Skip Navigation


PEDS Advance Access originally published online on May 31, 2005
Protein Engineering Design and Selection 2005 18(6):279-284; doi:10.1093/protein/gzi034
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/6/279    most recent
gzi034v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (13)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Doi, N.
Right arrow Articles by Yanagawa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doi, N.
Right arrow Articles by Yanagawa, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Author 2005. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oupjournals.org

High solubility of random-sequence proteins consisting of five kinds of primitive amino acids

Nobuhide Doi, Koichi Kakukawa, Yuko Oishi and Hiroshi Yanagawa1

Department of Biosciences and Informatics, Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama 223-8522, Japan

1 To whom correspondence should be addressed. E-mail: hyana{at}bio.keio.ac.jp


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Why are the random-sequence...
 Origin and early evolution...
 Acknowledgements
 References
 
Searching for functional proteins among random-sequence libraries is a major challenge of protein engineering; the difficulties include the poor solubility of many random-sequence proteins. A library in which most of the polypeptides are soluble and stable would therefore be of great benefit. Although modern proteins consist of 20 amino acids, it has been suggested that early proteins evolved from a reduced alphabet. Here, we have constructed a library of random-sequence proteins consisting of only five amino acids, Ala, Gly, Val, Asp and Glu, which are believed to have been the most abundant in the prebiotic environment. Expression and characterization of arbitrarily chosen proteins in the library indicated that five-alphabet random-sequence proteins have higher solubility than do 20-alphabet random-sequence proteins with a similar level of hydrophobicity. The results support the reduced-alphabet hypothesis of the primordial genetic code and should also be helpful in constructing optimized protein libraries for evolutionary protein engineering.

Keywords: genetic code/protein design/protein evolution/reduced amino acid alphabet/synthetic library


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Why are the random-sequence...
 Origin and early evolution...
 Acknowledgements
 References
 
The question of what proportion of random-sequence proteins exhibit folded structure or functional activity in a given sequence space is important for understanding how natural proteins have evolved and how novel proteins can be engineered (for reviews, see Doi and Yanagawa, 1998Go; Kauffman and Ellington, 1999Go; Saven, 2002Go; Watters and Baker, 2004Go). Since 1990, several researchers have reported the construction and screening of large libraries of random-sequence proteins and the biophysical characterization of such proteins (Mandecki, 1990Go; LaBean et al., 1995Go; Prijambada et al., 1996Go; Doi et al., 1997Go, 1998Go; Yamauchi et al., 1998Go; Cho et al., 2000Go; Keefe and Szostak, 2001Go). However, experimental studies using random-sequence protein libraries face the difficulty of identifying novel proteins with native-like structures and desired functions. In the only successful example so far reported, Keefe and Szostak isolated novel ATP-binding proteins from a random-sequence library, but the biophysical characterization of these proteins was difficult owing to poor solubility (Keefe and Szostak, 2001Go), although the X-ray crystal structure of one of them was recently solved (Lo Surdo et al., 2004Go). Generally, random-sequence proteins have a strong tendency to form aggregates (Mandecki, 1990Go), which is unfavorable for functional selection and further improvement of their solubility (Ito et al., 2004Go), and folding stability (Chaput and Szostak, 2004Go) by directed evolution is required. Hence, in the laboratory it would be profitable to start from a library in which most proteins are soluble and stable (Fischer et al., 2004Go), in order to evolve novel proteins, as would also have been the case in the prebiotic soup.

Although modern proteins consist of 20 amino acids, it has been proposed that the origin and early evolution of protein synthesis involved a reduced alphabet, that was gradually extended through co-evolution of the genetic code and the primordial biochemical system for amino acid synthesis (Crick, 1968Go; Wong, 1975Go; Brooks et al., 2002Go). If this is so, the properties of random-sequence proteins with a reduced alphabet may be different from those of the 20-alphabet random-sequence proteins previously reported. Davidson and co-workers constructed and characterized random-sequence proteins consisted of only Gln, Leu and Arg (Davidson and Sauer, 1994Go; Davidson et al., 1995Go). These QLR proteins showed remarkable helical structures, but their solubility was fairly low. In a computational study using inverse folding techniques, Babajide et al. demonstrated that native-like folded structures of tested proteins were maintained with restricted alphabets containing primitive amino acids such as Ala and Gly, but were not maintained with a non-primitive QLR alphabet (Babajide et al., 1997Go). In this paper, we describe the first attempt to construct and characterize random-sequence proteins using a restricted set of primitive amino acids.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Why are the random-sequence...
 Origin and early evolution...
 Acknowledgements
 References
 
Construction of a DNA library of random-sequence proteins The 88-bp DNA [GGTAGATCTGGAAGACTGTGG (GNW)15TGGGCGAGACCGCTCGAGGTTC] consisting of 15 consecutive random codons (GNW, in which N = T:C:A:G = 15:30:30:25 and W = T:A = 40:60) was synthesized at FASMAC (Kanagawa, Japan) and amplified by PCR using primers GNW-F (5'-GGTAGATCTGGAAGACTGTGG-3') and GNW-R (5'-GAACCTCGAGCGGTCTCGC-3') with Ex Taq DNA polymerase (Takara Shuzo). The PCR product was purified by phenol/chloroform extraction and ethanol precipitation and separated into two equal aliquots that were digested with either BbsI or BsaI. The resulting fragments were purified by 2% agarose gel electrophoresis and Recochip (Takara Shuzo), ligated with T4 DNA ligase (Toyobo) and amplified by PCR. Repeating this procedure three times yielded a final library with eight (=23) contiguous random regions.

Cloning, expression and purification of the random-sequence proteins

The DNA library was cloned, randomly selected and sequenced with an ABI PRISM 3100 (Applied Biosystems). The random-sequence region of the eight in-frame genes were digested with BglII and XhoI and then subcloned into a derivative of a pET vector (Novagen) containing the N-terminal T7·tag sequence and the C-terminal His6 tag sequence. Escherichia coli BL21-CodonPlus(DE3) cells (Stratagene) transfected with individual recombinant plasmids were grown in LB broth containing 100 µg/ml ampicillin and 40 µg/ml chloramphenicol at 37°C. When the culture achieved an optical density of 0.6–0.7 at 600 nm, isopropylthio-ß-D-galactoside was added to a final concentration of 0.1 mM. After an additional 3 h of incubation, the cells were harvested by centrifugation and lysed in a BugBuster (Novagen) containing a protease inhibitor cocktail (Sigma). The centrifuged supernatants were used as the soluble fractions. The pellets were resuspended in a buffer containing 8 M urea and the centrifuged supernatants were used as insoluble fractions. These fractions were analyzed by 16.5% Tricine SDS–PAGE (Schägger and von Jagow, 1987Go). The proteins were detected with CBB (Coomassie Brilliant Blue R250) staining and Western blotting with anti-T7·tag antibody. The soluble fractions were loaded on the affinity column of nickel–NTA agarose resin (Qiagen) and the recombinant proteins were eluted with an imidazole gradient. The protein molar concentration was determined from the UV absorption at 280 nm and the molar absorption coefficient was calculated from {varepsilon} = 5690 M–1 cm–1 for Trp (Gill and von Hippel, 1989Go).

CD and fluorescence measurements

CD spectra of purified proteins in the absence and presence of 1–5 M Gdn·HCl were measured on a J-820 spectropolarimeter (JASCO) at 25°C. The protein concentration was 3 µM and the light pathlength used was 1 mm. The results were expressed as mean residue molar ellipticity [{theta}].

Fluorescence measurements were performed at 25°C on a Shimadzu RF-1500 spectrofluorometer. The emission spectra of Trp residues of 1 µM proteins were measured at an excitation wavelength of 280 nm and the fluorescence spectra of 50 µM ANS (1-anilinonaphthalene-8-sulfonic acid) (Molecular Probes) in the absence and presence of 1 µM protein were measured with excitation at 371 nm.

Size-exclusion chromatography

Gel-filtration experiments on purified proteins were performed using a Shodex KW-803 column (Showa Denko) on a Vision Workstation (Applied Biosystems). The column was calibrated with a low molecular weight gel filtration calibration kit (Amersham Pharmacia Biotech). The Stokes radii of purified proteins and the control proteins (BSA, ovalbumin, chymotrypsinogen and ribonuclease) were calculated from their elution volumes as described previously (Uversky, 1993Go).


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Why are the random-sequence...
 Origin and early evolution...
 Acknowledgements
 References
 
Design of DNAs encoding random-sequence proteins with primitive alphabets

The most abundant amino acids in the prebiotic environment as inferred from the results of spark-discharge experiments were Ala, Gly, Asp and Val (Miller, 1953Go; Eigen, 1978Go), whereas those deduced from analysis of the Murchison meteorite were Gly, Ala, Glu and Val (Kvenvolden et al., 1970Go). Interestingly, codons for all these amino acids have guanosine (G) at the first nucleotide (Figure 1) and thus codons GNC and GNN, where N denotes U, C, A or G, were proposed to have formed the early genetic code (Eigen, 1978Go; Kuhn and Waser, 1994Go). We chose the five amino acids Ala, Gly, Val, Asp and Glu as a primitive alphabet.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1.. The universal genetic code and the abundance of amino acids in simulated prebiotic synthesis. Typical yields (µM) in spark discharge experiments were Ala, 790; Gly, 440; Asp, 34; Val, 19.5; Leu, 11.3; Glu, 7.7; Ser, 5.0; Ile, 4.8; Thr, 1.6; Pro, 1.5; and others (data from Eigen, 1978Go).

 
Using the strategy shown in Figure 2, we constructed a DNA library encoding polypeptides of more than 100 residues of random mixtures of the five amino acids. The semi-random codon GNW (N = T, C, A or G; W = T or A) encodes either Val, Ala, Asp/Glu and Gly with probabilities determined by the percentages of T, C, A and G in the base mixture at the second nucleotide position of each randomized codon. The frequency of each amino acid was set to reflect the putative prebiotic abundance of Ala and Gly (Miller, 1953Go; Kvenvolden et al., 1970Go; Eigen, 1978Go). The GNW codons contained only A and T at the third nucleotide position in order to reduce the total GC content of the DNA sequences to no more than ~50%.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 2.. The strategy for construction of a DNA library encoding random-sequence proteins of >100 amino acid residues. The synthesized 88 bp DNA (top) consisting of 15 consecutive random codons, GNW, was amplified by PCR, purified and separated into two equal aliquots that were digested with either BbsI or BsaI type IIS restriction endonuclease. The resulting fragments were purified, ligated with T4 DNA ligase and amplified by PCR. Repeating this procedure three times yielded a final library with eight (=23) contiguous random regions (i.e. 120 random codons). The BglII–XhoI sites were used for subcloning of genes. This strategy based on type IIS restriction sites is similar to that described previously (Cho et al., 2000Go), although ‘preselection’ was not performed because the GNW repeats contain no stop codon.

 
The DNA library was cloned into Escherichia coli and the sequences of arbitrarily chosen clones were analyzed. As shown in Figure 3, the amino acid sequences were designed to encode an N-terminal T7·tag to allow Western blot analysis, a C-terminal His6 tag to allow affinity purification and several fixed Trp residues at the random cassette junctions to allow fluorescence studies and UV measurements for protein quantitation. Consequently, 92–94% of each polypeptide sequence consisted of random combinations of the five amino acids (Table I). The length of each sequence varied (Figure 3), perhaps owing to unexpected recombination in a repetitive GNW region during PCR and/or unexpected deletion in the synthetic DNA cassettes (single base deletions were observed in 17% of the DNA cassette sequences). However, all random cassettes were different from each other, as we expected.



View larger version (55K):
[in this window]
[in a new window]
 
Fig. 3.. Predicted amino acid sequences of arbitrarily chosen random-sequence VADEG proteins. The N-terminal T7·tag sequence and the C-terminal His6 tag sequence are also shown.

 

View this table:
[in this window]
[in a new window]
 
Table I.. Properties of the random-sequence proteins

 


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 4.. Expression and solubility of the random-sequence proteins. The soluble (lanes S) and insoluble (lanes I) fractions of overexpressed proteins were analyzed by 16.5% Tricine SDS–PAGE (Schägger and von Jagow, 1987Go). The arrows indicate the positions of random-sequence proteins. The proteins were detected by CBB staining (top) and Western blotting with anti-T7·tag antibody (bottom).

 


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5.. The mean residue ellipticity values of VADEG proteins (triangles, G2; squares, G4) at 222 nm as a function of Gdn·HCl concentration. CD spectra of eight purified proteins at a concentration of 3 µM were measured on a J-820 spectropolarimeter (JASCO). The other six proteins (Table I) revealed a similar level of ellipticity to that of G2 and G4.

 


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 6.. Fluorescence spectra of 50 µM ANS (excitation at 371 nm) in the absence (gray line) and presence of 1 µM G4 protein (black line). Fluorescence measurements were performed on a Shimadzu RF-1500 spectrofluorometer. For the other seven proteins, see also Table I.

 
High solubility of the random-sequence VADEG proteins

As shown in Figure 4, we examined the solubility of eight of the random-sequence VADEG proteins and found that all of them were expressed in the soluble fraction. In the case of G4, the protein was also detected in the insoluble fraction. In previous studies, only five of 25 20-alphabet random-sequence proteins (Prijambada et al., 1996Go) and only two of 11 random-sequence QLR proteins (Davidson et al., 1995Go) were found to be soluble. The VADEG proteins presented here thus seem to possess remarkably high solubility.

Structural characterization of the VADEG proteins

Previous reports indicated that 20-alphabet random-sequence proteins did not show any marked secondary structure (Doi et al., 1998Go; Yamauchi et al., 1998Go) whereas the three-alphabet QLR proteins had remarkably high levels of helical structure (fractional helicity 32–70%) and it was suggested that proteins with a limited range of amino acids have a greater tendency to form secondary structure (Davidson et al., 1995Go). However, the five-alphabet VADEG proteins revealed no marked secondary structure as analyzed by means of CD measurements (Figure 5 and Table I), in spite of the abundance of Glu and Ala, which are known to be strong helix formers (Chou and Fasman, 1978Go). One reason for the low helical content of the VADEG proteins would be the presence of the strong helix breaker, Gly, within the polypeptides. The highly structured QLR proteins contain the strong helix former Leu and have no helix breaker in their sequences.

For tertiary structure analysis, the emission spectra of the Trp residues doped in the random-sequence proteins in advance were measured at an excitation wavelength of 280 nm. The emission maxima ranged from 348 to 352 nm in an aqueous buffer, suggesting that almost all the Trp residues are exposed to the solvent (Teale, 1960Go). However, the intensity at the emission maximum of the G8 random-sequence protein was decreased by half in buffer containing 5 M urea (data not shown). Hence some of the Trp side chains of the G8 protein appear to be located in a hydrophobic environment under native conditions and to undergo denaturation in 5 M urea. The presence of hydrophobic clusters in the random sequence polypeptide was also supported by the results of ANS binding experiments. The fluorescence emission spectrum of ANS is known to be enhanced when the dye binds to hydrophobic regions of proteins (Stryer, 1965Go). As shown in Figure 6, ANS fluorescence increased in the presence of the G4 random-sequence protein. A relatively small increase was also observed for the G1, G3, G7 and G8 proteins (Table I).

Next, the oligomeric state of the VADEG proteins was analyzed by means of gel filtration experiments. Each VADEG protein, except for the G4 protein, was eluted as a single peak and the Stokes radius calculated from the elution position of each VADEG protein was slightly larger than that deduced from data for monomeric, globular proteins with similar molecular weights (Figure 7). This result suggests that the VADEG proteins with high solubility tended to exist as monomers with slightly extended shape, whereas the QLR proteins (Davidson et al., 1995Go) and the 20-alphabet random-sequence proteins (Yamauchi et al., 1998Go) with poor solubility tended to form multimeric structures.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 7.. Stokes radius plot for VADEG proteins. The elution volume was determined by gel filtration of purified proteins using a Shodex KW-803 column (Showa Denko) on a Vision Workstation (Applied Biosystems). The circles indicate the elution volume of four control proteins (BSA, ovalbumin, chymotrypsinogen and ribonuclease) plotted against their known Stokes radii and the line shows an empirical equation relating Stokes radius to elution position (Uversky, 1993Go). The arrows indicate the elution volumes of VADEG proteins. The G4 protein purified from the soluble fraction showed two peaks (G4a and b), whereas the other seven proteins each gave a single peak between the positions of G1 and G7.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Why are the random-sequence...
 Origin and early evolution...
 Acknowledgements
 References
 
We constructed a library of random-sequence proteins consisting of five amino acids, Ala, Gly, Val, Asp and Glu, which are believed to have been abundant under prebiotic conditions. We found that the random-sequence VADEG proteins in the library have higher solubility than that of previously reported 20-alphabet random-sequence proteins. Structural analyses of some of our five-alphabet random-sequence proteins indicated the presence of flexible monomeric structures. The high solubility of these random-sequence proteins with a primitive alphabet supports the reduced-alphabet hypothesis of the primordial genetic code and also implies that such protein libraries may be favorable tools for evolutionary protein engineering.


    Why are the random-sequence VADEG proteins highly soluble?
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Why are the random-sequence...
 Origin and early evolution...
 Acknowledgements
 References
 
The hydrophobicity of the VADEG proteins calculated based on the index (Kyte and Doolittle, 1982Go) was in the range –0.2 to 0.2, which is slightly higher (i.e. more hydrophobic) than that of the previous random-sequence proteins with poor solubility: –2.2 to –0.2 for the QLR proteins (Davidson et al., 1995Go) and –1.0 to –0.2 for the 20-alphabet random-sequence proteins (Ito et al., 2004Go). Therefore, the content of hydrophobic residues of the VADEG proteins cannot explain their high solubility. As suggested by Wilkinson and Harrison, protein solubility may not always correlate with hydrophobicity but would also be affected by net charge and the fraction of turn-forming residues (Asp, Asn, Pro, Gly, Ser) (Wilkinson and Harrison, 1991Go), both of which are relatively high in the VADEG proteins. Since these proteins contain the negatively charged amino acids, Asp and Glu, but no positively charged amino acid, they are expected to be highly charged at neutral pH. Further, the abundant Gly has no side chain and tends to favor high solubility. Indeed, the G4 random-sequence protein that was expressed as both soluble and insoluble forms has relatively low contents of Asp and Gly compared with the other seven proteins, which were only expressed in the soluble fraction (Table I).


    Origin and early evolution of proteins through functional selection
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Why are the random-sequence...
 Origin and early evolution...
 Acknowledgements
 References
 
Do the unfolded structures of the VADEG proteins, as well as the 20-alphabet random-sequence proteins (Doi et al., 1998Go; Yamauchi et al., 1998Go), mean that these proteins have no function? Although the functions of modern proteins are closely related to their tertiary structures, numerous examples of proteins that are unstructured in solution, but which become structured on binding to the target molecule, have now been recognized (Wright and Dyson, 1999Go). The unfolded structure of a polypeptide has functional advantages, including the ability to bind to several different targets through induced folding (Wright and Dyson, 1999Go). Similarly, it appears likely that the flexible structures of primitive polypeptides would have provided a variety of functions to be optimized during molecular evolution (James and Tawfik, 2003Go).

Keefe and Szostak estimated the frequency of functional proteins in a library of 20-alphabet random-sequence proteins as 1 in 1011 by using mRNA display technology (Keefe and Szostak, 2001Go). It would be interesting to study whether a library of simple-alphabet random-sequence proteins with higher solubility contains functional proteins in the reduced sequence space. Such studies are in progress by using in vitro display technologies developed in our laboratory (Nemoto et al., 1997Go; Doi and Yanagawa, 1999Go; Yonezawa et al., 2003Go; Horisawa et al., 2004Go). The acidic residues, Asp and Glu, can bind to metals such as Mg2+ and Ca2+, so primitive enzymes with the VADEG alphabet might act as metalloenzymes, like ribozymes in the RNA world. Recent studies in vitro (Riddle et al., 1997Go; Silverman et al., 2001Go; Akanuma et al., 2002Go) and in silico (Chan, 1999Go; Wang and Wang, 1999Go; Murphy et al., 2000Go; Fan and Wang, 2003Go) provide insight into the extent to which native protein structure and function can be achieved with reduced alphabets, such as IKEAG (Riddle et al., 1997Go). In order to acquire artificial proteins with various functions by laboratory evolution, it might be effective to dope basic amino acids such as Lys and Arg into a set of reduced-alphabet random-sequence libraries.

As an alternative approach to laboratory protein evolution and selection, Hecht et al. constructed a ‘binary code’ library by designing a binary pattern of polar and non-polar amino acids that would favor proteins containing abundant secondary structure (Kamtekar et al., 1993Go; Wei and Hecht, 2004Go). The quality of the library is high; almost all of the proteins in the library are soluble and have a well-ordered structure, although their structural diversity is limited to a predesigned unique fold, such as a four-helix bundle structure. Libraries of modest quality and diversity containing polypeptides with various folds and abundant secondary structure, but no well-ordered structure, can be constructed by randomly combining naturally occurring polypeptide segments such as repetitive peptide motifs (Shiba et al., 1997Go, 2003Go), secondary structure units (Tsuji et al., 1999Go, 2001Go) and random cDNA fragments (Fischer et al., 2004Go). In general, there would be a trade-off between quality and diversity of combinatorial polypeptide libraries. However, a random-sequence library with a reduced alphabet can achieve relatively high quality (e.g. high solubility) with enormous diversity.


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Why are the random-sequence...
 Origin and early evolution...
 Acknowledgements
 References
 
The authors thank Dr Toru Tsuji for helpful discussions. This research was supported in part by the Industrial Technology Research Grant Program in '04 from the NEDO of Japan and by a Grant-in-Aid for Scientific Research and a Special Coordination Fund grant from the MEXT of Japan.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Why are the random-sequence...
 Origin and early evolution...
 Acknowledgements
 References
 
Akanuma,S., Kigawa,T. and Yokoyama,S. (2002) Proc. Natl Acad. Sci. USA, 99, 13549–13553.[Abstract/Free Full Text]

Babajide,A., Hofacker,I.L., Sippl,M.J. and Stadler,P.F. (1997) Fold. Des., 2, 261–269.[CrossRef][Web of Science][Medline]

Brooks,D.J., Fresco,J.R., Lesk,A.M. and Singh,M. (2002) Mol. Biol. Evol., 19, 1645–1655.[Abstract/Free Full Text]

Chan,H.S. (1999) Nat. Struct. Biol., 6, 994–996.[CrossRef][Web of Science][Medline]

Chaput,J.C. and Szostak,J.W. (2004) Chem. Biol., 11, 865–874.[CrossRef][Web of Science][Medline]

Cho,G., Keefe,A.D., Liu,R., Wilson,D.S. and Szostak,J.W. (2000) J. Mol. Biol., 297, 309–319.[CrossRef][Web of Science][Medline]

Chou,P.Y. and Fasman,G.D. (1978) Annu. Rev. Biochem., 47, 251–276.[CrossRef][Web of Science][Medline]

Crick,F.H.C. (1968) J. Mol. Biol., 38, 367–379.[CrossRef][Web of Science][Medline]

Davidson,A.R. and Sauer,R.T. (1994) Proc. Natl Acad. Sci. USA, 91, 2146–2150.[Abstract/Free Full Text]

Davidson,A.R., Lumb,K.J. and Sauer,R.T. (1995) Nat. Struct. Biol., 2, 856–864.[CrossRef][Web of Science][Medline]

Doi,N. and Yanagawa,H. (1998) Cell. Mol. Life Sci., 54, 394–404.[CrossRef][Web of Science][Medline]

Doi,N. and Yanagawa,H. (1999) FEBS Lett., 457, 227–230.[CrossRef][Web of Science][Medline]

Doi,N., Itaya,M., Yomo,T., Tokura,S. and Yanagawa,H. (1997) FEBS Lett., 402, 177–180.[CrossRef][Web of Science][Medline]

Doi,N., Yomo,T., Itaya,M. and Yanagawa,H. (1998) FEBS Lett., 427, 51–54.[CrossRef][Web of Science][Medline]

Eigen,M. (1978) Naturwissenschaften, 65, 341–369.[CrossRef][Web of Science]

Fan,K. and Wang,W. (2003) J. Mol. Biol., 328, 921–926.[CrossRef][Web of Science][Medline]

Fischer,N., Riechmann,L. and Winter,G. (2004) Protein Eng. Des. Sel., 17, 13–20.[Abstract/Free Full Text]

Gill,S.C. and von Hippel,P.H. (1989) Anal. Biochem., 182, 319–326.[CrossRef][Web of Science][Medline]

Horisawa,K., Tateyama,S., Ishizaka,M., Matsumura,N., Takashima,H., Miyamoto-Sato,E., Doi,N. and Yanagawa,H. (2004) Nucleic Acids Res., 32, e169.[Abstract/Free Full Text]

Ito,Y., Kawama,T., Urabe,I. and Yomo,T. (2004) J. Mol. Evol., 58, 196–202.[CrossRef][Web of Science][Medline]

James,L.C. and Tawfik,D.S. (2003) Trends Biochem. Sci., 28, 361–368.[CrossRef][Web of Science][Medline]

Kamtekar,S., Schiffer,J.M., Xiong,H., Babik,J.M. and Hecht,M.H. (1993) Science, 262, 1680–1685.[Abstract/Free Full Text]

Kauffman,S. and Ellington,A.D. (1999) Curr. Opin. Chem. Biol., 3, 256–259.[CrossRef][Web of Science][Medline]

Keefe,A.D. and Szostak,J.W. (2001) Nature, 410, 715–718.[CrossRef][Medline]

Kuhn,H. and Waser,J. (1994) FEBS Lett., 352, 259–264.[CrossRef][Web of Science][Medline]

Kvenvolden,K., Lawless,J., Pering,K., Peterson,E., Flores,J., Ponnamperuma,C., Kaplan,I.R. and Moore,C. (1970) Nature, 228, 923–926.[CrossRef]

Kyte,J. and Doolittle,R.F. (1982) J. Mol. Biol., 157, 105–132.[CrossRef][Web of Science][Medline]

LaBean,T.H., Kauffman,S.A. and Butt,T.R. (1995) Mol. Divers., 1, 29–38.[CrossRef][Web of Science][Medline]

Lo Surdo,P., Walsh,M.A. and Sollazzo,M. (2004) Nat. Struct. Mol. Biol., 11, 382–383.[CrossRef][Web of Science][Medline]

Mandecki,W. (1990) Protein Eng., 3, 221–226.[Abstract/Free Full Text]

Miller,S.L. (1953) Science, 117, 528–529.[Free Full Text]

Murphy,L.R., Wallqvist,A. and Levy,R.M. (2000) Protein Eng., 13, 149–152.[Abstract/Free Full Text]

Nemoto,N., Miyamoto-Sato,E., Husimi,Y. and Yanagawa,H. (1997) FEBS Lett., 414, 405–408.[CrossRef][Web of Science][Medline]

Prijambada,I.D., Yomo,T., Tanaka,F., Kawama,T., Yamamoto,K., Hasegawa,A., Shima,Y., Negoro,S. and Urabe,I. (1996) FEBS Lett., 382, 21–25.[CrossRef][Web of Science][Medline]

Riddle,D.S., Santiago,J.V., Bray-Hall,S.T., Doshi,N., Grantcharova,V.P., Yi,Q. and Baker,D. (1997) Nat. Struct. Biol., 4, 805–809.[CrossRef][Web of Science][Medline]

Saven,J.G. (2002) Curr. Opin. Struct. Biol., 12, 453–458.[CrossRef][Web of Science][Medline]

Schägger,H. and von Jagow,G. (1987) Anal. Biochem., 166, 368–379.[CrossRef][Web of Science][Medline]

Shiba,K., Takahashi,Y. and Noda,T. (1997) Proc. Natl Acad. Sci. USA, 94, 3805–3810.[Abstract/Free Full Text]

Shiba,K., Shirai,T., Honma,T. and Noda,T. (2003) Protein Eng., 16, 57–63.[Abstract/Free Full Text]

Silverman,J.A., Balakrishnan,R. and Harbury,P.B. (2001) Proc. Natl Acad. Sci. USA, 98, 3092–3097.[Abstract/Free Full Text]

Stryer,L. (1965) J. Mol. Biol., 13, 482–495.[Medline]

Teale,F.W. (1960) Biochem. J., 76, 381–388.[Web of Science][Medline]

Tsuji,T., Yoshida,K., Satoh,A., Kohno,T., Kobayashi,K. and Yanagawa,H. (1999) J. Mol. Biol., 286, 1581–1596.[CrossRef][Web of Science][Medline]

Tsuji,T., Onimaru,M. and Yanagawa,H. (2001) Nucleic Acids Res., 29, e97.[Abstract/Free Full Text]

Uversky,V.N. (1993) Biochemistry, 32, 13288–13298.[CrossRef][Medline]

Wang,J. and Wang,W. (1999) Nat. Struct. Biol., 6, 1033–1038.[CrossRef][Web of Science][Medline]

Watters,A.L. and Baker,D. (2004) Eur. J. Biochem., 271, 1615–1622.[Web of Science][Medline]

Wei,Y. and Hecht,M.H. (2004) Protein Eng. Des. Sel., 17, 67–75.[Abstract/Free Full Text]

Wilkinson,D.L. and Harrison,R.G. (1991) Biotechnology, 9, 443–448.[Medline]

Wong,J.T. (1975) Proc. Natl Acad. Sci. USA, 72, 1909–1912.[Abstract/Free Full Text]

Wright,P.E. and Dyson,H.J. (1999) J. Mol. Biol., 293, 321–331.[CrossRef][Web of Science][Medline]

Yamauchi,A. et al. (1998) FEBS Lett., 421, 147–151.[CrossRef][Web of Science][Medline]

Yonezawa,M., Doi,N., Kawahashi,Y., Higashinakagawa,T. and Yanagawa,H. (2003) Nucleic Acids Res., 31, e118.[Abstract/Free Full Text]

Received March 18, 2005; revised April 29, 2005; accepted May 5, 2005.

Edited by Dan Tawfik


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J R Soc InterfaceHome page
D. T.F Dryden, A. R Thomson, and J. H White
How much of protein sequence space has been explored by life on Earth?
J R Soc Interface, August 6, 2008; 5(25): 953 - 956.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/6/279    most recent
gzi034v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (13)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Doi, N.
Right arrow Articles by Yanagawa, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doi, N.
Right arrow Articles by Yanagawa, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?