PEDS Advance Access originally published online on December 20, 2005
Protein Engineering Design and Selection 2006 19(2):85-90; doi:10.1093/protein/gzj003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SHORT COMMUNICATION |
An improved method for an efficient and easily accessible eukaryotic ribosome display technology
Cambridge Antibody Technology, Granta Park, Milstein Building, Cambridge CB1 6GH, UK
1 To whom correspondence should be addressed. E-mail: julie.douthwaite{at}cambridgeantibody.com
| Abstract |
|---|
|
|
|---|
Ribosome display is a powerful in vitro technology for the selection and directed evolution of proteins. However, this technology has so far been perceived as being technically challenging owing to comparatively difficult protocols and the absence of tailored commercial reagents, particularly when using prokaryotic cell-free expression systems. Eukaryotic ribosome display is potentially a more accessible alternative because of the availability of suitable commercial reagents, yet despite published protocols, this method has been less widely used. For eukaryotic ribosome display, a novel mechanism of mRNA recovery compared with that of the well-proven prokaryotic method has been proposed. We have examined the eukaryotic ribosome display process with the aims of investigating the proposed mechanism of sequence recovery and of identifying aspects of the protocol that may have lead to poor performance and therefore so far limited its use. We demonstrate that the proposed novel method is in fact mechanistically comparable to the prokaryotic method and we provide a step-by-step protocol for eukaryotic ribosome display that is 20-fold more efficient than current published methods. Our findings should increase the ease of operating ribosome display technology, making it more accessible to the scientific community.
Keywords: eukaryotic ribosome display/prokaryotic ribosome display/rabbit reticulocyte lysate/S30 extract
| Introduction |
|---|
|
|
|---|
Ribosome display is a powerful tool for the selection of proteins with specific functions and as such has been demonstrated for the discovery of high-affinity monoclonal antibodies (Hanes et al., 1998
The ribosome display process comprises a series of steps that may be carried out in an iterative manner as required (Figure 1). First, mRNA is transcribed in vitro from DNA encoding a ligand binding molecule or a library of molecules. This is then translated in vitro under conditions that produce stable mRNAribosomeprotein complexes (referred to as ribosome complexes). The ribosome maintains a non-covalent link between genotype and phenotype so that relevant proteins, along with their encoding mRNA, are selected by binding to a target of interest. Recovery of selected mRNA is achieved by dissociation of ribosome complexes and subsequent reverse transcription (RT) and PCR to regenerate cDNA for further rounds of selection or for expression and screening. Since such sequence recovery from ribosome display does not require breakdown of the interaction between the ligand and its binding partner, higher affinity interactions can be efficiently selected for, therefore conferring an additional advantage of ribosome display over other in vitro display technologies such as covalent mRNA display.
|
The earliest demonstrations of ribosome display technology used a prokaryotic in vitro translation system for generation of stable ribosome complexes for selection (Mattheakis et al., 1994
We have investigated aspects of the eukaryotic ribosome display protocol paying particular attention to the proposed mechanism of mRNA recovery. To date there has been only a single comparison of prokaryotic versus eukaryotic ribosome display, although efficiency of mRNA recovery was not considered (Hanes et al., 1999
). We have used real-time PCR analysis to determine relative efficiencies of ribosome complex disruption at the cDNA recovery stage and have addressed the issue of poor success of eukaryotic ribosome display by highlighting that several aspects of the proposed method are sub-optimal. In concluding, we suggest an improved method that requires a minimal number of commercially available reagents and that is both robust and sufficiently efficient for a wide range of protein selection and evolution applications. The proposed protocol should facilitate wider access to ribosome display technology beyond the specialist researcher.
| Materials and methods |
|---|
|
|
|---|
Model proteins for ribosome display
Ribosome display selections were performed using single-chain antibody fragments (scFv) comprising the VH and VL domains of either an IL-13-specific or fluorescein-specific antibody (scFv12; Hanes et al., 1999
).
DNA constructs for ribosome display
The ribosome display constructs contained an scFv coding region and a 3' non-structured tether sequence, derived from the geneIII sequence of filamentous phage, to allow the scFv to be displayed outside of the ribosome tunnel. The T7 RNA polymerase promoter was used for in vitro transcription and the ShineDalgarno or Kozak ribosome binding sequences were used for translation initiation in prokaryotic or eukaryotic systems, respectively. The DNA constructs were prepared by PCR. ScFv coding regions contained in the NcoI/NotI site of the plasmid pCANTAB6 (McCafferty et al., 1994
) were amplified using the forward primer SD (AGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATATCCATGNNNNNNNN, where N is the scFv-specific sequence and the underlined region is the ShineDalgarno sequence) or T7KOZ (GCAGCTAATACGACTCACTATAGGAACAGACCACCATGNNNNNNNN, where N is the scFv-specific sequence and the underlined regions are the T7 RNA polymerase promoter and Kozak sequence), for prokaryotic and eukaryotic ribosome display, respectively, and the reverse primer MycR (ATTCAGATCCTCTTCTGAGATGAG). A separate PCR reaction using the forward primer MycG3 (ATCTCAGAAGAGGATCTGAATGGTGGCGGCTCCGGTTCCGGTGAT) and reverse primer G3rev (CCGTCACCGACTTGAGCC) was performed using pCANTAB6 as template to amplify a region of the geneIII coding sequence for use as the ribosome display tether. PCR products were purified by agarose gel electrophoresis (QIAquick Gel Extraction Kit, Qiagen), assembled by overlap PCR and reamplified with the forward primer T7B (ATACGATAATACGACTCACTATAGGGAGACCACAACGG, where the underlined region is the T7 RNA polymerase promoter) or T7KOZ, for prokaryotic and eukaryotic ribosome display, respectively, and the reverse primer RT-1 (CCGCACACCAGTAAGGTGTGCGGTATCACCAGTAGCACCATTACCATTAGCAAG). PCR products were used directly for in vitro transcription of mRNA.
Generation and selection of ribosome complexes
For prokaryotic ribosome display we used optimized conditions throughout (Hanes et al., 2000a
). For eukaryotic studies we followed the published methods (He and Taussig, 1997
, 2003
), with the exception that separate transcription and translation reactions were used to generate ribosome complexes.
In vitro transcription
mRNA was produced by in vitro transcription using the RiboMax Large Scale mRNA Production kit T7 (Promega). Transcription reactions contained
5 µg of DNA template (PCR product), 25 mM each of rATP, rGTP, rUTP and rCTP and 5 µl of T7 RNA polymerase enzyme mix in a total reaction volume of 50 µl. Transcription was performed for 22.5 h at 37°C. mRNA was purified using a ProbeQuant G50 microcolumn (Amersham Pharmacia) according to manufacturer's instructions and quantitated by spectrophotometry, measuring the absorbance at 260 nm (A260).
In vitro translation
mRNA was translated in vitro using either a prokaryotic or eukaryotic cell-free system to generate stabilized ribosome complexes. For prokaryotic ribosome display, we used an S30 Escherichia coli extract prepared as described previously (Hanes et al., 2000a
). Prokaryotic translation reactions contained 0.2 M potassium glutamate, 6.9 mM magnesium acetate, 90 µg/ml protein disulfide isomerase (Fluka), 50 mM Tris acetate (pH 7.5), 0.35 mM each amino acid, 2 mM ATP, 0.5 mM GTP, 1 mM cAMP, 30 mM acetyl phosphate, 0.5 mg/ml E.coli tRNA, 20 µg/ml folinic acid, 1.5% PEG 8000, 40 µl S30 E.coli extract and 10 µg mRNA in a total volume of 110 µl. Translation was performed at 37°C for 7 min, after which ribosome complexes were stabilized by 5-fold dilution in ice-cold selection buffer [50 mM Tris acetate (pH 7.5), 150 mM NaCl, 50 mM magnesium acetate, 0.1% Tween 20, 2.5 mg/ml heparin]. For eukaryotic ribosome display we used the Flexi Rabbit Reticulocyte Lysate System (Promega). Eukaryotic translation reactions contained 40 mM KCl, 100 µg/ml protein disulfide isomerase (Fluka), 0.02 mM each amino acid, 66 µl rabbit reticulocyte lysate and 10 µg mRNA in a total volume of 100 µl. Translation was performed at 30°C for 20 min, after which ribosome complexes were stabilized by 2-fold dilution in ice-cold PBS
Affinity selection Stabilized ribosome complexes were incubated with biotinylated hapten [50 nM fluoresceinbiotin (Sigma)] or antigen [100 nM IL-13 (Peprotech) biotinylated in-house] as appropriate at 4°C for 12 h, followed by capture on streptavidin-coated M280 magnetic beads (Dynal). Beads were then washed to remove non-specifically bound ribosome complexes. For prokaryotic selections, five washes in ice-cold selection buffer were performed. For eukaryotic selections, three washes in PBS containing 0.1% BSA and 5 mM magnesium acetate were performed, followed by a single wash in PBS alone. Eukaryotic complexes were then incubated with 10 U DNAse I in 40 mM TrisHCl, 6 mM MgCl2, 10 mM NaCl, 10 mM CaCl2 for 25 min at 37°C, followed by three further washes with PBS, 5 mM magnesium acetate, 1% Tween 20.
Recovery of mRNA from selected ribosome complexes
For analysis of mRNA recovery without a specific disruption step, ribosome complexes bound to magnetic beads were directly processed into the reverse transcription reaction. For recovery of mRNA from prokaryotic selections by ribosome complex disruption, selected complexes were incubated in EB20 [50 mM Tris acetate (pH 7.5), 150 mM NaCl, 20 mM EDTA, 10 µg/ml Saccharomyces cerevisae RNA] for 10 min at 4°C. To evaluate the efficiency of the 20 mM EDTA for recovery of mRNA from eukaryotic selections, ribosome complexes were incubated in PBS20 (PBS, 20 mM EDTA, 10 µg/ml S.cerevisae RNA) for 10 min at 4°C. Alternative conditions for disruption of eukaryotic ribosome complexes were used as described in Results and discussion. For both systems, mRNA was purified using a commercial kit (High Pure RNA Isolation Kit, Roche). For prokaryotic samples, the DNAse I digestion option of the kit was performed; however, this step was not required for eukaryotic samples, as DNAse I digestion was performed during post-selection washes. Reverse transcription was performed on either 4 µl of purified RNA or 4 µl of immobilized, selected ribosome complexes (i.e. a bead suspension). For prokaryotic samples, reactions contained 50 mM TrisHCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 1.25 µM RT primer (see Assessment of ribosome complex integrity), 0.5 mM PCR nucleotide mix (Amersham Pharmacia), 1 U RNAsin (Promega) and 5 U SuperScript II (Invitrogen) and were performed by incubation at 50°C for 30 min. For eukaryotic samples, reactions contained 50 mM TrisHCl (pH 8.3), 50 mM KCl, 10 mM MgCl2, 0.5 mM spermine, 10 mM DTT, 1.25 µM RT primer (see Assessment of ribosome complex integrity), 0.5 mM PCR nucleotide mix, 1 U RNasin and 5 U AMV reverse transcriptase (Promega) and were performed by incubation at 48°C for 45 min. To determine the efficiency of mRNA recovery, the level of mRNA remaining bound to beads after deliberate ribosome complex disruption was determined either by incubation of beads in the lysis buffer component of the RNA purification kit (this reagent is optimized for disruption of cells to release mRNA, and therefore elutes all remaining mRNA from any remaining ribosome complexes) or by direct processing of beads post-elution into a reverse transcription reaction.
PCR of selection outputs
End-point PCR End-point PCR was performed to visualize amplification of the full-length construct. A 5 µl sample of each reverse transcription reaction was amplified with 2.5 U Taq polymerase (Roche) in 20 mM TrisHCl (pH 8.4), 50 mM KCl, 1 mM MgCl2, 5% DMSO, containing 0.25 mM PCR nucleotide mix, 0.25 µM forward primer (T7B or T7KOZ for prokaryotic and or eukaryotic experiments, respectively) and 0.25 µM RT primer (described in Assessment of ribosome complex integrity). Thermal cycling comprised 94°C for 3 min, then 94°C for 30 s, 50°C for 30 s and 72°C for 1.5 min for 30 cycles, with a final step at 72°C for 5 min. PCR products were visualized by electrophoresis on an ethidium bromide-stained 1% agarose gel.
Real-time PCR
In order to provide more accurate relative quantitation of selection outputs, a real-time PCR (Taqman) assay was performed. The Taqman assay was targeted to the tether sequence in a region 5' to the annealing region of both RT primers. Real-time PCR reactions were performed in an ABI 7700 (Applied Biosystems) in 25 µl reactions containing 12.5 µl 2x ABI Universal Master Mix (Applied Biosystems), 300 nM each of forward (GCCGCAGAACAAAAACTCATCT) and reverse (AATCAAAATCACCGGAACCG) primer, 200 nM dual labelled (5' FAM, 3' TAMRA) probe (AGCCGCCACCATTCAGATCCTCTTCT) and 5 µl reverse transcription reaction. Relative quantitative data was calculated as 2
CT (a modification of the standard 
CT method since no house-keeping control is required in these experiments).
Assessment of ribosome complex integrity
It has been suggested that RT-PCR performed directly on selected ribosome complexes does not cause disruption of the ribosome complex itself and that this can be determined by the use of reverse transcription primers with different annealing sites (He and Taussig, 2003
, 2005
). It was hypothesized that reverse transcription with a primer annealing upstream of the ribosome will generate cDNA from free mRNA and from a ribosome complex that is intact, whereas reverse transcription with a primer annealing at the very 3' end of mRNA will not recover mRNA from intact ribosome complexes since primer annealing will be prevented by the presence of the ribosome (He and Taussig, 2003
, 2005
). The same approach was taken here, where primer RT-1 (CCGCACACCAGTAAGGTGTGCGGTATCACCAGTAGCACCATTACCATTAGCAAG) anneals at the 3' end and is hypothesized to recover mRNA only from disrupted ribosome complexes, whereas primer RT-2 (CCTTATTAGCGTTTGCCATTTTTTCATAATCAAAATCACCGGA) anneals 118 nucleotides upstream and is hypothesized to recover mRNA from all ribosome complexes.
| Results and discussion |
|---|
|
|
|---|
Direct recovery from selected ribosome complexes
We performed RT-PCR directly on selected ribosome complexes to determine whether the published method for eukaryotic ribosome display does in fact recover mRNA from intact ribosome complexes as was proposed (He and Taussig, 1997
, 2003
, 2005
). For this analysis, we replicated studies performed by others, where different reverse transcription primers were used. In these previous studies, the lack of a PCR product when using a 3' terminal primer for RT was used to conclude the presence of intact ribosome complexes, i.e. the ribosome still bound to mRNA prevented primer annealing during reverse transcription. However, other factors were not considered; for example, it is well known that 3' degradation of mRNA greatly influences the success of RT-PCR reactions primed in this region and in these studies, any 3' end mRNA degradation would reduce the yield of the 3' terminal primer and consequently overestimate the proportion of intact ribosome complexes. We therefore assessed the integrity of purified mRNA (i.e. ribosome-free mRNA) from eukaryotic and prokaryotic ribosome display selections using the two RT primers, prior to analysis of ribosome complex integrity. For mRNA derived from both prokaryotic and eukaryotic ribosome display selections, cDNA yields with the upstream primer RT-2 were typically 2-fold higher than cDNA yields with the 3' primer RT-1 (as described next) and in fact this has been observed previously (Lee et al., 2004
). In our study, this was not due to efficiency of the primers themselves, since cDNA yields with these primers are equivalent for reverse transcription of freshly transcribed mRNA (RT-1 relative cDNA level = 84.14, RT-1 relative cDNA level = 86.32). We therefore suggest that 3' degradation of the mRNA occurs during the selection process and must be taken into account when drawing conclusions from the use of different reverse transcription primers.
Real-time amplification plots and end-point PCR products produced by direct reverse transcription of ribosome complexes with primers RT-1 and RT-2 are illustrated in Figure 2. Despite the fact that no deliberate disruption step was employed, both RT primers were able to generate an RT-PCR product. If ribosome complexes had remained intact, it would be expected that only primer RT-2 would have been successful. Therefore, these data indicate that simply omitting a disruption step is not sufficient to maintain intact ribosome complexes. The degree of ribosome complex disruption determined by real-time PCR, with normalization for mRNA integrity, is shown in Table I. Conditions of the reverse transcription reaction are clearly not compatible with prokaryotic or eukaryotic ribosome complex stability as illustrated by disruption of 81 and 93% of ribosome complexes, respectively.
|
|
mRNA recovery by ribosome complex disruption
The efficiency of EDTA-based ribosome complex disruption as a method of recovering mRNA sequences encoding selected binders was determined for both prokaryotic and eukaryotic ribosome display systems (Figure 3). EDTA elution is clearly highly efficient for disruption of prokaryotic ribosome complexes and recovery of mRNA sequences; however in contrast, EDTA functions very inefficiently as a recovery method from eukaryotic selections. While these data are in agreement with those reported previously (He and Taussig, 2003
, 2005
), our interpretation is that the method of ribosome complex disruption is sub-optimal, rather than that ribosome complex disruption itself is a poor method. We examined alternative conditions for disruption of eukaryotic ribosome complexes. Figure 4 illustrates that increased levels of EDTA alone are not sufficient for efficient eukaryotic ribosome complex disruption and that this is not improved by inclusion of a detergent. We have already demonstrated ribosome complex disruption by conditions used for reverse transcription and this is likely to be a temperature-dependent effect since reverse transcription buffer alone does not disrupt ribosome complexes (data not shown). Therefore, recovery of mRNA by incubation of selected complexes at 50°C was investigated and shown to be successful (Figure 4a). In addition, we show that cDNA product quality produced from mRNA eluted at 50°C is not compromised (Figure 4b), since this is critical for the successful processing for subsequent rounds of ribosome display selection. These results highlight that the method of mRNA recovery should be appropriate and optimal for the nature of the ribosome display system and that direct transfer of a prokaryotic method to a eukaryotic system may result in a very inefficient process.
|
|
Improvement of the eukaryotic ribosome display protocol
In our investigations of mRNA recovery from eukaryotic ribosome display selections, we identified certain aspects of the overall procedure that may be sub-optimal. Based on our experience with prokaryotic ribosome display, we make several recommendations for improving the eukaryotic ribosome display procedure. We suggest that separate transcription and translation allow the most efficient production of stabilized ribosome complexes. In vitro transcription is ideally performed for 2 h to generate a large population of mRNA molecules. However, the ideal duration of in vitro translation to generate stabilized ribosome complexes is significantly shorter. The key is to allow sufficient time for protein translation, while keeping the time sufficiently short to minimize destabilization of complexes and mRNA degradation. In addition, the optimal reaction conditions themselves differ. For example, DTT is required for in vitro transcription but may be incompatible with correct folding of the nascent protein. At all stages of the process, where stabilized eukaryotic ribosome complexes must be maintained, we recommend the presence of 5 mM magnesium and that samples are maintained at 4°C or on ice. Methods that include post-selection steps lacking magnesium and incorporate DNase I digestion at 37°C on intact ribosome complexes are likely to result in the loss of selected complexes by spontaneous disruption. We recommend that DNase I digestion is performed on purified mRNA where it does not impact on selection efficiency. In addition, such relocation of the DNase I digestion step allows for more simple post-selection washing. We recommend mRNA recovery by ribosome complex disruption. This first overcomes the problem that the direct RT-PCR approach is not possible for certain selection scenarios, for example, selection on cell monolayers or on target protein that is immobilized on a solid surface, and second allows mRNA to be purified prior to RT. Performing RT-PCR directly on selected ribosome complexes may be limited in terms of the capacity or efficiency of the reverse transcription step, since here RT is performed in the presence of magnetic beads, ribosomal and other proteins and background RNA and DNA. We suggest that it is preferable to produce a highly pure and concentrated sample of mRNA to allow maximum cDNA synthesis in an optimal reverse transcription reaction.
We have compiled these recommendations and present below a step-by-step procedure, based on commercially available reagents, in order to improve the performance of eukaryotic ribosome display and to increase accessibility to ribosome display technology for non-specialists. We have performed our suggested protocol for ribosome display selection and sequence recovery in parallel to the previously published methods (He and Taussig, 1997
, 2003
) and used cDNA yields as a measure of selection efficiency to determine if the recommendations we describe are of benefit. End-point PCR products generated following selections (Figure 5a) clearly indicate that selection efficiency is higher with the method we describe and real-time PCR analysis of the selection outputs shows the improvement to be a 20.8-fold increase over the previous method. Figure 5b illustrates that cDNA recovery is specific to selection on antigen. Therefore, using our protocol, ribosome display using a eukaryotic system is an efficient technology that requires no specialist reagent development. The improved step-by-step method is as follows.
|
In vitro transcription Using the RiboMax Large Scale mRNA Production kit T7 (Promega), prepare a 50 µl reaction containing 10 µl 5x reaction buffer, 15 µl rNTP pool (final 25 mM each), 5 µg DNA template (PCR product without clean-up) in a 20 µl volume and 5 µl T7 enzyme mix. Mix by pipetting and incubate at 37°C for 2 h. Purify mRNA using a ProbeQuant G50 microcolumn (Amersham Pharmacia) according to manufacturer's instructions and quantitate by measuring A260.
In vitro translation Using the Flexi Rabbit Reticulocyte Lysate system (Promega), prepare a 100 µl translation reaction containing: 16.7 µl water, 2 µl complete amino acid mix (prepared by pooling all three amino acid mixtures), 1.6 µl 2.5 M KCl, 2 µl 5 mg/ml protein disulfide isomerase (Fluka), 66 µl rabbit reticulocyte lysate and 10 µl mRNA at a concentration of 10 µg/µl. Mix gently by pipetting and incubate at 30°C for 20 min.
Selection Transfer the translation reaction to a pre-cooled microfuge tube on ice containing 100 µl PBS and mix gently by pipetting. Add 2 µl 10% autoclaved milk (prepared in water) to block non-specific binding if required. Add the target antigen, suitably labelled for capture, for example coupled to biotin. Incubate at 4°C for 12 h (or as appropriate) with end-over-end mixing.
Capture of selected complexes For biotinylated antigens, add 10100 µl streptavidin-coated M280 beads (Dynal), pre-washed three times in wash buffer (PBS, 5 mM magnesium acetate, 1% Tween 20). Incubate at 4°C for a further 2 min with gentle end-over-end mixing.
Post-selection washes Collect the beads on a magnetic particle concentrator, remove the supernatant and gently resuspend in 500 µl wash buffer. Repeat a further two times (or more if required to improve the signal-to-noise ratio). Ensure complete removal of buffer after the last wash.
Ribosome complex disruption for mRNA recovery Add 200 µl PBS containing 10 µg/ml S.cerevisae RNA and incubate at 50°C for 5 min, vortex mixing occasionally. Collect the beads and process the supernatant for RNA purification. Alternatively, the cell lysis step of the RNA purification kit may be used to recover mRNA as follows: resuspend beads in 200 µl PBS containing 10 µg/ml S.cerevisae RNA and transfer the bead suspension to 400 µl cell lysis buffer for RNA purification (provided in the RNA isolation kit). Vortex mix well. Collect the beads on a magnetic particle concentrator before processing the lysate for mRNA purification.
mRNA purification Use a commercial kit, e.g. the High Pure RNA Isolation Kit (Roche). Include the DNase I digestion step and elute mRNA in 30 µl nuclease-free water. Keep mRNA on ice and proceed to the next step as quickly as possible.
Reverse transcription Prepare a 20 µl reaction containing 4 µl 5x first strand buffer (Invitrogen), 2 µl 0.1 M DTT (Invitrogen), 0.5 µl 25 mM dNTP mix (Amersham Pharmacia), 0.125 µl 100 µM reverse primer, 0.5 µl RNAsin (Promega), 0.5 µl Superscript II (Invitrogen) and 12.25 µl mRNA. Mix well by pipetting and incubate at 50°C for 30 min.
PCR amplification Prepare a 100 µl reaction containing 50 µl 2x Abgene PCR mix, 0.5 µl each 100 µM forward and reverse primer, 5 µl DMSO, 34.5 µl nuclease-free water and 10 µl cDNA. Mix well by pipetting and amplify as appropriate. Visualize PCR products by agarose gel electrophoresis.
Conclusion
We have presented an improved eukaryotic ribosome display method that is mechanistically comparable to that already proven for prokaryotic ribosome display, but has been tailored for the specific requirements of eukaryotic ribosomes. With the improvements that we describe, ribosome display based on a eukaryotic system represents an in vitro evolution technology that is easily accessible owing to the wide availability of suitable commercial translation reagents. In addition, the typically lower RNase content of eukaryotic in vitro translation reagents allows less critical optimization of translation time and the use of a simple buffer system. Finally, our suggested improvements will allow access to other perceived benefits of the eukaryotic system, such as translation of eukaryotic proteins in the presence of a eukaryotic tRNA pool and eukaryotic chaperone proteins.
| References |
|---|
|
|
|---|
Hanes,J., Jermutus,L., Weber-Bornhauser,S., Bosshard,H.R. and Plückthun,A. (1998) Proc. Natl Acad. Sci. USA, 95, 1413014135.
Hanes,J., Jermutus,L. Schaffitzel,C. and Plückthun,A. (1999) FEBS Lett., 450, 105110.[CrossRef][Web of Science][Medline]
Hanes,J., Jermutus,L. and Plückthun,A. (2000a) Methods Enzymol., 328, 404430.[Web of Science][Medline]
Hanes,J., Schaffitzel,C., Knappik,A. and Plückthun,A. (2000b) Nat. Biotechnol., 18, 12871292.[CrossRef][Web of Science][Medline]
He,M. and Taussig,M.J. (1997) Nucleic Acids Res., 25, 51325134.
He,M. and Taussig,M.J. (2003) Eur. Pat. EP985032 B1.
He,M. and Taussig,M.J. (2005) J. Immunol. Methods, 297, 7382.[CrossRef][Medline]
Jermutus,L., Honegger,A., Schwesinger,F., Hanes,J. and Plückthun,A. (2001) Proc. Natl Acad. Sci. USA, 98, 7580.
Lee,M.S., Kwon,M.H., Kim,K.H., Shin,H.J., Park,S. and Kim,H.I. (2004) J. Immunol Methods, 284, 147157.[Medline]
Lipovsek,D. and Plückthun,A. (2004) J. Immunol. Methods, 290, 5167.[CrossRef][Web of Science][Medline]
McCafferty,J., Fitzgerald,K.J., Earnshaw,J., Chiswell,D.J., Link,J., Smith,R. and Kenten,J. (1994) Appl. Biochem. Biotechnol., 47, 157173.[Web of Science][Medline]
Mattheakis,L.C., Bhatt,R.R. and Dower,W.J. (1994) Proc. Natl Acad. Sci. USA, 91, 90229026.
Received April 18, 2005; revised October 28, 2005; accepted November 28, 2005.
Edited by Arne Skerra
![]()
CiteULike
Connotea
Del.icio.us What's this?
Related web sites:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




