PEDS Advance Access originally published online on September 1, 2008
Protein Engineering Design and Selection 2008 21(11):653-658; doi:10.1093/protein/gzn044
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Hetero- and auto-activation of recombinant glutamyl endopeptidase from Bacillus intermedius
1 Institute of Molecular Genetics, Russian Academy of Sciences, Moscow 123182 2 Institute of Energy Problems for Chemical Physics (Branch), Russian Academy of Sciences, Chernogolovka, Moscow 142432 3 Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, Moscow 119992, Russia
4 To whom correspondence should be addressed. E-mail: duk{at}img.ras.ru
| Abstract |
|---|
|
|
|---|
Glutamyl endopeptidase from Bacillus intermedius (BIGEP) is a secretory serine proteinase specifically hydrolyzing peptide bonds involving
-carboxyl groups of glutamic and aspartic acids. In this work, different BIGEP forms (full-length precursor, precursor without signal peptide and mature part) were expressed in Escherichia coli and the process of enzyme maturation was studied in vitro. BIGEP precursor renaturation leads to autocatalytic hydrolysis of the propeptide at Glu(–16). At the same time, the enzyme activation requires the complete removal of the prosequence by other proteinases. The mature part of BIGEP cannot be activated, which indicates that the propeptide is required for the active protein formation. The data obtained allowed us to apply directed mutagenesis of the processing site to obtain a BIGEP form that matured autocatalytically. This approach makes it possible to produce the enzyme without extrinsic proteinases, which is a prerequisite for using it in limited hydrolysis of proteins and peptides.
Keywords: activation/gene expression/glutamyl endopeptidase/precursor maturation/protein renaturation
| Introduction |
|---|
|
|
|---|
Glutamyl endopeptidase from Bacillus intermedius (BIGEP) is a secretory serine proteinase of the structural family of chymotrypsin. BIGEP specifically hydrolyzes bonds involving
-carboxyl groups of glutamic and aspartic acids. Previously, the BIGEP gene was cloned, sequenced and expressed in a laboratory strain of Bacillus subtilis (Rebrikov et al., 1999Proteolytic enzymes with a narrow substrate specificity including BIGEP are suitable for limited hydrolysis of proteins and peptides, which makes them indispensable in mass spectrometry-based proteomic studies. Such enzymes are used to determine the primary structure and domain organization as well as to identify proteins. They can also be applied in sequence-specific hydrolysis of fusion proteins and the production of biologically active peptides.
Heterologous expression is the most efficient approach to produce proteins for both research and applied purposes. At the same time, the proper protein folding problem appears when this technique used. Most secretory proteinases (including BIGEP) are synthesized as precursors, and their propeptide is required for proper folding in many of them (Shinde and Inouye, 2000
; Demidiuk et al., 2003
). At the same time, it should be removed for active enzyme production. If the cleavage is autocatalytic, spontaneous maturation is commonly observed after renaturation of a proteinase expressed in a heterologous system (Ikemura and Inouye, 1988
; Silen et al., 1989
; Marie-Claire et al., 1998
). However, some enzymes, typically proteinases with a narrow substrate specificity (like BIGEP), cannot cleave off their propeptide, and an additional proteolytic enzyme is required. At the same time, extrinsic proteinases are undesirable in experiments, since their removal is redundant and sometimes non-trivial. An admixture of a heterologous activating enzyme is inadmissible in limited proteolysis that relies on highly specific proteinases.
The BIGEP precursor includes the signal peptide, propeptide and mature moiety. The propeptide can be autocatalytically removed in glutamyl endopeptidases only if a Glu–Xaa bond is present in the processing site (Stennicke et al., 1996
; Park et al., 2004
); otherwise, other enzymes are required for the activation (Park et al., 2004
; Trachuk et al., 2005
; Nickerson et al., 2007
; Nemoto et al., 2008
). During the BIGEP maturation, a Lys–Val bond is hydrolyzed and, hence, this enzyme is likely activated by another proteinase in vivo. By analogy with glutamyl endopeptidases from Bacillus licheniformis (Trachuk et al., 2005
) and Staphylococcus aureus (V8 protease) (Nemoto et al., 2008
), one could expect that the BIGEP expressed in a heterologous system requires to be activated by another enzyme with the corresponding specificity.
In this work, different BIGEP forms were expressed in E.coli cells, and the enzyme maturation process was studied in vitro. The obtained data allowed us to propose an approach to produce proteinases with a narrow substrate specificity involving no extrinsic proteolytic enzymes.
| Materials and methods |
|---|
|
|
|---|
Materials
In this work, we used tris-(hydroxymethyl)aminomethane (Tris), 2-(N-morpholino)ethanesulfonic acid (MES), azocasein, bromophenol blue, ethidium bromide, isopropyl-β-D- thiogalactopyranoside (IPTG), 5-bromo-4-chloro-3-indolyl-β- D-galactopyranoside (X-gal), cacodylic acid sodium salt, glutaraldehide, 1,10-phenanthroline, bovine trypsin (Sigma, USA), Coomassie brilliant blue R-250 (Bio-Rad, USA), glycerol (ICN Pharmaceuticals, USA), Pfu DNA polymerase, T4 polynucleotide kinase, Taq DNA polymerase, T4 DNA ligase, restriction endonucleases and the corresponding buffers (SybEnzyme, Russia), oligonucleotides (Syntol, Russia), yeast extract, tryptone (Roth, Germany), phenylmethylsulphonyl fluoride (PMSF) and thermolysin from Bacillus thermoproteolyticus (Serva, Germany). Recombinant B.intermedius glutamyl endopeptidase (BIGEP-Bs) was purified from B.subtilis AJ73 strain as described previously (Rebrikov et al., 1999
). Bacillus intermedius subtilisin (Balaban et al., 2004
) and N-benzyloxycarbonyl-L-glutamyl-p-nitroanilide (Z-E-pNA) were kindly provided by Dr G.N. Rudenskaya (Faculty of Chemistry, Lomonosov Moscow State University). All other chemicals were of reagent grade and were purchased from Dia-M (Russia).
Protein electrophoresis (SDS–PAGE) was performed in vertical 12.5% polyacrylamide slab gels with 0.1% sodium dodecyl sulfate (Laemmli, 1970
) using a Molecular Weight Marker Kit 14–70 kDa (Sigma).
Protein quantity was determined by optical density (OD) measurements at 260 and 280 nm on an Agilent 8453 spectrophotometer (USA). Concentration was calculated using formula [C] mg/ml = 1.55 x OD280 – 0.76 x OD260 (Dawson et al., 1987
).
The signal peptide processing site was predicted in the BIGEP sequence using the SignalP 3.0 server (http://www.cbs.dtu.dk/services/SignalP) (Nielsen et al., 1997
).
Total proteolytic activity was evaluated by azocasein cleavage as described previously (Demidyuk et al., 2004
).
The activity of BIGEP on specific substrate was evaluated after the addition of 50 µl of the enzyme to 200 µl of 1.4 mM Z-E-pNA in 25 mM Tris–HCl (pH 8.0) and incubation at 37°C for 30–90 min. The reaction was stopped by adding 100 µl of 1 M potassium acetate (pH 4.5), and OD410 was measured. The activity unit was defined as the amount of the enzyme releasing 1 µmol p-nitroaniline per minute.
For MALDI mass spectrometric analysis of tryptic hydrolysates of recombinant proteins, 10–100 µl of protein sample (0.02–0.4 mg/ml) was supplemented with a half volume of 50% trichloroacetic acid and centrifuged at 10 000g for 10 min. The pellet was washed three times with 200 µl of acetone, incubated at 37°C for 5 min and dissolved in 20 µl of 10 mM Tris–HCl (pH 7.2). The solution was supplemented with 1 µl of 0.05 mg/ml trypsin and incubated at 37°C for 4 h. Mass spectrometric analysis was conducted using a tandem quadrupole time-of-flight mass spectrometer QSTAR (MDS Sciex, Canada) with an Ortho-MALDI ion source using
-CHC matrix (Agilent).
For N-terminal sequencing, the proteins after SDS–PAGE were transferred to PVDF membrane (Amersham Biosciences). The bands corresponding to the processed BIGEP forms were cut out. N-terminal amino acid sequence of proteins was determined by automated Edman degradation using a Model 477A Protein Sequencer (Applied Biosystems, USA) equipped with a Model 120A PTH Analyzer (Applied Biosystems).
Modified BIGEP genes encoding the full-length precursor (SPM), precursor without the secretory leader (PM) and mature part enzyme (M) were generated by PCR using the p58.21 plasmid (Rebrikov et al., 1999
) as template. The following primer pairs were used: SPM, SigNI (ataaaggaggcatatgatgatgaaaaagg) and EndHIII (ggaaacaagctttgtgctc); PM, ProNI (tttgcccatatgacatcggattcagtactaac) and EndHIII; and M, MatNI (caaacacatatggtcattggagacgatggaag) and EndHIII. The gene encoding the BIGEP precursor with a Lys(–1)
Glu substitution (PEM) was generated by the megaprimer method of site-directed mutagenesis (Sarkar and Sommer, 1990
) using the E-1 (ctttcaaacagaagtcgtcattg) primer to introduce the nucleotide substitutions (boldfaced) as well as the flanking ProNI and EndHIII pair. All PCR products included NdeI and HindIII restriction sites at their termini (underlined above). The amplification products were phosphorylated and cloned into the HincII site of pUC19. The resulting plasmids were introduced into E.coli TG1 cells. The structure of all constructs was confirmed by sequencing and the BIGEP gene fragments were cloned into the NdeI and HindIII sites of pET23b(+) (Novagen, USA). Escherichia coli BL21(DE3) cells were transformed by the resulting vectors (pSPM, pPM, pM and pPEM).
Purification of recombinant proteins
Escherichia coli BL21(DE3) cells containing pSPM, pPM, pM or pPEM were grown at 37°C with agitation (200 rpm) in 100 ml of Luria–Bertani medium (with 100 µg/ml ampicillin) to OD600 = 0.5 –0.7. Then the medium was supplemented with IPTG to a final concentration of 0.1 mM, and growth continued for 4 h. Cells were harvested by centrifugation (4000g, 5 min), resuspended in 5 ml of 25 mM Tris–HCl (pH 8.0) and disintegrated by ultrasonication. The cell lysate was centrifuged (10 000g, 10 min) and 2.5 ml of 50 mM MES–NaOH (pH 6.0) containing 8 M urea was added to the pellet. After a 1 h incubation at 20°C, the solution was centrifuged (10 000g, 10 min) and the supernatant was applied to an 1 ml Econo-Pac High S cartridge (Bio-Rad) equilibrated with 50 mM MES–NaOH (pH 6.0) containing 8 M urea. Elution was carried out with a linear gradient of 0–1 M NaCl in the same buffer (100 ml) at a flow rate of 1.0 ml/min. The fraction with the target protein (0.5 ml) was applied to a Superdex 200 HR 10/30 column (Amersham Biosciences) equilibrated with 25 mM Tris–HCl (pH 8.0) containing 8 M urea and 0.15 M NaCl. Proteins were eluted with the same buffer at a flow rate of 0.5 ml/min. The purification process was controlled by electrophoresis.
Renaturation and activation of recombinant proteins
BIGEP in 25 mM Tris–HCl (pH 8.0) containing 8 M urea and 0.15 M NaCl was diluted 15-fold with 25 mM Tris–HCl (pH 8.0) containing 25% glycerol and 0.15 M NaCl in some cases supplemented with 1 mM 1,10-phenanthroline and 1 mM PMSF. After 12 h incubation at 4°C, samples were taken for the activity assays and SDS–PAGE. Then the SPM and PM samples were exposed to a proteinase (BIGEP-Bs, trypsin, subtilisin or thermolysin) at a 100:1 ratio (w/w), incubated at 4°C for 12 h, and samples for the activity assays and SDS–PAGE were taken again.
The intracellular localization of recombinant BIGEPs was visualized by electron microscopy. Escherichia coli BL21 (DE3) cells containing pSPM, pPM, pM or pET23b(+) were grown as described in the Purification of Recombinant Proteins section. Cells were prepared using the standard technique with 0.2 M cacodylic acid-NaOH buffer (pH 7.5) and 2% glutaraldehyde as a fixative. Sections were cut on an LKB III ultratome (Sweden) and examined under a JEM-100CX electron microscope (JEOL, Japan) at an accelerating voltage of 80 kV.
| Results |
|---|
|
|
|---|
Production of recombinant proteins
We have constructed the pM, pPM, pSPM and pPEM vectors expressing the following BIGEP forms: mature part (M), precursor without the signal peptide (PM), full-length precursor (SPM) and precursor without the signal peptide and with a Lys(–1)
Glu substitution (PEM), respectively (Fig. 1A).
|
The expression of recombinant BIGEP genes in E.coli BL21(DE3) cells resulted in the accumulation of all proteins (SPM, PM, PEM and M) in an insoluble form. At the same time, electron microscopy indicated different cellular localization of the inclusion bodies (Fig. 2). The full-length BIGEP precursor (SPM) was found in the periplasmic space, whereas all other forms localized in the cytoplasm. This finding indicates that the signal peptide provides for the secretion of BIGEP in E.coli cells.
|
The recombinant proteins (SPM, PM, PEM and M) were purified in the presence of 8 M urea by cation exchange chromatography and gel permeation chromatography to electrophoretic homogeneity (Fig. 3). The purification process is shown in Table I.
|
|
Structure of recombinant proteins
The primary structure of SPM, PM, PEM and M was verified by MALDI mass spectrometry analysis after trypsinolysis.
The tryptic hydrolysates of SPM included 52%, PM 67%, PEM 52%, M 61% of theoretical tryptic fragments. The sets of PM, PEM and M fragments completely corresponded to the proteins encoded by the modified genes. Moreover, N- and C-terminal peptides were found. Its masses for PM were 4129.972 Da [digestion after K(–26)] and 1642.845 Da (after K200); for PEM 2050.966 Da [after K(–33)] and 1642.849 Da (after K200); and for M 1059.542 Da (after K10) and 1642.801 Da (after K200), respectively. Besides, in the case of PEM, there was found a peptide with a molecular weight of 1449.692 Da which corresponds to the sequence D(–5)FQTEVVIGDDGR(8) with Lys(–1)
Glu modification.
In the case of SPM, C-terminal peptide was the same as for M, PM, PEM (1642.785 Da, digestion after K200), but no fragment corresponding to the gene coding N-terminal region was found. Instead, there was a peptide with a molecular weight of 1920.838 Da, which corresponds to the sequence T(–62)SDSVLTSDYDMVTSDGK(–45) in the BIGEP precursor. Then the N-terminal sequencing of SPM was performed. The first five amino acids of SPM were TSDSV. This data indicate that the first 26 amino acids that correspond to the theoretically predicted signal peptide were removed in SPM. Thus, the primary structure of SPM differed from that of PM only by the absence of the start methionine (Fig. 1).
Maturation of recombinant proteins
Purified SPM, PM, PEM and M were renatured in the presence of 25% glycerol and 0.15 M NaCl, whereas the urea concentration was decreased to 0.53 M by a single dilution. (The maturation diagram is shown in Fig. 1B.). In the case of SPM and PM, 50–70% of protein was converted into the intermediate form (IntF) (Fig. 4A shows the data for SPM). According to SDS–PAGE, the molecular weight of IntF was
25 kDa, which was higher than the mature protein (22.8 kDa) and lower than the precursor (29.5 kDa). This form was isolated from polyacrylamide gel, N-terminal sequence of IntF was determined: KVKPL. So the intermediate resulted from the hydrolysis of the Glu(–16)–Lys bond in the propeptide. Thus, the molecular weight of the intermediate calculated from the sequence was 24.7 kDa. IntF was stable in solution at 4°C for at least 90 days. The addition of PMSF, an inhibitor of serine proteinases, and 1,10-phenanthroline, an inhibitor of metalloproteinases, had no effect on the intermediate formation. The activities of IntF on azocasein or Z-E-pNA were undetectable. The exposure to bovine trypsin or B.intermedius subtilisin (but not thermolysin or BIGEP-Bs) converted IntF into an active form with the electrophoretic molecular weight coinciding with that of BIGEP-Bs (
23 kDa).
|
No intermediate was detected in the case of PEM, 50–70% of this protein incubated at 4°C for 12 h converted into an active form with a molecular weight of
23 kDa (Fig. 4B). The presence of PMSF and 1,10-phenanthroline had no effect on this process. The MALDI mass spectrometric analysis of tryptic hydrolysates of derived from SPM, PM and PEM active forms demonstrated their structural identity to the mature wild-type BIGEP sequence. The N-terminal sequences of active forms derived from PEM and PM were identical to the mature wild-type BIGEP N-terminal sequence (VVIGD) too.
Activity on specific substrate (Z-E-pNA) of all mature BIGEP forms derived from the precursors (SPM, PM and PEM) expressed in E.coli was 1.6 ± 0.1 U/mg, which corresponds to the activity of native BIGEP determined previously (Leshchinskaya et al., 1997
). The azocasein digestion activity of the enzymes derived from SPM, PM and PEM (31 ± 0.1 U/mg) and wild-type BIGEP was also similar (Demidyuk et al., 2004
).
The mature part of BIGEP (M) expressed in E.coli and purified and treated similar to SPM, PM and PEM aggregated to form a pellet after the denaturing agent concentration decreased. No activity was detectable in the pellet and supernatant. Thus, the propeptide absence in the recombinant BIGEP rendered the formation of an active enzyme impossible under experimental conditions.
| Discussion |
|---|
|
|
|---|
Similar to many secretory proteinases, BIGEP is synthesized as a precursor that includes the mature part, prosequence and signal peptide. Currently, the role of the propeptides removed during the maturation of glutamyl endopeptidases is unknown.
The BIGEP propeptide is cleaved at the Lys–Val bond, which does not correspond to the primary specificity of the enzyme. In such cases, the processing is carried out by other proteolytic enzymes, as demonstrated previously for glutamyl endopeptidases from B.subtilis and S.aureus (V8 protease) cleaved by subtilisin-like bacillopeptidase F and metalloproteinase aureolysin, respectively (Park et al., 2004
; Nickerson et al., 2007
). Extrinsic proteinases were also required to activate the precursor of glutamyl endopeptidase from B.licheniformis and V8 protease in vitro (Trachuk et al., 2005
; Nemoto et al., 2008
). Thus, similar to these examples, the BIGEP precursor synthesized in a foreign organism most likely requires the heteroactivation. However, understanding the mechanism of BIGEP maturation allows us to get around this problem.
We studied the process of BIGEP maturation by expressing the enzyme precursor that includes the prosequence and mature part without the signal sequence (PM) in E.coli. Similar to glutamyl endopeptidases from B.licheniformis (Trachuk et al., 2005
) and S.aureus (Nickerson et al., 2007
), the PM maturation proceeded in steps. At the first step, the propeptide was cleaved off at Glu(–16) to yield the intermediate form (IntF). The IntF formation was independent of the inhibitors PMSF and 1,10-phenanthroline, which corresponds to the BIGEP properties. This findings as well as the nature of the bond (Glu–Lys) hydrolyzed in the propeptide suggest the autocatalytic mechanism of the intermediate form generation. At the same time, no IntF activity was detected. This fact may be explained by a very low activity that cannot be detected by methods used. Other explanations that may be proposed are an intramolecular processing of BIGEP precursor at first step and/or inhibition of IntF activity by the few remaining amino acids of propeptide.
At the next stage, the BIGEP activation required the removal of the remaining propeptide fragment by proteinases with the corresponding substrate specificity (trypsin and subtilisin). The mature BIGEP obtained after the precursor heteroactivation was indistinguishable from the wild-type enzyme by the primary structure and specific activity. It is of interest that the processing of protease V8 in vitro is mediated by thermolysin (Nemoto et al., 2008
). However, the exposure of BIGEP intermediate to thermolysin yielded no mature enzyme. This can be attributed to different structure of the processing site in these glutamyl endopeptidases, despite the significant similarity of the N-terminal sequences of the mature proteins.
Thus, the data obtained demonstrate that other proteinases are required to produce active BIGEP expressed as a precursor in E.coli.
In some cases of heterologous expression of protein precursors in E. coli, their secretion leads to the correct maturation (Ikemura et al., 1987
; Suh and Benedik, 1992
). We tested this effect for BIGEP by expressing the full-length precursor including the proper signal peptide. Electron microscopy of E.coli cells carrying the corresponding plasmid (pSPM) demonstrated the protein localization to the periplasmic space, which indicates that the BIGEP signal sequence provides for its secretion. The primary structure analysis of the purified protein demonstrated the absence of the signal peptide and its detachment at the predicted site. At the same time, no active enzyme was generated after the secretion, and the properties and maturation of this precursor variant (SPM) were the same as in the precursor expressed without the secretory leader (PM).
Some proteinases synthesized in vivo as a precursor proved to form an active protein without the propeptide involved (Mansfeld et al., 2005
; Pulido et al., 2006
). With this in mind, we tried to produce an active enzyme by expressing the BIGEP mature part alone. However, no enzyme activity was observed despite the attempts to renature it. This fact coupled with efficient formation of active BIGEP from the precursor indicates that the propeptide is most likely required for the correct folding of BIGEP.
Considering the capacity of the BIGEP precursor for autocatalytic hydrolysis of the propeptide at Glu(–16) as well as the data on autocatalytic in vivo processing of related enzymes [glutamyl endopeptidases from B.subtilis (Park et al., 2004
) and Streptomyces griseus (Stennicke et al., 1996
)], we constructed a BIGEP precursor gene with a mutation modifying the processing site to correspond to the BIGEP substrate specificity. This gene encoded no signal sequence, since the BIGEP precursor secretion had a negative effect on the cell culture growth and protein accumulation. After renaturation, the resulting mutant precursor with a Lys(–1)
Glu substitution gave rise to a mature BIGEP indistinguishable from the wild-type enzyme by the primary structure and specific activity. The maturation of such precursor was autocatalytic, i.e. required no other enzymes.
Thus, we studied the process of BIGEP precursor maturation in vitro and demonstrated the significance of the propeptide for active protein formation. The data obtained suggested an efficient approach to produce proteinases with a narrow substrate specificity in heterologous expression systems. This approach involves the creation of an enzyme variant capable of self-activation by modifying its processing site.
| Funding |
|---|
|
|
|---|
This work was supported by the Russian Foundation for Basic Research (project nos. 06-04-48678 and 06-04-48690) and the Federal Program R&D in Priority Directions of the Russian Scientific-Technological Complex Development in 2007–2012" (the state contract no. 02.522.11.2005 [EC] ).
| Footnotes |
|---|
Edited by Jacques Fastrez
| References |
|---|
|
|
|---|
Balaban N.P., Mardanova A.M., Sharipova M.R., Gabdrakhmanova L.A., Sokolova E.A., Rudenskaya G.N., Leshchinskaya I.B. Biochemistry (Mosc.) (2004) 69:420–426.[CrossRef][Medline]
Dawson M.C., Elliott D.C., Elliott W.H., Jones K.M. Data for Biochemical Research (1987) Oxford: Oxford University Press.
Demidiuk I.V., Zabolotskaia M.V., Velishaeva N.S., Safina D.R., Kostrov S.V. Mol. Gen. Mikrobiol. Virusol. (2003) 4:11–15.[Medline]
Demidyuk I.V., Romanova D.V., Nosovskaya E.A., Chestukhina G.G., Kuranova I.P., Kostrov S.V. Protein Eng. Des. Sel. (2004) 17:411–416.
Ikemura H., Inouye M. J. Biol. Chem. (1988) 263:12959–12963.
Ikemura H., Takagi H., Inouye M. J. Biol. Chem. (1987) 262:7859–7864.
Laemmli U.K. Nature (1970) 227:680–685.[CrossRef][Web of Science][Medline]
Leshchinskaya I.B., et al. Biochemistry (Mosc.) (1997) 62:903–908.[Medline]
Mansfeld J., Petermann E., Durrschmidt P., Ulbrich-Hofmann R. Protein Expr. Purif. (2005) 39:219–228.[CrossRef][Web of Science][Medline]
Marie-Claire C., Roques B.P., Beaumont A. J. Biol. Chem. (1998) 273:5697–5701.
Meijers R., Blagova E.V., Levdikov V.M., Rudenskaya G.N., Chestukhina G.G., Akimkina T.V., Kostrov S.V., Lamzin V.S., Kuranova I.P. Biochemistry (2004) 43:2784–2791.[CrossRef][Web of Science][Medline]
Nemoto T.K., Ohara-Nemoto Y., Ono T., Kobayakawa T., Shimoyama Y., Kimura S., Takagi T. FEBS J. (2008) 275:573–587.[Medline]
Nickerson N.N., Prasad L., Jacob L., Delbaere L.T., McGavin M.J. J. Biol. Chem. (2007) 282:34129–34138.
Nielsen H., Engelbrecht J., Brunak S., von Heijne G. Protein Eng. (1997) 10:1–6.
Park C.H., Lee S.J., Lee S.G., Lee W.S., Byun S.M. J. Bacteriol. (2004) 186:6457–6464.
Pulido M., Saito K., Tanaka S., Koga Y., Morikawa M., Takano K., Kanaya S. App.l Environ. Microbiol. (2006) 72:4154–4162.
Rebrikov D.V., Akimkina T.V., Shevelev A.B., Demidyuk I.V., Bushueva A.M., Kostrov S.V., Chestukhina G.G., Stepanov V.M. J. Protein Chem. (1999) 18:21–27.[CrossRef][Web of Science][Medline]
Sarkar G., Sommer S.S. Biotechniques (1990) 8:404–407.[Web of Science][Medline]
Shinde U., Inouye M. Semin. Cell. Dev. Biol. (2000) 11:35–44.[CrossRef][Web of Science][Medline]
Silen J.L., Frank D., Fujishige A., Bone R., Agard D.A. J. Bacteriol. (1989) 171:1320–1325.
Stennicke H.R., Birktoft J.J., Breddam K. Protein Sci. (1996) 5:2266–2275.[Web of Science][Medline]
Suh Y., Benedik M.J. J. Bacteriol. (1992) 174:2361–2366.
Trachuk L.A., Shcheglov A.S., Milgotina E.I., Chestukhina G.G. Biochimie (2005) 87:529–537.[CrossRef][Web of Science][Medline]
Received May 8, 2008; revised July 21, 2008; accepted July 29, 2008.
![]()
CiteULike
Connotea
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



