat cells was inhibited by polyclonal anti-IL7R antibodies. When 1010 M (
18 times the IC50) of the fusion toxin was added to the cells, protein synthesis was completely blocked. When the toxin was incubated with 50 µg/ml polyclonal anti-IL7 antibodies prior to addition to the cultures, protein synthesis was restored to
35% of the level of the untreated cultures.
|
| Discussion |
|---|
|
|
|---|
A number of different cytotoxic agents have been developed in which various toxins are selectively targeted to specific cell surface receptors. These fusion toxins are highly selective for cells that express the target receptors and some of them have proved to be clinically effective in controlling certain malignant or inflammatory diseases. To date, production of most active fusion toxins has required significant manipulation of one or more polypeptide chains. We have developed a method for rapidly generating biologically active fusion toxins that does not require renaturation to become active.
For many recombinant fusion toxins, it is most expedient and economical to produce them in bacteria. However, for certain toxins and applications the method described here offers significant advantages. Some fusion toxins are inherently more difficult to refold into biologically active molecules. This is most likely due to interactions between polypeptide sequences of the toxin and ligand domains in their unfolded states. Fusion toxins secreted by mammalian cells are folded in an ordered process and it is likely that the toxin and ligand domains will only be able to interact after they have adopted stable tertiary conformations. Therefore, toxins that are poorly suited to renaturation may be more efficiently produced in mammalian cells. Although it is difficult to compare the present results with previously published data obtained with a different cell line (Sweeney et al., 1998
), the specific activity of DAB389-IL7 secreted by human cells appears to be comparable to or higher than that of the previously described bacterial preparation.
The system described here could also be used to streamline the characterization of novel toxins. Preliminary studies demonstrated that toxin activity could be detected by direct functional assay of the culture supernatant of transfected cells (data not shown). This could make it possible to develop a method for high-throughput screening of novel fusion toxins.
Although glycosylation is not essential for the activity of fusion toxins, carbohydrate structures can affect their pharmacological characteristics. While existing sequence motifs in the fusion toxins may become glycosylated, recent advances have demonstrated that the introduction of glycosylation sites can greatly increase the in vivo activity of recombinant molecules (Elliott et al., 2003
). However, there is also evidence that certain glycosylations can inhibit the action of fusion toxins (Liu et al., 2000
). Expression of fusion toxins in mammalian cells will make it possible to produce and evaluate various glycosylated forms.
As discussed above, the IL-7R is likely to be expressed by several different types of malignant cells and may be a clinically useful target for a selective toxin. This method will permit the production of sufficient quantities of DAB389-IL7 to evaluate its potency on malignant patient cells and its effects in mice with transgenic pathology or transplanted tumors involving the IL-7R. These studies may ultimately lead to the development of DAB389-IL7 as a valuable therapeutic agent.
| Acknowledgments |
|---|
The authors thank L.Liu for assistance with flow cytometry and A.Boutanev for help with chromatography. This work was supported by grants from the Leukemia and Lymphoma Society and the Dermatology Foundation.
| References |
|---|
|
|
|---|
Al-Rawi,M.A., Mansel,R.E. and Jiang,W.G. (2003) Histol. Histopathol., 18, 911923.[ISI][Medline]
Baba,H. et al. (2002) Eur. J. Haematol., 68, 362369.[CrossRef][ISI][Medline]
Bagot,M., Charue,D., Boulland,M.L., Gaulard,P., Revuz,J., Schmitt,C. and Wechsler,J. (1996) Br. J. Dermatol., 135, 572575.[CrossRef][ISI][Medline]
Barata,J.T., Cardoso,A.A., Nadler,L.M. and Boussiotis,V.A. (2001) Blood, 98, 152431.
Benjamin,D., Sharma,V., Knobloch,T.J., Armitage,R.J., Dayton,M.A. and Goodwin,R.G. (1994) J. Immunol., 152, 47494757.[Abstract]
Collier,R.J. (2001) Toxicon, 39, 17931803.[Medline]
Dalloul,A., Laroche,L., Bagot,M., Mossalayi,M.D., Fourcade,C., Thacker,D.J., Hogge,D.E., Merle-Beral,H., Debre,P. and Schmitt,C. (1992) J. Clin. Invest., 90, 10541060.[ISI][Medline]
De Waele,M., Renmans,W., Vander Gucht,K., Jochmans,K., Schots,R., Otten,J., Trullemans,F., Lacor,P. and Van Riet,I. (2001) Eur. J. Haematol., 66, 178187.[CrossRef][ISI][Medline]
DuBridge,R.B., Tang,P., Hsia,H.C., Leong,P.M., Miller,J.H. and Calos,M.P. (1987) Mol. Cell. Biol., 7, 379387.
Duvic,M., Cather,J., Maize,J. and Frankel,A.E. (1998) Am. J. Hematol., 58, 8790.[CrossRef][ISI][Medline]
Ellgaard,L., Molinari,M. and Helenius,A. (1999) Science, 286, 18821888.
Elliott,S. et al. (2003) Nat. Biotechnol., 21, 414421.[CrossRef][ISI][Medline]
Fisher,A.G., Burdet,C., LeMeur,M., Haasner,D., Gerber,P. and Ceredig,R. (1993) Leukemia, 7, Suppl 2, S66S68.
Foley,B.T., Moehring,J.M. and Moehring,T.J. (1992) Somat. Cell. Mol. Genet., 18, 227231.[CrossRef][ISI][Medline]
Foley,B.T., Moehring,J.M. and Moehring,T.J. (1995) J. Biol. Chem., 270, 2321823225.
Foss,F.M. (2001) Ann. N. Y. Acad. Sci., 941, 166176.
Foss,F.M., Koc,Y., Stetler-Stevenson,M.A., Nguyen,D.T., O'Brien,M.C., Turner,R. and Sausville,E.A. (1994) J. Clin. Oncol., 12, 326335.[Abstract]
Foss,F.M., Saleh,M.N., Krueger,J.G., Nichols,J.C. and Murphy,J.R. (1998) Curr. Top. Microbiol. Immunol., 234, 6381.[ISI][Medline]
Foss,H.D., Hummel,M., Gottstein,S., Ziemann,K., Falini,B., Herbst,H. and Stein,H. (1995) Am. J. Pathol., 146, 3339.[Abstract]
Frankel,A.E., Fleming,D.R., Powell,B.L. and Gartenhaus,R. (2003) Expert Opin. Biol. Ther., 3, 179186.[ISI][Medline]
Frankel,A.E., Neville,D.M., Bugge,T.A., Kreitman,R.J. and Leppla,S.H. (2003) Semin. Oncol., 30, 545557.[CrossRef][ISI][Medline]
Frishman,J., Long,B., Knospe,W., Gregory,S. and Plate,J. (1993) J. Exp. Med., 177, 955964.
Gillis,S. and Watson,J. (1980) J. Exp. Med., 152, 17091719.
Gordon,V.M., Klimpel,K.R., Arora,N., Henderson,M.A. and Leppla,S.H. (1995) Infect. Immun., 63, 8287.[Abstract]
Gottlieb,S.L., Gilleaudeau,P., Johnson,R., Estes,L., Woodworth,T.G., Gottlieb,A.B. and Krueger,J.G. (1995) Nat. Med., 1, 442447.[CrossRef][ISI][Medline]
Gupta,R.S. and Siminovitch,L. (1978) Somat. Cell. Genet., 4, 553571.
Kebelmann-Betzing,C. et al. (2001) Cytokine, 13, 3950.[CrossRef][ISI][Medline]
Kimata,Y. and Kohno,K. (1994) J. Biol. Chem., 269, 1349713501.
Koeffler,H.P., Billing,R., Lusis,A.J., Sparkes,R. and Golde,D.W. (1980) Blood, 56, 265273.
Kohno,K. and Uchida,T. (1987) J. Biol. Chem., 262, 1229812305.
Liu,Y.Y., Gordienko,I., Mathias,A., Ma,S., Thompson,J., Woo,J.H. and Neville,D.M.,Jr (2000) Protein Expr. Purif., 19, 304311.[CrossRef][ISI][Medline]
Liu,Y.Y., Woo,J.H. and Neville,D.M. (2003) Protein Expr. Purif., 30, 262274.[CrossRef][ISI][Medline]
Long,B.W., Witte,P.L., Abraham,G.N., Gregory,S.A. and Plate,J.M. (1995) Proc. Natl Acad. Sci. USA, 92, 14161420.
Martin,A., Gutierrez,E., Muglia,J., McDonald,C.J., Guzzo,C., Gottlieb,A., Pappert,A., Garland,W.T., Bagel,J. and Bacha,P. (2001) J. Am. Acad. Dermatol., 45, 871881.[CrossRef][ISI][Medline]
Mattei,S., Colombo,M.P., Melani,C., Silvani,A., Parmiani,G. and Herlyn,M. (1994) Int. J. Cancer, 56, 853857.[ISI][Medline]
Mellman,I. and Warren,G. (2000) Cell, 100, 99112.[CrossRef][ISI][Medline]
Murphy,J.R. and van der Spek,J.C. (1995) Semin. Cancer Biol., 6, 259267.[CrossRef][ISI][Medline]
Naglich,J.G., Metherall,J.E., Russell,D.W. and Eidels,L. (1992) Cell, 69, 105161.[CrossRef][ISI][Medline]
Olsen,E. et al. (2001) J. Clin. Oncol., 19, 376388.
Pastan,I. (1997) Biochim. Biophys. Acta, 1333, C1C6.[Medline]
Perentesis,J.P., Genbauffe,F.S., Veldman,S.A., Galeotti,C.L., Livingston,D.M., Bodley,J.W. and Murphy,J.R. (1988) Proc. Natl Acad. Sci. USA, 85, 83868390.
Plate,J.M., Knospe,W.H., Harris,J.E. and Gregory,S.A. (1993) Hum. Immunol., 36, 249258.[CrossRef][ISI][Medline]
Pontvert-Delucq,S., Hibner,U., Vilmer,E., Baillou,C., Rohrlich,P., Heymann,D., Najman,A., Guigon,M. and Lemoine,F.M. (1996) Leuk. Lymphoma, 21, 267280.[ISI][Medline]
Rich,B.E., Campos-Torres,J., Tepper,R.I., Moreadith,R.W. and Leder,P. (1993) J. Exp. Med., 177, 305316.
Sundstrom,C. and Nilsson,K. (1976) Int. J. Cancer, 17, 565577.[ISI][Medline]
Sweeney,E.B., Foss,F.M., Murphy,J.R. and van der Spek,J.C. (1998) Bioconj. Chem., 9, 201207.[CrossRef][ISI][Medline]
Tanudji,M., Hevi,S. and Chuck,S.L. (2002) J. Cell Sci., 115, 38493857.
Valdizan,E.M., Loukianov,E.V. and Olsnes,S. (1995) J. Biol. Chem., 270, 1687916885.
van der Spek,J.C., Mindell,J.A., Finkelstein,A. and Murphy,J.R. (1993) J. Biol. Chem., 268, 1207712082.
Williams,D.P., Parker,K., Bacha,P., Bishai,W., Borowski,M., Genbauffe,F., Strom,T.B. and Murphy,J.R. (1987) Protein Eng., 1, 493498.
Williams,M.D., Rostovtsev,A., Narla,R.K. and Uckun,F.M. (1998) Protein Expr. Purif., 13, 210221.[CrossRef][ISI][Medline]
Woo,J.H., Liu,Y.Y., Mathias,A., Stavrou,S., Wang,Z., Thompson,J. and Neville,D.M.,Jr (2002) Protein Expr. Purif., 25, 270282.[CrossRef][ISI][Medline]
Yamaizumi,M., Mekada,E., Uchida,T. and Okada,Y. (1978) Cell, 15, 245250.[CrossRef][ISI][Medline]
Received September 14, 2004; revised January 21, 2005; accepted February 6, 2005.
Edited by Andreas Kungl
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





