PEDS Advance Access originally published online on September 26, 2005
Protein Engineering Design and Selection 2005 18(11):537-546; doi:10.1093/protein/gzi058
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Isolation of novel single-chain Cro proteins targeted for binding to the bcl-2 transcription initiation site by repertoire selection and subunit combinatorics
1Department of Biochemistry, Uppsala University, Biomedical Center, Box 576, SE-751 23 Uppsala, Sweden 2Present address: Swedish Institute for Infectious Disease Control, SE-171 82 Solna, Sweden 4Present address: Developmental Genetics, Groningen Biomolecular Sciences and Biotechnology Institute, University of Groningen, Kerklaan 30, 9751 NN Haren, The Netherlands 5Present address: BioDesign InstituteBON Center, Main Arizona State University, 1001 S. McAllister Avenue, Tempe, AZ 85287-5201, USA
6 To whom correspondence should be addressed. E-mail: mikael.widersten{at}biokemi.uu.se
| Abstract |
|---|
|
|
|---|
New designed DNA-binding proteins may be recruited to act as transcriptional regulators and could provide new therapeutic agents in the treatment of genetic disorders such as cancer. We have isolated tailored DNA-binding proteins selected for affinity to a region spanning the transcription initiation site of the human bcl-2 gene. The proteins were derived from a single-chain derivative of the lambda Cro protein (scCro), randomly mutated in its recognition helices to construct libraries of protein variants of distinct DNA-binding properties. By phage display-afforded affinity selections combined with recombination of shuffled subunits, protein variants were isolated, which displayed high affinity for the target bcl-2 sequence, as determined by electrophoretic mobility shift and biosensor assays. The proteins analyzed were moderately sequence-specific but provide a starting point for further maturation of desired function.
Keywords: phage display/proteinDNA interactions/repressor/single-chain Cro/subunit shuffling
| Introduction |
|---|
|
|
|---|
Variations of a cell's phenotype are largely due to differences in the expression of genes coding for proteins, with the vast majority of regulatory events occuring at the level of transcription (Villard, 2004
The ability to wilfully manipulate gene expression by the introduction of engineered transcription factors would provide tremendous possibilities for applications in gene therapy (Segal and Barbas, 2001
). A distinct advantage of an approach based on designed transcription is that both gene repression and activation can be orchestrated in trans (Beerli and Barbas, 2002
). Therefore, gene regulation by using artificial transcription factors appears to be a viable alternative to antisense RNA approaches in the regulation of human disease related genes (Wu et al., 1995
). One approach to down-regulate gene repression is by targeting designed DNA-binding proteins to recognize and bind sequences in the immediate vicinity of the transcription initiation site and, hence, interfering with the assembly of the transcription machinery. An overall aim being the generation of transcription factors that can be directly involved in gene therapy of genetic disorders, such as cancer. Results obtained using engineered Cys2His2 zinc finger domain proteins have been promising: repertoire selections of novel zinc finger proteins have facilitated the isolation of designed proteins acting as specific repressors of endogenous gene expression of proto-oncogenes erbB-2 and erbB-3 (Beerli et al., 2000) or the checkpoint kinase 2 gene (Tan et al., 2003
).
To date, most designed transcription factors have been constructed from zinc finger proteins as molecular scaffolds. We have, however, constructed an expression system for the functional selection of tailored helixturnhelix proteins. The selection system is based on a single-chain derivative of the Cro repressor (scCro) of bacteriophage lambda (Jana et al., 1998
). This scCro protein is amenable to mutagenesis in amino acid residues involved in DNA recognition, and variants possessing novel DNA-binding properties can be isolated by phage display-afforded selection (Nilsson et al., 2000
; Nilsson and Widersten, 2004
). Such redesigned scCro proteins may be assigned roles as transcriptional regulators.
Overexpression of the B-cell lymphoma protein 2 (Bcl-2) is common in various types of cancer, including prostate (Krajewska et al., 1996
), gastric (Ayhan et al., 1994
), renal (Gobe et al., 2002
), non-Hodgkin's lymphoma (Kondo et al., 1994
) and both acute and chronic leukemia (Zaja et al., 1998
). There are also indications that Bcl-2 overexpression renders tumors more resistant to chemotherapeutical drugs (Pepper et al., 1998
; Buchholz et al., 2003
; Mariott et al., 2003). It has been proposed that functional blockade of the anti-apoptic Bcl-2 family members could be a possible route to restore the apoptic machinery in tumor cells (Kirkin et al., 2004
). Hence, to complement earlier tested approaches, primarily relying on antisense RNA (Webb et al., 1997
; Jansen et al., 1998
; Jansen and Zangenmeister-Wittke, 2003
), an attractive goal would be the generation of a transcription factor targeted to bcl-2 in order to suppress gene expression already at the transcription level.
In this work, novel designed proteins targeted to act as repressors have been isolated by phage display selection towards a DNA sequence spanning the transcription start site of the human bcl-2 gene. The affinity selections were combined with combinatorial shuffling of protein subunits to increase the diversity of DNA-binding variants. The isolated proteins were overexpressed and analyzed for their DNA-binding properties. The influence of intrinsic bendability of target DNA sequences on proteinDNA complex formation is also discussed.
| Materials and methods |
|---|
|
|
|---|
Strains
Escherichia coli XL1-Blue bacteria and M13K07 bacteriophages (Stratagene, La Jolla, CA) served as the host cell and as the helper phage, respectively, during phage display expression. E.coli JM109 (DE3) (Promega Corp., Madison, WI) was used as the host strain for overexpression of unfused proteins.
Library constructions
(i) scCro-N library: The construction and characteristics of this library have been reported earlier (Nilsson et al., 2000
). (ii) scCro-C library: Codons for amino acid residues important for DNA binding in the C-terminal subunit of Cro were randomized by using mutagenic oligonucleotides in PCR. A forward primer, CroCmut (AAAGACCTAGGCGTGTATNNSNNSNNSATCNNSNNSGCCATCCATGCCGGCC), was designed to contain five NNS codons in positions Q27, S28, A29, N31 and K32 of the C-terminal subunit of scCro. The reverse primer was complementary to a sequence within gene III (gIII-1; GAGGCAGGTCAGACGATTGG). As template, a plasmid containing a single Cro gene flanked by an AatII site at the 3' end of the gene was used (Nilsson and Widersten, 2004
). The PCR product (2 µg) was digested with BlnI and AatII, and purified by agarose gel electrophoresis. Purified fragment (1 µg) was ligated to the pCscCro vector (2 µg) digested with the same enzymes. Ligation mixtures were allowed to transform host cells by electroporation. The maintained variability of the constructed library was assessed by sequencing of 25 unselected scCro-C-lib clones. (iii) scCro-NC library: A gene library encoding variants mutated in both the N- and C-terminal domains of scCro was constructed by recombining genes from scCro variants pre-selected for binding to either the Bcl2-ORC ligand (the scCro-N library) or the ORC-Bcl2 ligand (the scCro-C library) (Figure 1). Plasmid DNA was isolated from bacteria, which had been infected with output-phages selected from the C- and the N-libraries after four cycles of affinity selection. After restriction digest of the isolated plasmids with Acc65I and NheI, the fragment containing the mutated cro-C gene was cloned into the vector containing the randomized cro-N gene. XL1-Blue competent cells were transformed with the recombined library construct and colonies of transformed bacteria were analyzed by sequencing. The resulting library was denoted as pC3scCroNC. Phage libraries displaying scCro variants were propagated and harvested as described previously (Nilsson et al., 2000
).
|
DNA ligands
The complementary (+) and () strands of each DNA oligonucleotide (Table I) used as ligands in affinity selections, biosensor assays or electrophoretic mobility shift assays (EMSAs) were annealed as follows: a mixture yielding 10 µM (+) strand and 10 µM () strand in annealing buffer (10 mM TrisHCl, pH 7.5 and 50 mM NaCl) was heated to 95°C for 10 min followed by cooling down to room temperature over a period of >4 h. The double-stranded DNA ligands used in the EMSA were labeled by filling-in the oligo(dT) ends using exo-free Klenow fragment and 6000 mCi/mol [
-32P]dATP (Amersham Bioscience, Uppsala, Sweden). Buffer change and removal of unincorporated dATP were achieved by loading the samples on G-25 Micro-Spin columns (Amersham Bioscience) equilibrated with 10 mM TrisHCl, pH 7.4, 100 mM KCl and 1 mM EDTA. After centrifugation of the columns for 2 min at 735 g, the purified samples were collected and used directly or stored at 20°C.
|
Affinity selection from phage libraries
Phages expressing scCro variants on their surface were diluted to a titer of
1011 colony forming units and incubated with 1 µM biotinylated DNA ligand, 0.01 mg/ml sonicated salmon sperm DNA in binding buffer (BB; 10 mM TrisHCl, pH 7.4 and 100 mM KCl) in a final volume of 100 µl for 1 h on ice. The phageproteinDNA complexes were then added to 0.1 mg streptavidin-coated paramagnetic beads (Promega Corp.), which had been pre-washed with BB fortified with 0.5% (w/v) BSA. The phageDNAbead mixtures were then incubated for an additional 30 min on ice. Using a magnetic holder for the microcentrifuge tubes, entrapped complexes were purified by washing with ice-cold BB containing 0.3% (w/v) BSA, as given in Table II. Phages still bound to the paramagnetic beads were resuspended in 50 µl of 2TY [1.6% (w/v) tryptone, 0.5% (w/v) yeast extract and 5% (w/v) NaCl] and added to 5 ml of log-phase E.coli XL1-Blue cells for infection for 15 min at room temperature. An aliquot of infected bacteria was removed for titration of out-phages, whereas the remaining bacteria were grown overnight for the amplification of selected phages. The next day, amplified phages were harvested and added as input-phages for the next round of selection. In all cases, four selection cycles were performed.
|
Analysis of affinity selection
In order to estimate the efficiency of clonal amplification, the ratios between the number of phage clones surviving the selection (out-phages) and the number of initially added phages (in-phages) were calculated. After reaching a plateau in the ratio out-phages/in-phages (selection rounds 34), ampicillin-resistant clones were randomly picked, plasmids were isolated and the scCro genes analyzed by DNA sequencing.
Small-scale scCro protein expression
Plasmid DNA from the enriched scCro-NC library was isolated from the infected E.coli XL1-Blue cells after the second to fourth rounds of affinity selection. The enriched phagemid libraries were digested with BglII and AatII and subcloned into pETscCroA11:402, a derivative of pET
B (Nilsson and Widersten, 2004
), digested at the corresponding sites. The resulting pETscCro libraries were transferred into E.coli XL1-Blue, with plasmid DNA being subsequently isolated from randomly picked transformants. The encoded scCro genes were analyzed by DNA sequencing. Sequenced pETscCro plasmids were transferred into E.coli JM109 (DE3) for protein expression on a 5 ml culture scale as described previously (Nilsson and Widersten, 2004
). After induced protein expression for 3 h, the cells were harvested by centrifugation at 3840 g for 15 min. Pelleted cells were resuspended in 100 µl of 20 mM sodium phosphate, pH 7.4, containing protease inhibitor cocktail and lysed by ultrasonication. Bacterial lysates were cleared by a 15 min centrifugation at 16 000 g. To the cleared lysates were added glycerol and 2-mercaptoethanol to final concentrations of 50% (v/v) and 12.5 mM, respectively. The total protein concentrations were determined by applying the Bradford method using a commercial reagent (Bio-Rad, Richmond, CA) with purified wild-type scCro as the standard. The specific concentrations of scCro variants in lysates were estimated by western blotting with immunodetection using polyclonal rabbit anti-scCro antibodies (AgriSera, Vännäs, Sweden) visualized by enhanced chemiluminescense detection. The lysates were stored at 20°C until subjected to EMSA.
EMSA Bacterial lysates diluted to contain equal amounts (0.5 µM) of scCro variants were mixed with 32P-labeled Bcl2 or ORC ligands (<20 pM) in the presence of 0.5 µg/ml unspecific competitor DNA (sonicated salmon sperm DNA) in BB containing 10% glycerol (w/v), 0.06% (w/v) Nonidet-P40, 1 mM DTT, 10 µg/ml BSA and 0.5 mM EDTA. After incubation for 1 h on ice, the samples were loaded onto a 10% acrylamide gel containing 0.5x TBE and 5% (w/v) glycerol running at 16 V/cm, at 4°C. Before sample loading, the gel was pre-run for 20 min. After loading, samples were run for an additional 30 min at 32 V/cm. The gel was subsequently dried and the migration of labeled DNA was detected by autoradiography.
Large-scale scCro expression and purification
Purification of selected scCro variants was performed as described previously (Nilsson and Widersten, 2004
). The buffer composition of the purified material was subsequently changed to BB by passing through an equilibrated PD-10 column (Amersham Biosciences). Protein stocks were diluted in BB containing 50% (v/v) glycerol and stored at 20°C or used directly. Protein concentrations were determined by the UV absorbance at 276 nm, applying molar extinction coefficients determined after amino acid analyses (7800 M1 cm1).
ProteinDNA complex stabilitydissociation rates
Biotinylated ATTANA sensor chips (ATTANA Instruments, Stockholm, Sweden) were pre-equilibrated with 10 mM TrisHCl, pH 7.4, 300 mM KCl and 0.005% (v/v) Tween-20 under a constant flow rate of 50 µl/min. The chips were coated with streptavidin (2 x 50 µl injections of 100 µg/ml streptavidin in 10 mM TrisHCl, pH 7.4, 300 mM KCl and 0.005% Tween-20) until a stable baseline was observed. Subsequently, biotinylated DNA ligands (1 µM Bcl2, ORC or #11; Figure 1) were bound to the chips under the same conditions. Approximately 5 nM of the protein in 50 µl BB was injected, and the complex association and dissociation was recorded as a change in chip crystal frequency. The data of the dissociation phases were transformed to positive values by multiplying by 1 and subsequently fitted to f = A (exp) (koff · t) + C, where f is the frequency signal, A the amplitude of the response and koff the dissociation rate constant. Curve fitting was performed using the EXFIT program in the SIMFIT program package (http://www.simfit.man.ac.uk/).
Structure modeling
The tertiary structures of scCro and variant NC48 were modeled as follows.
ScCro. The AGTGGSGG peptide linker connecting the two subunits in scCro was introduced by using the program Biopolymer (Accelrys, San Diego, CA) to the model constructed from the atomic coordinates of wild-type Cro (5CRO; Ohlendorf et al., 1998
). The crude scCro model was soaked in a 5 Å layer of water and subsequently relaxed by energy minimizations, of initially the solvent only, followed by protein hydrogens, side chains and finally the whole molecular system using the steepest descent algorithm in Discover (Accelrys). After this relaxation, a conjugate gradient minimization was conducted for 1000 iterations.
Following energy minimization, the molecular dynamics of the soaked scCro was simulated until the total energy of the system reached equilibrium (
30 ps) at 283 K. An average equilibrium structure was calculated and finally energy-minimized by conjugate gradient until convergence was reached.
Variant NC48. Side-chain replacements in positions 27, 28, 29, 31 and 32 were introduced into the relaxed crude model of scCro8 by using Biopolymer. The subsequent calculations were performed as described for scCro. Comparison of the modeled structures was performed by superimposition of the polypeptide backbone heavy atoms by using InsightII (Accelrys).
| Results |
|---|
|
|
|---|
Library constructions
scCro-C library. The total number of individual clones in the constructed library containing scCro variants mutated in their C-subunits was titered to be 2 x 106, with a background (empty vector) frequency of <6%. Thus, the constructed library maintained
5% of all possible combinations expected from the random mutagenesis of five codon positions. The obtained library size, however, was judged as adequate for the selection task at hand. The quality of the N-library has been reported previously (Nilsson et al., 2000
); the library maintains 5 x 107 individual variants with a vector background frequency of <1%.
To evaluate the quality of the C-library, plasmid DNA extracted from 25 unselected clones was sequenced through the regions of the scCro genes. Two of the analyzed clones consisted of wild-type scCro phages (data not shown), in agreement with the background frequency estimated from the titration of vector-only transformed host cells. The sequencing results showed that all variant clones analyzed from the library were unique and that codons coding for all 20 amino acids were represented. The observed codon distribution was judged as satisfactory, with a variation of codon occurrence ranging between a 2-fold over-representation (Gly and Asn) and a 3-fold under-representation (Ile and Pro) (Figure 2).
|
Affinity selection towards bcl-2/ORC half-site ligands
scCro variants from the N- and the C-libraries were selected for binding to sequences consisting of one half-site of a scCro high-affinity ligand ORC (Nilsson and Widersten, 2004
) and one half-site derived from the bcl-2 target sequence (Figure 1). scCro variants from the N-library were selected towards ligand Bcl2-ORC, consisting of a 3' ORC-like half-site and a 5' half-site with the sequence of the transcription initiation site of the bcl-2 gene [(8) to (1)]. Proteins in the C-library were challenged for binding towards ligand ORC-Bcl2, consisting of a 5' ORC half-site and a 3' half-site with the sequence of a region within the transcription initiation site of the bcl-2 gene (+1 to +9). After four rounds of affinity selection the survival ratio had climbed to a plateau at 250- (N-library) to 2000-fold (C-library) as compared with the unselected libraries, in both cases indicating enrichment of an increasing number of phages passing the selection criteria.
Sequence analysis of the selected variants
The deduced amino acid sequences of variants enriched after four rounds of selection are shown in Table III and the compiled residue compositions in Figure 2. It is clear from the data that certain residues had been selected for: in both parallel selections, the occurrences of Pro and Cys residues were increased; Pro in all cases in position 27, whereas Cys primarily in position 28/29 in the N-library and in position 31 in the C-library selected proteins. Further, Lys and to a lesser extent His were enriched in the N-library proteins, primarily in positions 28 and 32. The C-library proteins displayed a more uniform sequence pattern as compared with the N-library proteins, with a modest enrichment in Arg (position 32) in addition to the mentioned Pro/Cys. It appears as if a Pro residue at position 27 has been the strongest selected structural feature accompanied by a C31R32 motif in the C-library variants. The apparent high enrichment of Gly residues in the C-library variants may be due to uneven codon distribution in the naïve library (Figure 2).
|
scCro-NC library The genes encoding the mutated subunits of scCro from the pre-selected N- and C-libraries were shuffled to construct a new combinatorial library, which was selected for binding to the bcl-2 ligand proper. The final library was estimated to include
8 x 105 members, with a background (empty vector) <1%. A library of this size, assuming an unbiased recombination of genes, would maintain 900 variants of the cro-N and cro-C genes, respectively. Affinity selection of the NC-library towards bcl-2 DNA
Since both pre-selections of the N- and C-libraries involved the contributing interactions of the wild-type scCro subunit/ORC half-site, the presence of a substantial number of low-affinity scCro variants in the NC-library was anticipated. Therefore, the initial cycle of affinity selection was performed with less extensive washing and a higher input number of phages (10121013). In the subsequent rounds more extensive washing was introduced and the number of input-phages was reduced (10101011). Over the course of selection the survival ratio was virtually stable, after an initial decrease due to the increase in wash stringency during the second cycle. The ratio stayed at a high relative value of out-phages/in-phages (5 x 106). The reason for the absence of a steady increase in the ratio is possibly a reflection of a successful pre-selection providing a number of equally efficient DNA-binding protein-phages.
Sequence analysis of selected NC-library variants
The deduced primary structures of variants selected from the NC-library are given in Table IV. The results suggests that a further restricted number of sequence motifs had been enriched during the selection of the combinatorial NC-library as compared with the proteins analyzed after the respective pre-selections (Figure 2); in the N-subunit, P27X28X29(W/R)31K32 or R27H28E29S31K32 and in the C-subunit, P27X28T29C31R32 could be identified as consensus motifs. No clear preference for pairing of individually selected N- and C-terminal subunits was observed, although variants NC44 and NC46 only differed in a single position, H/Q31, suggesting preferred combinations of subunits in those cases.
|
Comparing the different sequences in each subunit, the motif P27C28A29W31K32 appeared 5 out of 20 times in the N-subunit. This motif was already identified in proteins from N-library pre-selection, whereas the motif R27H28E29S31K32, present in 5 of the 20 analyzed proteins, had not been observed previously. Further, His at position 28 appears favorable; 7 of the 20 analyzed clones contained a His at that position. In the C-subunit, Pro27 and the basic Arg/Lys at position 32 were also observed in the pre-selected proteins, but the dominance of Thr at position 29 was a feature that had evolved during the NC-library/Bcl2 selection. Concomitantly with the presence of Thr29, the high frequency of Gly at position 28 of the pre-selected C-library proteins had declined to appear only in 3 out of 20 analyzed proteins from the recombined library.
DNA-binding analysis of Bcl2-selected scCro variants
In order to assess the DNA-binding properties of Bcl2-selected proteins, the genes from sequenced isolates were transferred to a plasmid allowing for overexpression of the corresponding free proteins, unbound to phage. The levels of expression were analyzed by western blotting, allowing for semi-quantitative determination of the specific concentrations of expressed proteins. All proteins tested, except for variant NC401, were expressed at levels comparable to that of the wild-type protein (data not shown).
Expressed proteins were subsequently tested for binding to the bcl-2 transcription initiation sequence by EMSA (Figure 3). scCro proteins were challenged for binding towards radioactively labeled Bcl2 ligand, in the presence of unspecific competitor DNA. Gel shifts were obtained after electrophoresis of the respective mixtures containing Bcl2 DNA and any one of mutants NC43, NC44, NC45, NC46 and NC48 (Figure 3A). The binding specificities of these variants were, therefore, further analyzed by allowing for complex formation either with the wild-type high-affinity ligand ORC or with the Bcl2 ligand (Figure 3B).
|
As expected, the wild-type scCro included as control displayed both an apparent high affinity and specificity towards the ORC ligand; all labeled ORC DNAs were shifted to the position of scCroORC complex. Moreover, no detectable complex was observed after mixing the wild-type protein with the Bcl2 ligand. The tested variants, however, showed lower degrees of specificity with detectable shifts after incubation with ORC DNA in all cases except for variant NC48. Mutants NC43 and NC48 both displayed more intense shifts with the Bcl2 ligand as compared with ORC. The shifted bands, however, were comparably weak. This relatively low intensity of the shifted bands has been interpreted as being caused by aggregation of the proteins in the DNA-binding mixtures. Protein aggregation may result in concentrations of protein available to form complexes with labeled DNA substantially lower than expected, resulting in fainter proteinDNA complex bands after EMSA. Such sub-optimal solution behavior is not unlikely (or even unexpected) considering the relatively high protein concentrations applied in the binding mixtures (500 nM scCro) as compared with the low absolute concentrations of scCro proteins (and phages) throughout the affinity selection. At the highest phage titers used in the initial selection round of the NC-library, the scCro concentrations did not exceed 80 nM, and at later rounds <2 nM of protein-phages were present. Therefore, high protein solubility has not been a feature selected for during phage display, but may rather have been sacrificed for the improved binding affinity towards the Bcl2 ligand. The apparently poor solubility of these proteins makes estimations of affinity based on EMSA unreliable and a surface based method, less sensitive to aggregation, was applied to better probe DNA affinity.
Stability of proteinDNA complexes
Applying a QCM biosensor surface technique (ATTANA Sensor Technologies; www.attana.com), sensitive to mass changes at the sensor chip surface, it was possible to follow both association and dissociation of complexes between the immobilized DNA ligands and protein added to a flowing liquid phase (Figure 4). An increased mass at the sensor chip surface was detected as a lowering of the oscillation frequency of a silicon crystal in the chip device.
|
|
The wild-type scCro together with mutants NC43 and NC48 were allowed to bind to biotinstreptavidin immobilized Bcl2, ORC or #11 DNA (Figure 1). The latter DNA has previously been established as a low-affinity ligand for wild-type scCro and was included in the assay as a control for non-specific binding. All three proteins displayed non-specific interactions when standard binding conditions were applied (10 mM TrisHCl and 100 mM KCl, pH 7.4), which forced the inclusion of higher salt concentrations (300 mM KCl). Higher salt concentrations are expected to lower the influence of electrostatic forces contributing to affinity. Hence, non-specific salt bridges between Arg/Lys and DNA backbone phosphates were expected to contribute less to complex formation.
The dissociation rate obtained for the complex of wild-type scCro and its high-affinity ligand ORC was 1.1 (± 0.53, standard error) x 103 s1, similar to that determined by other techniques (0.5 x 103 s1; Jana et al., 1998
) for scCro in complex with unbiotinylated ORC, supporting that the assay results provided comparable measures of the dissociation rates. No binding of wild-type scCro to either the Bcl2 or the #11 ligands was observed. The underlying reason could be that although specific Cro-binding to DNA is insensitive to high ionic strengths, unspecific interactions are efficiently competed out by higher salt concentrations (Takeda et al., 1986
).
The selected variants NC43 and NC48 both displayed lowest off-rates when in complex with the Bcl2 ligand, with values only slightly larger than that for the scCroORC complex (Table V). This indicates that the affinity selection had enriched protein-phages that stabilize the complexes with DNA and, therefore, survived the washing cycles during selection. The discrimination between DNA ligands, however, was moderate; NC43 showed 5.5-fold higher values of koff for the ORC and the #11 ligands, whereas NC48 displayed a 2.8- and 6.3-fold increase in dissociation rates with the ORC and the #11 ligands, respectively. These rate differences may be translated to energetic contributions applying the equation 
G = RT ln
; the rate differences between the ORC/#11 and the Bcl2 ligands translates into
2.64.6 kJ/mol, which corresponds to less than one hydrogen bond. Hence, much of the binding affinity between the selected variants and the target DNA is realized by non-polar interactions. This is not unexpected, considering occurrence of relatively non-polar residues (Pro, Cys and Gly) in the recognition helices of the selected mutants (Table IV).
Structural modeling
To assess the structural consequences of the replacements in the recognition helices of both the subunits, modeling of the 3-D structures of wild-type scCro and variant NC48 was conducted. The modeled structures were constructed via in silico mutagenesis and optimized through energy minimizations and molecular dynamics simulations. When comparing the model of the variant with that of the wild-type scCro the most striking difference was the orientation of the recognition helix in the C-terminal subunit (Figure 5) caused by a change in the angle in the turn between helix 2 and helix 3. The altered structure is most probably due to the presence of a Pro residue at the N-terminal end of the recognition helix, which owing to its restricted conformation extends the turn connecting helices 2 and 3.
|
| Discussion |
|---|
|
|
|---|
Redesign of proteinDNA-binding properties targets primarily amino acidnucleotide interactions. However, for proteins interacting with DNA over a longer stretch of nucleotides, spanning over more than one contact site, changes in quaternary structure combined with structural alterations in the target DNA are often integrated in the binding process. This is certainly true for the lambda Cro repressor interacting with its target operator sequence by protrusion of the recognition helices into two neighboring major grooves at the same face of the DNA duplex. In the stable complex, DNA is bent 40° from its symmetry axis (Albright and Matthews, 1998
The ORC DNA consists of 5' terminal dT·dA triplets interspaced by a central G/C-rich region. This nucleotide arrangement involving A-tracts (Chrothers et al., 1990
) spaced by GC nucleotides adheres to the bending model described by Goodsell et al. (1993)
. Further, the GC-rich motif (CCGCGG) in ORC is in phase with the helical repeat, which also may introduce a higher degree of bending (see Lilley, 1995
and references therein). The Bcl2 DNA used as a target sequence for the performed repertoire selections probably has a lower tendency of intrinsic curvature as compared with ORC, estimated from the nucleotide sequence (Figure 1). Therefore, proteins binding to the Bcl2 DNA are supposedly required to adapt not only to an altered nucleotide sequence, but also to the overall conformation of the double helix. Comparing the distances of the distal nucleotides +2 and 16 in the predicted binding sites of ORC and Bcl2 reveals the following: the distance between the (O6) of Ade+2 and Ade16 of ORC in complex with Cro (Albright and Matthews, 1998
) is 45 Å, while the distance between corresponding bases in a B-DNA model of the Bcl2 DNA is 51 Å. Even if the actual difference in distances may be smaller than these values, it suggests that a wider spacing of the recognition helices in Bcl2-binding proteins would be advantageous. A replacement for Pro at position 27 was one of the strongest enriched structural features in the selected variants. This residue is situated in the N-terminus of the recognition helix and the putative effect of the Pro insertion, as inferred from molecular modeling (Figure 5), is a change in the angle between helices 2 and 3, thereby widening the distance between the two recognition helices in the dimer. Such a widening is in line with a notion of a less bent DNA with a larger distance between the major grooves at the same helix face.
Whether the moderate degree of specificity displayed by the mutants tested is due to an absence of DNA bending, i.e. bending is a required feature of specificity, is not clear from the present data and needs further analysis on the individual interactions made by these proteins with their target ligands. It is clear, however, that the isolated proteins bind with high affinity and that the formed complexes with DNA are stable with low dissociation rates.
Phage display is a powerful technique in that large protein repertoires can be tested directly for functional properties such as ligand interactions. A practical upper limit to the number of protein variants that can be maintained in a library, however, is of the order of 107108. In order to subject both recognition helices of the scCro protein to random mutagenesis, a library of 3.2 x 1011 members would be required, a figure far exceeding the capacity of phage display selection. To circumvent this obstacle a stepwise selection was performed as outlined in Figure 6. The individual subunits were mutated in parallel to construct two semi-large repertoires maintaining adequate numbers of variants that were subsequently pre-selected for binding to the different half-sites of the Bcl2 sequence. The pre-selected variant genes were later shuffled to create a final library challenged for binding to the entire Bcl2 DNA target. In addition to solving the technical issue of the required library size, the shuffling of the pre-selected subunits was also expected to increase the possibilities for favorable subunitsubunit interactions, which could improve the DNA-binding properties of the recombined proteins.
|
| Conclusion |
|---|
|
|
|---|
The described work has provided a set of first-generation proteins targeted to the transcription initiation region of the bcl-2 gene. The proteins display high affinity in binding to the new target sequence but display only moderate sequence discrimination. To improve on the specificity in binding, without sacrificing the displayed binding affinity, the contributing role of the DNA-interacting amino acid residues in selected proteins will be assessed and combined with further functional maturation by mutagenesis and selections.
| Notes |
|---|
3 These authors contributed equally to this work
| Acknowledgements |
|---|
|
|
|---|
The generous aid by ATTANA AB (Stockholm, Sweden) in providing the QCM biosensor equipment to the study is gratefully acknowledged. In this work M.W. was supported by the Carl Trygger Foundation.
| References |
|---|
|
|
|---|
Albright,R.A. and Matthews,B.W. (1998) J. Mol. Biol., 280, 137151.[CrossRef][Web of Science][Medline]
Ayhan,A., Yasui,W., Yokozaki,H., Seto,M., Ueda,R. and Tahara,E. (1994) Jpn. J. Cancer Res., 85, 584591.[CrossRef][Web of Science][Medline]
Beerli,R.R. and Barbas,C.F. (2002) Nat. Biotechnol., 20, 135141.[CrossRef][Web of Science][Medline]
Buchholz,T.A. et al. (2003) Cancer J., 9, 3341.[Web of Science][Medline]
Busby,S. and Ebright,R.H. (1994) Cell, 79, 743746.[Web of Science][Medline]
Chrothers,D.M., Haran,T.E. and Nadeau,J.G. (1990) J. Biol. Chem., 265, 70937096.
Gobe,G., Rubin,M., Williams,G., Sawczuk,I. and Buttyan,R. (2002) Cancer Invest., 20, 324332.[CrossRef][Web of Science][Medline]
Goodsell,D.S., Kopka,M.L., Cascio,D. and Dickerson,R.E. (1993) Proc. Natl Acad. Sci. USA, 90, 29302934.
Jana,R., Hazbun,T.R., Fields,J.D. and Mossing,M.C. (1998) Biochemistry, 37, 64466455.[CrossRef][Medline]
Jansen,B. and Zangemeister-Wittke,U. (2003) Lancet Oncol., 3, 672683.
Jansen,B., Schlagbauer-Wadl,H., Brown,B.D., Bryan,R.N., van Elsas,A., Muller,M., Wolff,K., Eichler,H.G. and Pehamberger,H. (1998) Nat. Med., 4, 232234.[CrossRef][Web of Science][Medline]
Kirkin,V., Joos,S. and Zornig,M. (2004) Biochim. Biophys. Acta, 1644, 229249.[Medline]
Kondo,E., Yoshino,T., Yamadori,I., Matsuo,Y., Kawasaki,N., Minowada,J. and Akagi,T. (1994) Am. J. Pathol., 145, 330337.[Abstract]
Krajewska,M., Krajewski,S., Epstein,J.I., Shabaik,A., Sauvageot,J., Song,K., Kitada,S. and Reed,J.C. (1996) Am. J. Pathol., 148, 15671576.[Abstract]
Lilley,D.M.J. (ed.) (1995) DNAProtein Structural Interactions. Oxford University Press, Oxford, UK.
Marriott,J.B. et al. (2003) Cancer Res., 63, 593599.
Nilsson,M.T.I. and Widersten,M. (2004) Biochemistry, 43, 1203812047.[CrossRef][Medline]
Nilsson,M.T.I., Mossing,M.C. and Widersten,M. (2000) Protein Eng., 13, 519526.
Ohlendorf,D.H., Tronrud,D.E. and Matthews,B.W. (1998) J. Mol. Biol., 280, 129136.[CrossRef][Web of Science][Medline]
Pepper,C., Hoy,T. and Bently,P. (1998) Leuk. Lymphoma, 28, 355.[Web of Science][Medline]
Segal,D.J. and Barbas,C.F.,3rd (2001) Curr. Opin. Biotechnol., 12, 632637.[CrossRef][Web of Science][Medline]
Takeda,Y., Kim,J.G., Caday,C.G., Steers,E.,Jr, Ohlendorf,D.H., Anderson,W.F. and Matthews,B.W. (1986) J. Biol. Chem., 261, 86088616.
Tan,S. et al. (2003) Proc. Natl Acad. Sci. USA, 100, 1199712002.
Villard,J. (2004) Swiss Med. Wkly., 134, 571579.[Medline]
Webb,A., Cunningham,D., Cotter,F., Clarke,P.A., di Stefano,F., Ross,P., Corbo,M. and Dziewanowska,Z. (1997) Lancet, 349, 11371141.[CrossRef][Web of Science][Medline]
Wu,H., Yang,W.P. and Barbas,C.F.,3rd (1995) Proc. Natl Acad. Sci. USA, 92, 344348.
Zaja, F. et al. (1998) Leuk. Lymphoma 28, 567572.[Web of Science][Medline]
Received May 31, 2005; revised August 8, 2005; accepted August 8, 2005.
Edited by Brian Matthews
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





